sci_philosophy EDGARS IMANTS SILINŠ Lielo patiesību meklējumi

Lielo patiesību meklējumi

EDGARS IMANTS SILINŠ

Esejas

par ideju un paradigmu vēsturi no senkīniešu Dao filozofijas un dzenbudisma līdz mūsdienu kvantu fizikai, sinerģētikai, haosa teorijai un fraktēju ģeometrijai.

Paradigmu sasaikne un izomorfisms laikmetu kultūrslāņos Austrumos un Rietumos.

Ideju un paradigmu tīkls laika horizontālās un vertikālēs

Sīs esejas iecerētas kā netradicionāls ieskats Lielo Patiesību meklējumos Cilvēces pasaules izziņas un izpratnes vēsturiskās attīstības gaitā. Apskatot problēmu no vissenākajiem pirmsākumiem līdz mūsdienām, mēs — pretēji tradicionālajai pieejai — atsakāmies no ierastā vēsturiski hronoloģiskā izklāsta. Savu stāstījumu sāksim ar to, ka mūsu 20. gadsimta ietvaros Lielo Patiesību meklējumi noveda pie modernās kvantu fizikas, vispārīgās relativitātes teori­jas, Gēdela teorēmas, kosmosa evolūcijas Lielā Sprādziena (Big Banģ) modeļa, haosa teorijas, sinerģētikas — visjaunākās mūsdienu integrālās zinātnes, kā ari netradicionālās fraktāļu ģeometrijas — ģeometrijas, kas apraksta kā dzīvās, tā nedzīvās dabas daudzveidīgās neregulārās formas.

JUMAVA

Grāmata izdota ar Sorosa fonda—Latvija, Kultūrkapitāla fonda un Vines Rotari kluba finansiālu atbalstu

Zinātniskais redaktors Dr. hab. phys., Dr. h. c. chem. Jāzeps Eiduss

Redaktore Indra Ozoliņa

Māksliniece Māra Rikmane

Datorgrafiķis Andris Bergmanis

Maketētāja Rūta Vilīte

ISBN - 9984 - 05 -186 - 2

«Jumava», 1999

teksti, 1999 O Māra Kikmane,

«Dybe sandheder» er udsagn, hvoraf det omvendte ogsā er en dyb sandhed.

Niels Bohr

Great truth is a truth who s opposite is also a great truth.

Niels Bohr

Liela Patiesība ir Patiesība, kuras pretmets arī ir liela Patiesība.

Nilss Bors

lv lv
Imants Ločmelis imantslochmelis@inbox.lv FB Editor v2.0 26 August 2010 E17AD657-2D35-4CED-91A7-3133AF711A8A 1.0 Lielo patiesību meklējumi «Jumava», 1999

Lielo patiesību meklējumi

EDGARS IMANTS SILINŠ

Esejas

SATURA RĀDĪTĀJS

1.  LIELO PATIESĪBU KOMPLEMENTAR1TĀTE; 13 DAO/A/VUN /^PRINCIPS

2.   LIELĀS PATIESĪBAS UN TRIVIĀLĀS PATIESĪBAS. 17 KŪNA PARADIGMAS

3.  ĢEOCENTRISKĀ UN HELIOCENTRISKĀ PARADIGMA. 19 EMPĪRISKIE FAKTI UN INTELEKTUĀLIE MODELI

4.   ŅŪTONA MEHĀNIKA UN DETERMINISMA PARADIGMA 22

5.  GAISMAS FIZIKĀLĀS DABAS PĒTĪJUMI «UZSPRIDZINA» 25 DETERMINISMU

5.1.   Priekšstati par gaismu seno tautu mitoloģijā un 25 pirmsņūtona zinātnē

5.2.   Ņūtons postulē korpuskulāro gaismas teoriju 28

5.3.   Gaismas vijpu teorijas triumfs 29

5.4.   Korpuskulārā un viļņu paradigma 29 kā komplementāri pretmeti

5.5.   Determinisms un indeterminisms 32 kā komplementāri pretmeti

6.   EINŠTEINA RELATIVITĀTES TEORIJA UN JAUNĀ 34 PARADIGMA ĢEOMETRIJĀ

7.  JAUNO 20. GADSIMTA PARADIGMU VIENOTAIS 35 KULTŪRSLĀNIS

8.   KVANTU FIZIKAS DZIMTAS VIETAS: 37 KEMBRIDŽA, GETINGENE, KOPENHĀGENA

9.   KOMPLEMENTAR1TĀTES PRINCIPS, TĀ VĒSTURISKĀS 40 SAKNES UN UNIVERSĀLA NOZĪMĪBA

10.  JANUN IŅPRETMETI SENĶlNIESU «DAODEDZIN» UN 43 «IDZIN» TEKSTOS Trejādība «Idzin» trigrammas un ikebanas simbolikā 50

11.                                    JANVH PRETMETU LĪDZĪBAS RIETUMU PASAULĒ 52

12.   KONKRĒTAIS UN ABSTRAKTAIS. NO TĒLA UZ 61 SIMBOLU UN ZlMI

13.  ANIMA UN ANIMUSPRETMETU SIMBIOZE 69

14.  DAĻIŅAS UN VILNA KOMPLEMENTARITĀTE 72 KVANTU FIZIKA

15.  VIELAS UN ENERĢIJAS PRETMETI 75

16.  NENOTEIKTĪBAS RELACIJA UN 77 KOMPLEMENTARITĀTES PRINCIPS

17.  INDRAS TIKLA METAFORA 80

18.  ATOMMODEĻI, ORBĪTAS UN ORBITALES. 81 PULKSTEŅA UN MAKONA METAFORA

19.  KOPENHĀGENAS SUPERZVAIGZŅU KVINTETS UN 86 VIENTUĻNIEKS ALBERTS EINŠTEINS

20.  NEPIECIEŠAMĪBA VAI GADĪJUMS? 89 ATBILDI ROD SINERGĒTIKA

21.  DAZl NOZĪMĪGĀKIE SINERGĒTIKAS PAMATJĒDZIENI 92

22.  LIKTENIS, GADĪJUMS, BRlVĀ GRIBA 95

23.  NEPIECIEŠAMĪBAS UN GADĪJUMA KATEGORIJA 97 MŪSDIENU ZINĀTNĒ

24.  INTELEKTUĀLIE MODELI, DOMU EKSPERIMENTI 102 UN TIEŠA PIEREDZE

25.  DAUDZDALINU ANSAMBLI. ENTROPIJA KĀ 105 STATISTISKS HAOSA MĒRS

26.  BIOLOĢISKĀ EVOLŪCIJA «UZSPRIDZINA» 109 KLASISKO TERMODINAMIKU

27.  NELĪDZSVAROTO SISTĒMU TERMODINAMIKA. 111 PRIGOŽINS UN BRISELES SKOLA

28.  TAURIŅA EFEKTS. LAVĪNAS, ORKĀNI, ATOMBUMBA 113

29.  INTEGRĀLO ZINĀTŅU PARADIGMAS. KIBERNĒTIKA 115 UN INFORMĀCIJAS TEORIJA

30.  ENTROPIJAS UN INFORMĀCIJAS PRETMETI 119

31.  INFORMĀCIJAS AKUMULĀCIJA DZĪVAJĀ DABĀ 120

32.  HAOSS, KOSMISKAIS TUKŠUMS UN FIZIKĀLAIS 124 VAKUUMS

33.  ELEMENTĀRDAĻIŅU «SPIETS» UN ŠIVAS 130 KOSMISKĀ DEJA

34.  KVANTU HROMODINAMIKA. KRĀSAINIE KVARKI UN 132 BALTIE NUKLONI

35.  MIKRO PASAULES «STIGU ORĶESTRIS» 136

36.  MELNIE CAURUMI UN KVANTU KOSMOLOĢIJA 140

37.  LIELA SPRĀDZIENA (BIG BANG) MODELIS 143

38.  LIELĀ SPRĀDZIENA (BIG BANG) SCENĀRIJS 146

39.   visuma arhitektonika un dimensijas 149

40.   zemes ķīmiskas un bioloģiskās evolūcijas 152 scenārijs

41.   mūžības mirkli, kosmiskā gada alegorija 165

42.   mūžīgais un mirklīgais. akmens un 167 zieda metaforas

43.   einšteins: «es gribu zināt, kā dievs radīja šo 170 pasauli.» dieva eksistences iracionālā būtība

44.   labais un ļaunais — polāri vai 176 komplementāri pretmeti?

45.   einšteins: «vai dievam bija kāda izvēles iespēja 185 pasaules radīšanā?»

46.   deduktīvo sistēmu nepilnība. gēdela teorēma 188

47.   loģiskie paradoksi un «dīvainās cilpas» 193

48.   dzenbudisms un koanu paradoksi 195

49.   eikllda un neeiklīda ģeometrija 198

50.   ģeometrija un tēlotāja māksla 201

51.   dažādu arhitektūras stilu 205 komplementaritātes piemēri austrumos

un rietumos

52.   filozofiskas ievirzes glezniecības paraugi 212 austrumos un rietumos. sesju un

leonardo da vincl

53.   dabas fraktāļu ģeometrija 218

54.   fraktāļu iedīgli. georga kantora 219 «paradīzes putekli»

55.   mandelbrota fraktāli — jauna ģeometrijas 220 paradigma

56.   fraktāli un deterministiskais haoss 221

57.   brauna kustība ka deterministiskā 223 haosa prototips

58.   haoss, trokšņi «baltā», «brūnā» un «rozā» mūzika 225

59.   paradigmu maina mūzikā. no baha un 229 mocarta līdz šēnbergam un keidžam

60.   mūzikas un haosa elementi abstraktajā māksla 237

61.   dažas fraktāļu īpašības 239

62.   leduspuķu fraktāli tomasa manna skatījuma 243

\

63.   fraktāli dzīvajā daba. haoss un adaptivitāte 244

64.   SMADZEŅU VEIDOŠANAS CILVĒKA EMBRIJA 247

65.   EMBRIJA MORFOĢENĒZE DETERMINISTISKĀ HAOSA 249 IETVAROS. DĪVAINIE ATRAKTORI

66.   EMBRIJA DlGLLAPAS UN CILVĒKA TIPOLOĢIJA 251

67.   DĪVAINIE ATRAKTORI HAOTISKAS SISTĒMĀS 253

68.   METEOROLOĢISKAIS HAOSS UN LORENČA 255 ATRAKTORI

69.   HAOSA TEORIJA MEDICĪNĀ 259

70.   DĪVAINAIS METAATRAKTORS KĀ PLATONA IDEJAS 2 63 PROTOTIPS

71.   AUTOSIMILARITĀTES PRINCIPS FRAKTĀĻU ' 265 STRUKTŪRAS

72.   AUTOSIMILARITĀTE PAKĀPJU FUNKCIJĀS 267

73.   AUTOSI MI LARITĀTE KĀ UNIVERSĀLS 269 KOSMOSA ELEMENTS

74.   FRAKTĀĻU ATVEIDI MĀKSLINIEKU SKATĪJUMĀ 270

75.   FRAKTĀĻU ĢEOMETRIJA DATORA «VĪZIJĀS.. 275

76.   SIMBOLU VIZUĀLAIS SKAISTUMS 281

77.   KOMPLEMENTARITĀTES PRINCIPS UN KVANTU 288 FIZIKA LAIKMETU GRIEZOS

77.1.   Nilsa Bora filozofiskie uzskati 288

77.2.   Volfgangs Pauli kā fiziķis un filozofs 290

77.3.   Trinitārās un kvaternitārās domāšanas formas 293

77.4.   Kanta tīrā prāta antinomijas un modernā kosmoloģija 294

77.5.   Kvantu fizikas Prinstonas interpretācija 295

77.6.   Kvantu elektrodinamika un hromodinamika. 298 Ričards Feinmens un Marejs Gells—Manns

77.7.   Kvantu astrofizika. Stīvens Hokings 299

78.   DIALEKTISKĀ PRETSTATU CĪNA — EIROPAS 301 RACIONĀLISMA GARABĒRNS

78.1.   Komplementaritātes un dialektikas mode|u 301 principiālā atšķirība

78.2.   Mainīgais un pastāvīgais sengrieķu filozofijā. 302 Heraklīts pret Parmenīdu

78.3.   Dialektika kā diskusiju un paradoksu māksla 303

78.4.   Hēge|a spekulatīvā dialektika un panlogisms 304

78.5.   Dialektika, ideoloģija un totalitārisms 308

79.   SLĒGTA UN ATVĒRTA TIPA SABIEDRĪBAS. 314 TOTALITĀRISMS UN DEMOKRĀTIJA

80.   HISTORICISMA ORAKUIĀRĀ FILOZOFIJA. VĒSTURISKĀ 319 DETERMINISMA ILŪZIJAS UN MALDI

80.1.   Mūžīgā progresa spirāles un virzības cikliskā 323 modēja pretmeti

80.2.   Cilvēces pagrimuma un «pasaules gala» vīzijas 325

81.   PAREĢI, PRAVIEŠI, MISTIĶI UN ZlMJU TULKI 330

81.1.   Junga pravietiskie sapņi un dvēseles arhetipu modelis 331

81.2.   Delfu orākuls. Sokrāts un Juliāns Atkritējs 334

81.3.   Bībeles pravieši un Kristus mesija 337

82.   INTUĪCIJA KĀ JAUNRADES IRACIONĀLĀ CELVEDE 340

82.1.   Intuitīvā kreativitāte Mareja Gella-Manna skatījumā 342

82.2.   Ņūtona annus mirabilis 346

82.3.   Einšteina annus mirabilis. Superģeniālie atklājumi 348 un ietiepīgie maldi

82.4.   Citi dievišķās intuīcijas piemēri zinātnē 351

82.5.   Intuitīvās atklāsmes piemēri literatūrā, mākslā un 354 mūzikā

83.   HOLISMS UN REDUKCIONISMS KĀ PASAULES 357 UZTVERES UN IZZINĀS METOŽU PRETMETI

84.   CILVĒKA SMADZEŅU FUNKCIONĀLA ASIMETRIJA. 366 SAIKNE AR DOMĀŠANAS TIPOLOĢIJU

85.   VĀRDS, DOMA UN TĒLS. RIETUMU UN AUSTRUMU 378 DOMINANTES

85.1.   Dzejas valodas tēlainības formula 384

85.2.   Ziedu ēnas slīd uz Austrumiem 387 86.1 )OMĀŠANAS UN PASAULES IZZINĀS METOŽU SPEKTRS 390

86.1.    Formālās loģikas iluzorais spēks un «iedzimtie» trūkumi 390

86.2.   Intuitīvi induktīvā loģika. Intuitīvi spriedumi uz 393 analoģiju pamata

86.3.   Varbūtību loģika kā modernizēts induktīvās 395 loģikas atzars

86.4.   Metaforu un asociāciju loģika kā tēlainās domāšanas 396 pamatmetode

86.5.   Paradoksu loģika — ce|vede komplementāro 405 Lielo Patiesību meklējumos

86.6.    Paradoksi — katalizatori jaunu paradigmu rūgšanas 409 procesos

86.7.   Asimetrijas un simetrijas paradoksi

87. IĀIKA PARADOKSI 423

K8. vizuālie paradoksi un dažas vizuālās 429

uztveres īpatnības

89. esamības Četru pasauļu kvaternitarais modelis. 434

materiālā un gara pasaule

90. vispārinātā vizuālā paradigmu mainas shēma 448

91. atvērtības maģiskais brīnums un nenobeigtibas 451 neparastais skaistums

92. epilogs. «kas ir patiesība?». jēzum jauta pilāts. 461 patiesības meklētāji un patiesības zinātāji

Personu rādītājs 483

Priekšmetu rādītājs 495

Izmantotā literatūra 500

1. LIELO PATIESĪBU KOMPLEMENTARITĀTE;

DAO JAN un IŅ princips

Sīs esejas iecerētas kā netradicionāls ieskats Lielo Patiesību meklējumos Cilvēces pasaules izziņas un izpratnes vēsturiskās attīstības gaitā. Apskatot problēmu no vissenākajiem pirmsākumiem līdz mūsdienām, mēs — pretēji tradicionālajai pieejai — atsakāmies no ierastā vēsturiski hronoloģiskā izklāsta. Savu stāstījumu sāksim ar to, ka mūsu 20. gadsimta ietvaros Lielo Patiesību meklējumi noveda pie modernās kvantu fizikas, vispārīgās relativitātes teori­jas, Gēdela teorēmas, kosmosa evolūcijas Lielā Sprādziena (Big Banģ) modeļa, haosa teorijas, sinerģētikas — visjaunākās mūsdienu integrālās zinātnes, kā ari netradicionālās fraktāļu ģeometrijas — ģeometrijas, kas apraksta kā dzīvās, tā nedzīvās dabas daudzveidīgās neregulārās formas.

Visi šie jaunie revolucionārie zinātnes virzieni ir mūsu gadsimta Lielo Patiesību meklējumu izauklētie bērni.

Šo jauno zinātņu «kristāmvārdi» — kvantu fizika, relativitātes teorija, siner- ģētika, haosa teorija, fraktāļu ģeometrija — tad arī būs eseju dominējošie atslē­gas vārdi, kas veidos Lielo Patiesību meklējumu vadmotīvus.

Divdesmitā gadsimta zinātne satricināja no renesanses — no 17. gs. — līdz pat 19. gs. beigām dabaszinātnēs un dabas filozofijā valdošās un par vienīgām patiesībām pieņemtās koncepcijas. Blakus Ņūtona mehāniskajam determinis- mam bija jāpieņem kvantu fizikas ieviestais indeterminisms, blakus kauzālās nepieciešamības kategorijai — statistiskās nejaušības un gadījuma kategorija; blakus striktai noteiktībai nostājās kvantu mehānikas nenoteiktības princips; racionāli deduktīvās domāšanas visvarenību sagrāva Gēdela teorēma, kas parā­dīja deduktīvo sistēmu iekšējo nepilnību.

Plašākā kontekstā tas nozīmēja aizstāt vai — precīzāk formulējot — papil­dināti akareiropas zinātnē un filozofijā valdošo racionālismu un deduktīvi analītisko pasaules uztveri ar iracionālismu, intuitīvu ezoteriski sakrālu pieeju lietām un parādībām. Bet jaunā — 20. gadsimta «žuburaini» daudzveidīgā, «polifoniskā» zinātne nebūt nemēģināja klasiskās zinātnes «vienīgās objek­tīvās» patiesības aizstāt ar jaunām «vienīgajām» patiesībām.

Kvantu fizikas un vēlāk arī visas modernās zinātnes un dabas filozofijas pamatpostulātu, t. s. komplernentaritātesprincipu, 1927. gadā formulēja kvantu mehānikas pamatlicējs dāņu fiziķis Nilss Bors.

Šā universālā principa pamatjēga ir for­mulēta Nilsa Bora filozofiskajā postulātā, kas izvēlēts par eseju epigrāfisko apakšvirs­rakstu: «Liela Patiesība ir Patiesība, kuras pretmets arī ir Liela Patiesība.» Šis apgal­vojums tad arī izsaka komplementaritātes principa pamatbūtību. Ikviena Lielā Patie­sība bez sava pretmeta ir tikai puspatiesība-, tikai papildināta ar savu komplementāro pretmetu, tā kļūst par īsteni pilnīgu Lielās Patiesības iemiesojumu.

Cits Bora komplementaritātes principa formulējums vislakoniskāk skan latīņu mēlē: «Contraria sunt complementa,» — pretmeti papildina viens otru. Tieši patei­coties komplementaritātes principam, 20. gs. zinātne neizslēdza agrāko gadsimtu «vienīgās» patiesības kā nepatiesības vai maldus. Šīs patiesības, papildinātas ar at­bilstošiem pretmetiem, šobrīd veido mūs­dienu zinātnes Lielās Patiesības. Tajās komplementāri apvienojas pretmetu pāri: determinisms un indeterminisms, nepie­ciešamība un gadījums, racionālisms un iracionālisms, deduktīvā un intuitīvā do­māšana, vārds un tēls, arī — plašākā kon­tekstā — zinātne un reliģija.

Sākotnēji Nilss Bors bija pārliecināts, ka viņš ir komplementaritātes principa atklājējs un pirmautors. Šos maldus klie­dēja viņa ceļojums uz Austrumiem — uz Japānu. Tur Bors pirmo reizi iepazinās ar senkīniešu Dao filozofiju un komplemen­taritātes principa visvispārinātāko filozo­fisko formulējumu Dao jan un iņ vizuālajā simbolā (1. att.).

1. att. Dao jan un iņ pretmetu sim­bols — vislakoniskākā un filozofiski saturīgākā vizuālā metafora universāla­jam Lielo Patiesību komplcmentaritā- tes principam.

2. att. Jan un iņ simbols dāņu atom­fizika — komplementaritātes principa atklnjcja Niķa Bora ģimenes ģerboni.

No mūsdienu aspekta jan un iņ sim­bolu var uzskatīt par ģeniālu vislakonis­kāko un saturīgāko filozofiskās domas vis­pārinājumu. Ne velti vēlāk Nilss Bors šo Dao simbolu ietvēra savas dzimtas ģerbonī (2. att.). Tas iemūžināts arī Nilsam Boram

veltītajā franču skulptora Antuāna Pevznera piemineklī Prinstonas univer­sitātē ASV ar uzrakstu «Komplemen­taritātes principa autoram» un šā principa latinizēto formulējumu (3. att.).

Atklājās, ka šķietami paradoksālās mūs­dienu kvantu fizikas koncepcijas iedīgļu stadijā bija sastopamas jau tālā senatnē — senkiniešu enigmatiskajā traktātā «Idzin» (Pārvērtību Grāmata) jau 8. gs. pirms Kristus dzimšanas [50] [1] un nedaudz vēlāk «Daodedzin» tekstos [101], kas veido dao- isma filozofijas pamatus, un vēl vēlāk dzen­budisma koncepcijās un pasaules izpratnē.

Tieši Dao filozofiju un dzenbudismu var pamatoti uzskatīt par Austrumu intu­itīvi prātnieciskās domas blīvāko konden- sātu, kurā sinkrētiski iemiesojas visu triju lielo Austrumu kultūru — Indijas, Ķīnas un Japānas kultūras — filozofiski reliģiskie dārgumi. Un tieši tāpēc šajās esejās, iztirzājot mūsdienu zinātnes problēmas, mēs laiku pa laikam ienirsim kā pērļu zvej­nieki laika dzīlēs, lai meklētu Lielo Patie­sību pērles Austrumu filozofiskās domas apcirkņos. Tāpēc arī mūsu atslēgvārdu vidū jo bieži atradīsim vārdus «Dao» un «dzenbudisms». Jo saskaņā ar universālo komplementaritātes principu jāuzskata, ka arī Austrumu iracionāli intuitīvais un Rie­tumu racionāli analītiskais pasaules izziņas un uztveres princips ir viens otru papildi­noši Lielo Patiesību pretmeti.

Rietumu un Austrumu kopsakarības sevišķi spilgti uztvēris austriešu fiziķis Frit- jofs Kapra, kura grāmata «Fizikas Dao» {«The Tao of Physics», 1970, [20]) ir kļuvusi par vienu no populārākajām ieva- dītājām mūsdienu fizikas filozofiskajās problēmās. Par šīs interesantās grāmatas

3. att. Nilsam Boram veltītā Antuāna Pevznera memoriālā skulptūra Prinsto­nas universitātes, ASV, pagalmā. Uz skulptūras pamatnes četrām skaldnēm iegravēti uzraksti ang|u valodā:

—   Antuāns Pevzners. Konstrukcija tre­šajā un ceturtajā dimensijā Nilsa Bora (1885-1962) piemiņai;

—   Komplementaritātes principa autors;

—    Contraria Sunt Complementa (pret­stati papildina viens otru; šo principu simbolizē daoiskais jan un iņ attēls). Atoma struktūras un kodola struktūras izskaidrotājam;

—    «Mērķis, kas jāpaceļ pāri visam, ir atvērta pasaule, kurā katra tauta var sevi apliecināt tik lielā mērā, cik lielu ieguldījumu tā spēj dot kopējai kul­tūrai un cik var palīdzēt citiem ar savu pieredzi un resursiem.»

Nilss Bors.

pamatievirzi lici iiu tas apakšvirsraksts «Paralēles starp moderno fiziku un Aus­trumu mistic ismu».

Lidzigus uzskatus pauduši vairāki modernās kvantu fizikas pamatlicēji. Tā amcrik.iņu fiziķis Džons Vīlers apgalvo: «Šķiet, ka Austrumu domātāji to visu j.ui /inaja un, ja vien varētu viņu domas pārtulkot mūsdienu valodā, mums būtu atbildes uz visiem jautājumiem.»

Līdzīgi domā arī kvantu mehānikas radītājs vācu fiziķis Verners Heizen- bergs: «Mani vienmēr ir fascinējusi ciešā sakarība starp senās Austrumu filo­zofijas mācībām un modernās kvantu teorijas filozofiskajiem secinājumiem.» (Citēts pēc [21], 39. lpp.)

Pēc šā īsā prologa varam doties pa Lielo Patiesību meklējumu takām gan sendienās, gan mūsdienās, gan Austrumos, gan Rietumos. Šajās studijās mēģi­nāsim pa Ltika vertikāli izsekot ideju un paradigmu pretmetu maiņām un pēc­tecībai, pūloties saskatīt šajās izmaiņās Lielo Patiesību arhetipiskās struktūras un invariantos, laikā nemainīgos elementus.

Otrs nozīmīgākais mūsu pētījumu aspekts — atklāt laika horizontālē kādam laikmetam raksturīgo ideju un paradigmu sinhronu parādīšanos vis­dažādākajās Cilvēces gara aktivitāšu jomās — gan eksaktajās un humanitārajās zinātnēs, gan Pasaules tautu mītos un reliģijās, gan daiļo mākslu sfērās — lite­ratūrā, mākslā, mūzikā, arhitektūrā.

Mēģināsim saskatīt šo ideju un paradigmu strukturālo izomorftsmu (iekšējo līdzību), kas sinkrētiski veido kādu stratificēto laikmeta kultūras slāni. Un, kā redzēsim, šīs laika vertikāles un horizontāles veido savdabīgu «Indras tīklu» [72], kas sasaista visu cilvēces kultūras mantojumu laikā un telpā.

2. LIELĀS PATIESĪBAS UN TRIVIĀLĀS PATIESĪBAS.

KONA PARADIGMAS

Lielās Patiesības strikti jāšķir no triviālajām patiesībām. Triviālas patiesības piemērs ir apgalvojums, ka debesis ir zilas, ka zeme ir apaļa, ka ūdens sāk vārī­ties pie 100°C, ka rokai ir pieci pirksti vai ka cilvēks ir homo sapieris. Triviālas patiesības ir vai nu acīmredzamas, empīriski viegli pierādāmas, vai arī tieši atvedināmas no definīcijas. Triviālu patiesību pretmets ir nepatiesība, kļū­dains apgalvojums vai maldi. Kā formulējis Nilss Bors, triviāla patiesība ir apgalvojums, kam pretmets ir nepatiesība, turpretim Liela Patiesība ir apgalvojums, kura pretmets arī ir Liela (dziļa) Patiesība. Tomēr plašākos gara dzīves aspektos ne vienmēr triviālas patiesības pretmets ir maldi. Šis pretmets var būt, piemēram, mākslinieciska patiesība. Tā dažos van Goga audeklos debesis ir zaļas. Šāds paradoksāls īstenības pretmets var izraisīt protestu tikai dziļi konservatīvā, mākslinieciski noslēgtā skatītājā. Atvērtā skatītājā tas — gluži pretēji — var izraisīt neparastu emocionāli estētisku pārdzīvojumu.

Zinātnē Lielas Patiesības var tikt identificētas ar paradigmas (no grieķu vai. — modelis, tēls, arī sistēma, angliski — «pattern») jēdzienu, ko ieviesis Tomass Kūns savā zinātnes filozofijai veltītajā grāmatā «Zinātniskās revolūcijas struktūra» {«The Structure of Scientific Revolution», [95]); mūsdienās tas kļuvis par mīļ- vārdiņu gan filozofu scientologu, gan dabaszinātnieku sacerējumos. Plašākā nozīmē par laikmeta paradigmu sauc šim laikmetam raksturīgo dominējošo priekšstatu sistēmu. To var attiecināt gan uz zinātni, gan uz mākslu, literatūru vai arhitektūru.

Paradigmu maiņu — saskaņā ar Tomasu Kūnu — nosaka zinātnisko ideju evolūcija, to revolucionārās izmaiņas laika gaitā. Katru noteiktu zināt­nes attīstības posmu veido tam raksturīgā paradigmu kopa. Kādu noteiktu laikmetu zinātnes vai kultūras vēsturē var simboliski raksturot ar tajā domi­nējošo paradigmu— uztveres un domāšanas modeli vai sistēmu. Pagriezienus zinātnes attīstībā parasti saista ar iepriekšējo paradigmu vai modeļu aizstā­šanu ar jaunām paradigmām. Šo paradigmu struktūra tad arī nosaka zinātnes attīstības gaitu un īpatnības. Svarīgākās zinātnes attīstības posma paradigmas būtībā ir Lielās Patiesības, un paradigmu maiņa parasti saistās ar šo Lielo Patiesību aizstāšanu ar to pretmetiem, kas arī ir Lielās Patiesības. Un, bei­dzot, šo savstarpēji saistīto Patiesību sintēze atkal jaunā — vēl aptverošākā paradigmā veido ar iepriekšējām paradigmām komplementāru pāri. Tādā kārtā paradigmu maiņa zinātnes attīstības gaitā pēc savas būtības atspoguļo zinātnisko ideju attīstības vēsturi.

Te gan jāpiebilst, ka laikmeta vai vēsturiskās attīstības fāzes sasaiknēšanās ar tajā it kā valdošo paradigmu reizēm var kļūt par maldīgu stereotipu. Tomēr šāda pieeja dod atslēgu vispārīgam laikmeta raksturojumam un dziļākai izpratnei.

Tātad jauna laikmeta iestāšanos cilvēces domas attīstībā tieši raksturo vecās paradigmas aizstāšana ar jaunu — parasti diametrāli pretēju. Tā, piemēram, Kopernika patiesi epohālais darbs «Par debesu sfēras griešanos» (1543) aizstāja kopš 2. gs. pēc Kr. valdošo Ptolemaja ģeocentrisko paradigmu ar heliocen- trisko pasaules uzbūves modeli.

3. ĢEOCENTRISKĀ UN HELIOCENTRISKĀ PARADIGMA. EMPĪRISKIE FAKTI UN INTELEKTUĀLIE MODELI

Ģeocentriskās paradigmas aizstāšana ar heliocentrisko tālu pārsniedza astro­nomiskās nozīmības robežas un būtiski ietekmēja gan eksakto un humanitāro zinātņu, gan reliģijas, mākslas un literatūras attīstību, un iezvanīja laikmetu, ko kultūrvēsturē pazīstam kā renesansi. Katram laikmetam raksturīgā domi­nējošā paradigma veido it kā ģeoloģiski stratificētu slāņojumu, laika horizon- tālē sinhroni sasaistītu kultūrslāni. Ģeocentriskā paradigma bija cieši jo cieši saistīta ar viduslaikos valdošo aristotelisko sholastiķu, Akvīnas Toma teolo­ģiski centrēto filozofiju, viduslaiku mākslu un literatūru, kuras apogejs bija Dantes «Dievišķā komēdija» («Commedia Divina», [30]); heliocentriskā para­digma savukārt iezīmēja pasaules zinātniskās izpētes sākumu, atbrīvoja mākslu un literatūru no autoritāriem žņaugiem un centrā izvirzīja indivīda pašvērtību un brīvas attīstības ideālus.

Jāuzsver, ka ģeocentriskā paradigma dominē gan primitīvo tautu un seno kultūras tautu mitoloģijā, gan reliģiskajā, gan zinātniski filozofiskajā pasaules uztverē līdz pat Kopernika laikiem. Pat mūsdienās, ja abstrakti arī pieņemam heliocentrisko modeli, ikdienas pieredzē tīri neapzināti dodam priekšroku ģeocentrismam, sakot, ka «Saule lec» un «Saule noriet».

Ikviena vēsturiska paradigma ir objektīva cilvēces kultūras sastāvdaļa. Mēs to varam izspiest no subjektīvās apziņas sfēras, bet tā bieži vien apliecina savu nemirstību, iznirstot kā arhetips no bezapziņas dzīlēm un kļūstot par patiesību kādā konkrētā dzīves vai gara aktivitātes sfērā. Zemes kā pasaules centra paradig­ma ir jāpieņem, ja gribam patiesi uztvert un izprast Vecās Derības «Genesis» grā­matā [11] aprakstīto pasaules radīšanas norisi vai tās dievišķo attēlojumu Mikel- andželo Siksta kapelas griestu gleznojumā (19. att. 1. piel.). Un kulminācija šai paradigmai atrodama Dantes ģeniālajā opusā «Dievišķā komēdija». Tajā attēlotā pasaules arhitektonika ir ptolemajiska: Pazemes Elles loki, kas beidzas Zemes centrā, Šķīstītavas kalns Zemes dienvidu puslodē un deviņas Debesu spīdekļu sfēras apkārt Zemei. Dante, viedīgā Vergilija izvests cauri Elles un Šķīstītavas lokiem un burvīgās Beatričes pavadīts cauri Debesu sfērām, dievišķā darba finālā nāk pie apskaidrības, ka «tik Mīlestība ir tā, kas garu debess dzīlēs aiznes un visam ritēt liek, — tā Mīlestība, caur kuru griežas saule, mēness, zvaigznes».

Apcerot šīs divas paradigmas — heliocentrisko un ģeocentrisko — un ar tām saistīto Patiesības koncepciju, atcerēsimies Aristoteļa patiesības definīciju, kas dominēja gan klasiskajā Rietumu filozofijā, gan vēlāk arī zinātnes filozo­fijā, īpaši pozitīvismā: «Veritas est adequatio intelectus et rei,» (patiesība nozīmē intelekta atbilstību realitātei, [126], 11. lpp.). Pēc šīs definīcijas mēs domā­jam «pareizi», ja mūsu domāšana saskan ar empīriskās pieredzes faktiem. Tas izklausās pašsaprotami, pat triviāli, jo to mums diktē «veselais saprāts» (com- mon sense). Bet tieši ikdienas pieredze, mūsu «veselais saprāts», saka, ka Zeme ir pasaules centrs, jo Saule uzlec austrumos un noriet rietumos un debesu ķermeņi — planētas un zvaigznāji — riņķo ap mums. Uz Zemes kā Visuma centra mēs jūtamies droši un stabili. Tā — saskaņā ar Aristoteļa patiesības definīciju — ģeocentrisko paradigmu pamatoti varētu uzskatīt par pareizu.

Vācu filozofa Edmunda Huserla iedibinātā fenomenoloģija atzīst, ka ģeo­centriskajai paradigmai ir savs pamatojums uztveres, acīmredzamībasjomā. Fenomenoloģiskajā filozofijā parādībām jeb fenomeniem tiek piešķirts būtības statuss. Tas nozīmē, ka jebkura parādība pati par sevi ir vērā ņemama, tai ir sava esamība. Fenomeni nes sevī būtību un atklāj to caur sevi pašu. Tāpēc fenomenoloģija pēta fenomenus to esamības statusā, nevis kā atvasinājumus no kādas dziļākas būtības. Tam, ko dzird, redz un pārdzīvo cilvēks, ir sava realitāte [94],

Kā skaidro Huserls, no dabaszinātņu viedokļa ģeocentrisms un Zemes nekustīgums var tikt apšaubīts, taču no cilvēciskās pieredzes viedokļa tas ir neapšaubāms, acīmredzams fenomens. Mēs patiešām dzīvojam jēgpilnā pasaulē, kura kā patiesību pieņem nekustīgu Zemi vai plašākā vispārinājumā — ģeocentrisko paradigmu.

Kā norāda Huserla ģeniālais skolnieks Martins Heidegers [67, 26], Koper- niks un Keplers, pasludinādami, ka Zeme vairs neatrodas kosmosa centrā un ka debesu ķermeņi nekustas tā, kā mēs to iedomājamies redzam, faktiski ignorē «ietiepīgos empīriskos faktus». Viņi izveidoja intelektuālu modeli, kas runā pretī empīriskajai pieredzei un līdz ar to noārda kongruenci, kura pirms tam valdīja starp dabiskajām parādībām un tiešo uztveri ([126], 43. lpp.). Cilvēks ar savu ikdienišķo dzīvi un uz «veselo saprātu» balstītu pasaules uztveri tiek izstumts no kosmiskās dzīves ritma.

Bet situācija nebūt nav nepārprotama. Ja kāds intelektuāli izveidots modelis spēj aprakstīt un izskaidrot novērojamās dabas parādības un empīriskos fak­tus, tas nebūt nenozīmē, ka ir iegūts vienīgais patiesais īstenības apraksts. Ar prātu var radīt ne tikai vienu, bet vairākus, pat daudzus modeļus, kas vienlīdz labi apraksta empīriskos faktus un norises. Sarežģītu dabas parādību aprak­stam vairs nav tik vienkārši izmantojama Aristoteļa patiesības definīcija. Tur sastopamies ar zinātniski intelektuālu modeļu polimorftsmu (daudzveidību). Lai arī heliocentriskā Saules sistēmas uzbūves paradigma šobrīd ir vispār­pieņemta gan speciālistu astronomu vidū, gan zinātniskā sabiedrībā vispār un Fiksēta kā pareizākā (salīdzinot ar ģeocentrisko modeli) gan enciklopēdijās, gan mācību grāmatās, ari šoreiz patiesības pareizums ir diskutējams. Pavisam nesen šo problēmu iztirzājis pazīstamais Dienvidāfrikas kosmologs Džordžs Elliss [53]. «Cilvēkiem ir jāsaprot, ka vienmēr eksistē vairāki modeli, pēc kuriem izskaidrot novērotos faktus,» saka Elliss. «Es, piemēram, varu uzkon­struēt simetrisku Visumu ar Zemi centrā, kuru jūs, balstoties uz novēroju­miem, nevarēsiet apstrīdēt.» Elliss" konstatē, ka heliocentriskā modeļa pārā­kums pār ģeocentrisko balstās nevis uz to, ka «pareizāk» un precīzāk apraksta novērojumus un tāpēc ir patiesāks, bet uz izvēli, ko nosaka tīri filozofiski kri­tēriji. Starp tiem nozīmīgākie ir modeļa loģiskā vienkāršība, saprotamība un uzskatāmība. Angļu fiziķis Pols Diraks uzskata, ka modeļu izvēlē ir svarīgi ari estētiskie kritēriji [37]. Skaistākam modelim ir dodama priekšroka, ar skais­tumu izprotot modeļa vienkāršību un uzskatāmību. Šādiem filozofiskiem un estētiskiem kritērijiem, kā redzēsim tālāk, ir jo īpaša nozīme, izvēloties modeļus augstas kompleksitātes sistēmu aprakstam — it īpaši dzīvajā dabā. Šādā aspektā abas — gan ģeocentriskā, gan heliocentriskā paradigma — pamatoti jāuzskata par Lielām Patiesībām ar savu lietojamības un eksistences diapazonu dabas un gara pasaulē. Tās ir Lielās Patiesības, kuras nevis izslēdz, bet papildina viena otru.

Nav gan noliedzams, ka Kopernika postulētais heliocentrisms kļuva par jauno laiku zinātnes stūrakmeni. Tieši heliocentriskās paradigmas ietvaros Johanness Keplers, izmantodams Tiho Brahes precīzos astronomiskos novēro­jumus, formulēja planētu kustības likumus. Taču Kepleru neapmierināja sausās matemātiskās formulas. Sekojot tā laika klasiskajām tradīcijām, Keplers uzskatīja, ka planētu izvietojumā ap Sauli realizējas muzikālās harmonijas ele­menti [183]. Ideja par musica mundi (pasaules mūziku) sastopama gan pita- goriešu traktātos, gan Ptolemaja darbā «Harmonijas» («Harmonices»), gan latiņu enciklopēdistu teorijās, jo saskaņā ar quadrivium tradīcijām mūzika bija viena no četrām eksaktajām zinātnēm (aritmētika, mūzika, ģeometrija un astronomija). Keplera darbu kopu «Piecas grāmatas par pasaules harmoniju» («Harmonices mundi libri V», 1619) caurauž doma par Saules sistēmas muzi­kāli harmonisko struktūru, jo viņš dziļi ticēja, ka pasaules uzbūves harmonijā izpaužas tās Radītāja Dieva racionālā daba.

Brīnišķīgu muzikālu pieminekli Johannesa Keplera dzīvei un viņa filozofi­jai par pasaules muzikāli harmonisko iedabu radījis izcilais mūsu gadsimta komponists Pauls Hindemits — arī viens no 20. gs. paradigmas veidotājiem modernās mūzikas jomā. 1953. gadā Hindemits vienlaicīgi uzrakstīja operu «Pasaules harmonija» («Harmonie der Welt»), kurai pamatā ir Keplera dzīves stāsts, un simfoniju ar tādu paiu nosaukumu, kas veltīta Keplera pasaules har­monijas meklējumiem. Simfonijas trīs daļas saucas «Musica Instrumentalis», «Musica Humana» un «Musica Mundana» [ 1, 66].

4. ŅŪTONA MEHĀNIKĀ UN DETERMINISMA PARADIGMA

Uz Kopernika un Keplera heliocentriskās paradigmas bāzes Izaks Ņūtons patiesi ģeniālajā darbā «Dabas filozofijas matemātiskie principi» («Phibsophiae naturalis principia mathematica», pazīstams kā «Neiuton s Principia») radīja Ņūtona mehānikas pamatus un vispasaules gravitācijas koncepciju. Būtībā visa vēlākā 18. un 19. gs. t. s. klasiskā fizika balstījās uz Ņūtona mehānikas pamatprincipiem.

Ņūtona Visuma skatuve, uz kuras noris fizikālās parādības, ir klasiskās Eiklīda ģeometrijas trīsdimensiju telpa. Šī telpa ir absolūta, bezgalīga, homo­gēna, miera stāvoklī un nekustīga, paša Ņūtona vārdiem sakot: «Absolūtā telpa pēc savas dabas, lai kas arī tajā notiek, vienmēr paliek līdzīga un nekus­tīga.» ([20], 63. lpp.) Visas izmaiņas fizikālajā pasaulē var tikt aprakstītas atse­višķas, ar telpu nesaistītas dimensijas — laika — ietvaros; laikam nav nekāda sakara ar materiālo pasauli, un tas tek vienmērīgi no pagātnes caur tagadni uz nākotni. «Laiks ir absolūts, patiess un matemātisks pēc savas dabas un plūst vienmerīgi, lai arī kas tajā notiek,» apgalvo Ņūtons.

Pamatelementi, kas kustas šajā absolutizētajā Ņūtona pasaules telpā un laikā, ir materiālās daļiņas. Matemātiskos vienādojumos tās tiek iekļautas kā «masas punkti». Ņūtons tos saskatīja kā mazus, cietus, nedalāmus objektus, kas pasaulē veido visu vielu. Šis modelis ir loti tuvs grieķu atomistu modelim. Tomēr nozīmīgākā starpība starp sengrieķa Dēmokrita un Ņūtona atomismu ir tā, ka Ņūtons mēģina precīzi matemātiski aprakstīt spēkus, kas darbojas starp materiālajām daļiņām. Šo spēku vispārinājums ir Ņūtona atklātais Visuma gravitācijas likums. Ņūtona pasaulē atšķirībā no Dantes «Debesu sfēras», t. i., planētām, Saulei un Mēnesim griezties liek nevis Dievišķā Mīles­tība, bet gan pasaules gravitācijas likums. Tai pašā laikā atšķirībā no Dēmo­krita un grieķu atomistiem, kurus dažkārt uzskata par «kristāltīriem» materi­ālistiem, Ņūtons darbā «Optika» («Optics», pie tā vēl atgriezīsimies) deklarē, ka pasaules vielu, ko veido cietās daļiņas, ir radījis Dievs un šīs daļiņas ir tik cietas un nedalāmas, ka «.. nekāds spēks nevar sadalīt to, ko pats Dievs ir radī­jis sākotnējā radīšanas aktā» ([20], 64. lpp.).

Svarīgi, ka tieši uz Ņūtona mehānikas celma veidojās t. s. mehāniskais determinisms — filozofiskā koncepcija, ka visas norises pasaulē ir strikti determinētas un tādējādi, balstoties uz cēlonības likumu, prognozējamas, nosakāmas ar absolūtu precizitāti. Citiem vārdiem, pasaule darbojas kā labi noregulēts pulksteņa mehānisms. «Esmu izskaidrojis pasauli!» pašpārliecināti apgalvo Ņūtons. Ņūtona mehānisms apogeju sasniedza izcilā franču matemā­tika Pjēra Simona Laplasa darbos. Laplasam bija godkārīgs mērķis tā uzlabot un precizēt Ņūtona aprēķinus, ka tie dotu tik pilnīgu atrisinājumu grandioza­jām problēmām, ko zinātnei izvirza Saules sistēma, un panāktu tik ciešu teori­jas saskaņu ar novērojumiem, ka empīriskām formulām vairs neatrastos vieta astronomiskajās tabulās ([20], 66. lpp.). Šā darba rezultāts bija «Debesu mehā­nika» {«Mecanique Celeste») piecos sējumos, kuros Laplass visai veiksmīgi izskaidroja planētu, Mēness un komētu kustību līdz vissīkākajām detaļām, kā arī aprakstīja paisumus un citas ar gravitāciju saistītās parādības.

Laplass parādīja, ka Ņūtona kustības likumi nodrošina Saules sistēmas sta­bilitāti un Visumu var uzskatīt par perfekti izstrādātu pešregulējošos mašīnu. Kad Laplass dāvinājis sava kolosālā darba pirmizdevumu Napoleonam, tas teicis: «Laplasa kungs, stāsta, ka jūs esot sarakstījis šo lielo grāmatu par pasaules uzbūvi, nekad nepieminot Radītāja vārdu.» Laplass strupi atbildējis: «Man nav bijusi nekāda vajadzība pēc šādas hipotēzes!» ([20], 66. lpp.) Racio­nālisma filozofiskās skolas pamatlicēja (arī matemātiķa) Dekarta tautietis Lap­lass tik loti ticēja cilvēka intelekta varenībai, ka formulēja kā Lielu Patiesību šādu līdz galējībai hiperbolizētu determinētā mehānisma pamattēzi ([20], 66. lpp.): «Ja būtu intelekts, kas noteiktā laika punktā apzinātos visus dabā darbojošos spēkus un visu pasaulē eksistējošo lietu stāvokli, un varētu pie­ņemt, ka tas ir pietiekami plašs, lai spētu šos datus izanalizēt, mēs varētu ar vienu un to pašu formulu aprakstīt gan lielo debess ķermeņu, gan sīko atomu kustības. Tad mums nekas nepaliktu neskaidrs un Visuma nākotne līdzīgi pagātnei būtu mūsu acu priekšā.» ([20], 65. lpp.)

Stingrā determinisma filozofisko bāzi veidoja duālistiskais Dekarta dalī­jums «es» un «pasaule». Balstoties uz šo dalījumu, pasauli var aprakstīt objek­tīvi, atstājot malā subjektu, cilvēcisko vērotāju. Šāds objektīvs dabas apraksts kļuva par ideālu klasiskajai 18. un 19- gs. zinātnei.

No visa tā izriet secinājums: ja jau pasaulē viss ir strikti determinēts, pakļauts kauzalitātei un nepieciešamībai un norisēs nav nekādu nejaušību vai patvaļu, tad arī subjekta — cilvēka — dzīve ir tikpat stingri determinēta un pār to valda liktenis. Brīvā griba tātad var tikt pasludināta par fikciju, indeter- minisms — par pseidozinātnisku koncepciju.

No mehāniskā determinisma klēpja dzima tā kroplais bērns — mehānis­kais materiālisms un tā paveidi, piemēram, vēsturiskais materiālisms. Ja jau viss dabā un cilvēka dzīvē ir determinēts, tad arī cilvēces vēsturiskā attīstības gaita tāpat ir determinēta. Tas nozīmē, ka vēsturiskā attīstība ir prognozē­jama. Un te nu nonākam pie būtiska secinājuma: ja mehāniskā determinisma paradigma ir Lielā Patiesība, tad tā bez sava pretmeta ir tikai puspatiesība. Bet, ja to pieņem par vienīgo, par drošu un pilnīgu patiesību, tad esam notverti dog­matisma vai pat — vel ļaunāk — aprobežota fanātisma tīklos (sk. 92. eseju). Te jāatceras kāda viedīga prātnieka vārdi: «Es ticu cilvēkiem, kas saka, ka viņi meklē patiesību. Bet neticu tiem, kuri saka, ka viņi zina patiesību.»

Mehāniskā determinisma paradigma Vakareiropas zinātnē dominēja vairā­kus gadsimtus — līdz pat 20. gs. sākumam. Tika uzskatīts, ka tā ir vienīgā zinātniskā pieeja pasaules aprakstam un izpratnei un ka tai jāiekļaujas dekar- liska racionālisma rāmjos. Racionālisma pretmets — iracionālisms, determi­nisma pretmets — indeterminisms, Austrumu misticisms un Vakareiropas reliģijas — tie visi tika uzskatīti par nezinātniskiem, ar vienīgo pareizo zināt­nisko pasaules uzskatu nesavienojamiem uzskatiem. Arī psiholoģija k|uva drīzāk par piedēkli cilvēka smadzeņu fizioloģijai, atzīstot cilvēka kā subjekta apziņu par vienīgās objektīvās realitātes — ārējās pasaules atspoguļojumu.

No Lielo Patiesību meklējumu viedokļa cilvēces zinātniskā doma bija nonākusi strupceļā, kādā allaž noved vienpusīgas patiesības atzīšana.

5. GAISMAS FIZIKĀLĀS DABAS PĒTĪJUMI «UZSPRIDZINA» DETERMINISMU

Gaismas dabas pētījumu vēsturiskā gaita visspilgtāk iezīmē vairāku funda­mentālu pamatideju attīstību un pretmetu paradigmu maiņu. Gaismas fizikā­lās dabas skaidrojumā kopš 17. gadsimta viena otrai sekoja gaismas korpuskulu (daļiņu) un gaismas viļņu teorijas. Šīs divas pretmetu paradigmas šķita sav­starpēji izslēdzošas, nesavienojamas. Pirmā postulēja gaismu kā diskrētu, otra — kā nepārtrauktu dabas fenomenu. Tomēr abi skaidrojumi, kā redzēsim, tīri labi iekļāvās Ņūtona mehāniskā determinisma rāmjos. Kritiskais pagrieziena punkts iezīmējās mūsu gadsimta pirmajā desmitgadē ar jaunas paradigmas dzimšanu. Kvantu fizikas patriarhu Maksa Planka un Alberta Einšteina atklā­jumi apstiprināja, ka gaismai ir duāla daba — tā vienlaicīgi ir gan diskrētu daļiņu (kvantu) plūsma, gan nepārtraukts vilnis. Jaunā 20. gs. paradigma sevī iemiesoja komplementaritātes principu: abi šķietami ekskluzīvie pretmeti — daļiņa un vilnis, diskrētais un nepārtrauktais— atklājās kā Lielo Patiesību sav­starpēji papildinošas puses, kž. jan un iņ Dao simbolikā. Šo jauno Patiesību gaismā arī determinisms izrādījās tikai puspatiesība, kuru nepieciešams papil­dināt ar tā pretmetu — indeterminismu.

Kā gaismas fizikālās dabas izpēte «uzspridzināja» Ņūtona mehānisko deter- minismu, uzskatāmāk parādīsim nelielā, bet varbūt intriģējošā ekskursā šo ideju vēsturiskajā attīstībā no seno tautu mitoloģiskajiem arhetipiem līdz pat mūsdienu zinātnes priekšstatiem.

5.1. Priekšstati par gaismu seno tautu mitoloģija

un pirmsnūtona zinātnē

Gaisma, kā zināms, ir visur esoša parādība, kuras iedarbība ir vairāk vai mazāk zināma, bet būtība — grūti aptverama. Gaisma ir it kā pretstats mate­riālajai lietu pasaulei. Tā bieži uzskatīta par nematerialitātes, gara un dievišķā simbolu ([69], 53. lpp.).

Seno tautu mitoloģijā gaisma tiek identificēta ar Saules varenību un spēku un Saule dažkārt pielūgta kā dievība. Kulmināciju Saules kults sasniedza Senajā Ēģiptē faraona Ehnatona (Amenhotepa IV) valdīšanas laikā. Kā vēsta

4. att. Saules dieva Atona pielūgšana. Ēģiptiešu kapeņu zīmējums no faraona Ehnatona valdīšanas laika apm. 14. gs. pr. Kr. [70].

Elamarnas kapeņu hieroglifi, faraons Ehnatons atteicies no kalpošanas svētajam vērsim Amonam un pasludinājis par vienīgo dievu Atonu — zeltīto Saules disku. Kapeņu zīmējumos uzlecošā Atona staru dāsnās rokas glāsta ne vien Ehnatonu («Atonam tīkamo») un viņa skaisto sievu Nofreteti, bet arī visus faraona pavalstniekus, karavīrus un vergus, kā arī gazeles, ēzeļus un putnus — visu dzīvo radību, kokus un puķes (4. att.). Saules gaismas stari tiek antropo- logizēti kā maigas, glāstošas rociņas.

Himnu Atonam uzskata par vienu no izcilākajiem ēģiptiešu literatūras pieminekļiem [70]:

Cik skaista tava parādīšanās pie debesu apvāršņa, tu, dzīvais Aton, kas pastāvēji jau pašā sākumā! Tavs mirdzošais lēkts pie austrumu apvāršņa piepilda visu Zemi ar tavu skaistumu! Tavi stari aptver visas zemes līdz visa tā robežai, ko tu radījis! Tu esi tāls, un tomēr tavi stari sasniedz Zemi — tieši acu priekšā,

un tomēr nav aptverama tava gaita!

Arī citu seno tautu mitoloģijā uzsvērts gaismas primāts dabas un dzīvības attīstība [40]. Sajās mitoloģijās iezīmējas daži modernās kosmogonijas elementi, piemēram, gaismas jēdziens nav saistīts ar konkrētu debess spīdekli, gaisma tiek aplūkota kā kosmosa primārās matērijas neatkarīga sastāvdaļa. Arī «Genesis» pasaules radīšanas aprakstā Dievs vispirms atdala gaismu no tumsas [11] — to ģeniāli attēlojis Mikelandželo savā «Pasaules radīšanā» Siksta kapelas griestu glez­nojumā—, bet debesu spīdekļus rada tikai pēc tam (19. att. 1. piel.).

Arī antīkajā Grieķijā sastopams īpašs gaismas kults. Kā visiem spēkiem, arī gaismai bija piedēvēts īpašs dievs — Apollons ar pievārdu Fēbs (grieķu vai — Mirdzošais), kura tēls ātri vien saplūda ar Hēlija — Saules dieva — tēlu. Sau­les kults pārgāja arī uz Seno Romu. Saules un gaismas dievs bija reizē kārtības un skaidrības, garīgās dzīves un mākslas, mūzikas un dziesmas, dziedniecības, zemkopības un lopkopības patrons.

Sengrieķu zinātnieki pirmie formulēja dažus vienkāršākus gaismas izpla­tīšanās likumus, ieviesa terminu «optika» un lika pamatus mācībai par gaismu. Matemātikas dižgars Eiklīds, kas radīja viņa vārdā nosaukto Eiklīda ģeomet­riju, mazāk pazīstams ar saviem sasniegumiem optikā. 300 gadus pr. Kr. parādījās Eiklīda traktāts «Optika». Tajā ir atrodams postulāts, ka gaisma izplatās taisnā virzienā. Uz šo un vēl vienpadsmit postulātiem viņš būvē ģeo­metriskās optikas celtni, kas izskaidro ēnu rašanos, attēlu veidošanos no maziem caurumiem, atstarošanos no plakaniem un sfēriskiem spoguļiem u. c.

Eiklīda optiku tālāk attīstīja astronoms Ptolemajs mūsu ēras 2. gadsimtā. Viņš pētīja gaismas laušanu un aplūkoja pat astronomisko aberāciju. Vēl jāpiemin, ka ģeometriskās optikas vispārīgais princips, ko mūsu ēras 17. gad­simtā formulēja Pjērs Fermā, pirmo reizi minēts jau 2. gadsimtā pr. Kr. Hērona traktātā par katoptriku (mācība par gaismas atstarošanos).

Viduslaikos interese par gaismas fizikālo dabu bija niecīga. Sholastiskā domā­šana balstījās uz Aristoteļa kanoniem par dabas procesiem kā uz vienīgo patiesību.

Zinātne par gaismu atdzima lielā garīgās atmodas laikmetā — renesanses laikā. Zinātnieki sāka izmantot gaismu, lai izzinātu pasauli. Vispirms makro- kosmu — debesu ķermeņu pasauli. 1609. gadā Venēcijā izplatījās zina, ka izgudrots tālskatis, ko varot iegādāties par «dažiem soldo». Šādu tālskati 1600. g. izgatavoja Galileo Galilejs un pavērsa to pret zvaigznēm. Jau 1620. gadā iznā­kušais «Zvaigžņu Vēstnesis» iezvanīja jaunu laikmetu ne tikai astronomijā, bet arī visā zinātnē. Galileja ģēnijs spēja tālskati pārvērst par izcilu zinātnisku instrumentu, apzināti liekot gaismas staram kalpot par pasaules izziņas avotu. Vēlāk gaismas stars palīdzēja cilvēkam atklāt ne tikai makrokosma, bet arī mikrokosma — atomu un molekulu pasaules — noslēpumus.

Neiedziļinoties jautājumā par gaismas dabu, Galilejs izteica domu, ka tai no gaismas avota jāizplatās ar noteiktu ātrumu. Viņš pat izgudroja eksperi­mentu, kā šo ātrumu izmērīt. Tikai pēc 250 gadiem franču zinātnieks Fizo šo eksperimentu realizēja, bet jau 1676. gadā, aplūkojot Jupitera pavadoņu kus­tību tālskatī, gaismas ātrumu noteica jauns dāņu zinātnieks Ole Rēmers.

Gaismas daba, tās izplatīšanās likumi, gaismas un redzes, gaismas un krāsu problēmas atklājumiem bagātajā 17. gadsimtā šādā vai tādā veidā nodarbināja visu ievērojamāko zinātnieku prātus. Johanness Keplers pirmais skaidri for­mulēja attēla veidošanos uz acs tīklenes. Renē Dekarts atklāja gaismas laušanas likumus (eksperimentāli tos atrada viņa laikabiedrs holandietis Villebrords Snelliuss), izskaidroja varavīksni, mēģināja izskaidrot krāsu sajūtu ar gaismas nesēju daļiņu spēju izraisīt dažādas sajūtas aci. Francūzis Pjērs Fermā formu­lēja viņa vārdā nosaukto principu, kas vispārīgi apraksta gaismas izplatīšanās likumus. Itālietis Frančesko Grimaldi atklāja un aprakstīja gaismas difrakciju. Dānis Erasms Bartolins atklāja dubultlaušanu. Tomēr visnozīmīgākais šā vētrainā gadsimta veikums pieder izcilajam angļu fiziķim Izakam Ņūtonam. Burvīgā varavīksne, kas tik daudzus gadsimtus sniegusi vielu gan dzejnieku jūsmai, gan zinātnieku domai, nokāpa no debesim pētnieka laboratorijā un uzsāka savu uzvaras gājienu, dodot cilvēcei iespēju ne tikai izskaidrot pašu gaismas dabu, bet arī izpētīt vielas uzbūves dziļākos noslēpumus.

Daudzās skolas grāmatās ir aprakstīts Ņūtona eksperiments. Balto saules staru ielaiž pa mazu caurumiņu aptumšotā telpā un virza caur stikla prizmu, sadalot to septiņās krāsās. Lasītājs jau zina, ka Ņūtons nebija pirmais, kas novēroja baltās gaismas sadalīšanos krāsās. Viņa nopelns tomēr ir tas, ka viņš šo parādību sistemātiski izpētīja vairāku eksperimentu sērijā. Ņūtons radīja paša spektra jēdzienu un terminu (latīņu valodas vārds «spectrum» nozīmē — attēls, parādība), kā arī piešķīra īstu saturu neilgi pirms tam formulētajai atziņai, ka «gaismas stari, kas atšķiras ar krāsu, tiek atšķirīgi lauzti prizmā». Ņūtons pierādīja, ka prizmā iegūtais krāsainais stars tālāk vairs nav sadalāms. Viņš konstatēja, ka ķermeņi, uz kuriem krīt kāds gaismas stars, paši nerada krāsu. Priekšmets ir krāsains tāpēc, ka tas absorbē kādu daļu no stariem, kas uz to krīt. Šīs atziņas izteiktas apcerējumā «Jauna gaismas un krāsu teorija» (1672). Pilnīgi pabeigta, Ņūtona «Optika» pirmo reizi iznāca tikai 1705. gadā.

5.2. Ņūtons postulē korpuskulāro gaismas teoriju

Gaismas dabu Ņūtons izskaidro no korpuskulārās teorijas viedokļa. Gaisma izplatās kā īpašu materiālu daļiņu — korpuskulu plūsma. Ja šīs daļiņas sagrupē pa izmēriem, iegūst dažādas krāsas gaismu. Šāda daļiņu «šķirošana» notiek, gaismai lūstot prizmā. Sajaucoties kopā, tās atkal veido baltu gaismu.

Jāuzsver, ka Ņūtona uzskati optikā nebūt nebija tik viendabīgi, kā to iztē­loja viņa laikabiedri un vēlākie vēsturnieki. Dažreiz Ņūtons bija spiests runāt par svārstībām, kas gan norisinās pašā gaismas korpuskulā, gan arī tiek iero­sinātas kādā citā vidē šo korpuskulu ietekmē. Ņūtons vienmēr bija lepns uz to, ka viņš nekad «neizvirzot hipotēzes». Attiecībā uz mehānikas likumiem viņam šai ziņā var piekrist, taču par viņa optiku to nevar teikt.

Gaismas dabas korpuskulārās teorijas paradigma, ko Ņūtons postulēja savā «Optikā», visā pilnībā atbilda viņa atomistiskajiem principiem par pasaules uzbūvi un lieliski iederējās mehāniskā determinisma shēmā. Tomēr drīz vien Ņūtona korpuskulārās gaismas paradigma tika aizstāta ar gaismas viļnveida dabas paradigmu.

5.3. Gaismas vilnu teorijas triumfs

Holandietis Kristiāns Heigenss 1678. gadā sarakstīja, bet 1690. gadā pub­licēja «Traktātu par gaismu». Šajā nelielajā (77 lpp.) darbā viņš pievērsās jautājumam par gaismas dabu un izplatīšanos. Gaismai, pēc Heigensa uzskata, ir vilņveida daba. Šie viļņi izplatās īpašā hipotētiskā elastiskā bezsvara vidē — ēterā. Heigensa teorija lieliski izskaidroja gaismas laušanu, atstarošanos un dubultlaušanu kristālos, toties «pazaudēja» staru, kas izplatās pa kristālu. Tikai pēc angļu zinātnieka Tomasa Junga un it īpaši franču zinātnieka Ogistēna Frenela klasiskajiem darbiem 19. gadsimta sākumā gaismas korpuskulārā teorija, kas balstījās uz Ņūtona milzīgo autoritāti, tika galīgi atmesta un fizikā iestājās gaismas viļņu teorijas ēra, kas ilga veselu gadsimtu.

Jaunā teorija viegli izskaidroja visas galvenās optiskās parādības: gan gais­mas stara izplatīšanos pa taisni, gan difrakciju — apliekšanos ap šķēršļiem, gan interferenci — gaismas savstarpēju pastiprināšanos un pavājināšanos, ko bija novērojis jau Ņūtons («Ņūtona gredzeni»), gan laušanu un atstarošanu. Ari dažādu gaismas staru krāsu varēja viegli izskaidrot ar gaismas viļņu dažādo garumu. Bet kas tad svārstās šajos viļņos? Angļu fiziķis Džeimss Klārks Maksvels 1873. gadā teorētiski pierādīja, ka gaisma ir elektromagnētisks vilnis, kas izplatās telpā, kuru pilda hipotētiskā ideāli elastiskā nekustīgā vide — pasaules ēters. Jau likās — beidzot pielikts punkts. Šķita atrisināts viens no lielākajiem dabas noslēpumiem, izzināta dzīvības nesējas gaismas būtība…

Pētījumi gaismas viļņu mehānikā 17.-19. gs. it kā nepārprotami apstipri­nāja, ka Heigensa-Junga-Frenela viļņu teorija ir pareiza, bet Ņūtona kor­puskulārā gaismas teorija — maldīga. Tai pašā laikā gaismas viļņu teorija un pasaules ēters itin labi iekļāvās mehāniskā determinisma shēmā. Ak vai, šai gaismas viļņu paradigmas šķietamā triumfa brīdī zinātne vēl bija tālu no patie­sības par gaismas dabu!

5.4. Korpuskulārā un vilnu paradigma kā komplementāri pretmeti

Turpmākā notikumu gaita parādīja, ka abas paradigmas — korpuskulārā un viļņu— ir divas Lielās Patiesības komplementārās puses, kas viena otru pa­pildina un abas ir adekvātas. Lielo Patiesību atklāja tā pati stikla prizma, kuru Ņūtons bija novietojis Saules stara ceļā pirms vairāk nekā diviem gadsimtiem.

Ilgus gadu desmitus neviens nebija nopietni pievērsies šiem eksperimen­tiem. Vajadzēja paiet ap 150 gadiem, kamēr vācu aptiekārs un zinātņu cienī­tājs Jozefs Fraunhofers 1814. gadā, izmantojot krietni uzlabotu un papildi­nātu iekārtu — spektroskopu, atkal aplūkoja Saules spektru. Uz Ņūtona aprakstītās septiņkrāsu ainas fona viņš ieraudzīja virkni tumšu, šauru līniju, kuras vēl tagad sauc par Fraunhofera līnijām. Arī citi zinātnieki sāka intere­sēties par Fraunhofera instrumentu un aplūkoja dažādu sāļu iekrāsotas liesmas vai elektriskās izlādes. Šajā gadījumā spektrā novēro nevis nepārtrauktu sep­tiņu krāsu ainu, bet lielāku vai mazāku skaitu šauru, krāsainu līniju.

Pēc nepilna pusgadsimta (1859.-1861. g.) divi vācu zinātnieki — fiziķis Gustavs Kirhofs un ķīmiķis Roberts Bunzens — paziņoja, ka katram vielas atomam, katram ķīmiskam elementam ir sava, tikai tam vien piederoša līniju kopa, savs spektrs, kas to atšķir no citiem elementiem. Laižot baltu gaismu caur elementu tvaikiem, uz nepārtrauktās krāsainās ainas fona tieši tajā vietā, kur iekrāsotā liesma tās izstarojusi, parādās tumšas līnijas — tās pašas Fraun­hofera līnijas.

Kāpēc rodas līniju spektrs? Kāpēc līnijām ir tik skaidri noteikta frekvence? Kāds tam visam sakars ar vielas atomiem? Lai uz to atbildētu, cilvēcei vajadzēja nodzīvot vēl pusgadsimtu, pilnu ar dramatiskiem jauniem atklājumiem, strī­diem, šaubām, pārdomām un drosmīgām jaunām hipotēzēm un teorijām. Tai skaitā ari par gaismas dabu.

No visām pusēm nāca triecieni gaismas viļņu elektromagnētiskajai teorijai, kas jau it kā bija visu izskaidrojusi un sevī ietvērusi klasiskās fizikas manto­jumu — gan mācību par viļņiem un to izplatīšanos, gan Maikla Faradeja atziņas par elektrisko un magnētisko lauku, gan Frenela mantojumu un Mak- svela vispārinājumus.

Vispirms jau pats Saules «baltais» spektrs izrādījās ciets rieksts. «Baltu» jeb nepārtrauktu spektru izstaro nokaitētā Saules virsma — fotosfēra. Tādu pašu spektru izstaro jebkurš sakarsēts ķermenis. Taču neviens nespēja izskaidrot, kāpēc un kādā veidā spektrā rodas nevienmerīgs, katrai temperatūrai rakstu­rīgs sadalījums.

Viens no radioviļņu atklājējiem Heinrihs Hercs 1887. gadā konstatēja, ka gaismas iedarbībā no metāliem tiek izsisti elektroni. Un atkal gaismas elek- tromegnētisko viļņu teorija izrādījās bezspēcīga šo parādību izskaidrot.

Gadu agrāk amerikānis Alberts Maikelsons ar izbrīnu atklāja, ka tāda pasaules ētera nemaz nav! Neticēdams pats sev, viņš pēc gada kopā ar Eduardu Morliju eksperimentu atkārtoja. Tas pats rezultāts! Arī vēlāk precīzāki eksperi­menti šo secinājumu apstiprināja. Bet tad taču nevar arī pastāvēt gaismas viļņi! Jo nav vides, kur tie varētu izplatīties.

Atrisinājums nāca līdz ar jauno gadsimtu, kas cilvēcei atnesa jaunu fiziku un līdz ar to arī jaunu paradigmu.

Maksam Plankam 1900. gadā beidzot izdevās izskaidrot sakarsēto ķermeņu «balto» spektru. Sev pašam par pārsteigumu un pat nepatiku, viņš, audzināts klasiskās fizikas labākajās tradīcijās, bija spiests konstatēt, ka tas iespējams tikai tad, ja pieņem, ka gaisma ir nevis vilnis, bet gan sīku enerģijas daļiņu plūsma. Katras tādas daļiņas enerģija ir proporcionāla attiecīgā gaismas vilna frekvencei.

Ja četrdesmit divus gadus vecais Planks pats vēl šaubījās par jaunatklāto patiesību, nemaz nenojauzdams, ka iezvanījis jaunu laikmetu fizikā, tad divdesmitsešgadīgais Bernes patentu biroja darbinieks Alberts Einšteins pēc pieciem gadiem drosmīgi uztvēra šo jauno ideju un ģeniāli vienkārši izskaid­roja fotoelektrisko efektu, vienlaikus nosaucot Planka gaismas enerģijas daļi­ņas par gaismas kvantiem. Vēlāk radās vēl viens apzīmējums — fotons. Tikai daudz vēlāk šie epohālie darbi tika atzīmēti ar Nobela prēmiju (sk. 1. tabulu).

1. tabula

Deviņi mūsu gadsimta izcilākie zinātnieki —

kvantu fizikas pamatlicēji, kas par saviem atklājumiem saņēmuši pasaules prestižāko balvu zinātnē —

Nobela prēmiju fizika (sk. [157])

N.

p.k.

vārds, uzvārds

Nobela prēmijas

piešķiršanas gads

1.

Makss Planks (M. K. E. L. Planck, 1858-1947),

1918

vācu fiziķis

2.

Alberts Einšteins (A. Einstein, 1879-1955), vācu fiziķis

1921

3.

Nilss Bors (N. H. D. Bohr, 1885-1962), dāņu fiziķis

1922

4.

Luijs Viktors de Brojī (L. de Broglie, 1892-1987),

1929

franču fiziķis

5.

Verners Heizenbergs (W. Heisenberg, 1901-1976),

1932

vācu fiziķis

6.

Ervīns Šrēdingers {E. Schrddinger, 1887-1961),

1933

austriešu fiziķis

7.

Pols Adriens Moriss Diraks {P. A. M. Dirac, 1902-1984),

1933

angļu fiziķis

8.

Volfgangs Pauli (W. Pauli, 1900-1958),

1945

šveiciešu fiziķis

9.

Makss Borns {M. Born, 1882-1970), vācu fiziķis

1954

Šajā deviou ģēniju plejādē īpaši jāizceļ Lielais Kvintets — Bors, Heizcnbergs, Diraks, Pauli un Borns. Viņi izstradāja kvantu mehānikas statistisko interpretāciju. Filozofiski ievirzītais trio — Bors, Heizenbergs un Pauli — izveidoja kvantu fizikas filozofiskos pamatus, kas pazīstami ka Kopenhāgenas interpretācija (sk. 77. eseju).

Priekšstats par gaismas kvantiem divdesmit astoņus gadus veco dāni Nilsu Boru 1913. gadā beidzot noveda pie atomu spektru noslēpuma atrisinājuma. Elektroni atomā var atrasties tikai noteiktos enerģijas stāvokļos. Pārejot no viena stāvokļa otrā, tie vai nu iegūst enerģiju, uzņemot noteiktu enerģijas porciju, vai arī atdod to, izstarojot pilnīgi noteiktu enerģijas daudzumu gaismas kvanta veidā. Tā radās jaunā kvantu fizika, ko izstrādāja nākamajos divpadsmit gados.

Šie šķietami dīvainie zinātnes attīstības ceļi gaismas dabas izpētē ar atkārto­jošos pretēju paradigmu maiņu var kalpot par uzskatāmāko piemēru Lielo Patiesību meklējumos un demonstrē šo Patiesību komplementāro dabu.

Sākotnēji Ņūtons postulē, ka gaisma ir korpuskulu (daļiņu) plūsma. Vēlāk Heigenss, Jungs un Frenels parāda, ka gaisma ir vilnis. Bet gadsimtu mijā Planks un Einšteins apstiprina, ka gaisma tomēr ir korpuskulu plūsma. Vai tā būtu atgriešanās pie Ņūtona? Protams, nē. Gaismas dabu pilnībā apraksta abi šie šķietami nesavienojamie modeļi, kas savā būtībā ir Lielo Patiesību pretmeti.

Patiešām, lūstot, atstarojoties, interferējot, difraģējot gaisma parāda savu viļņa dabu. Taču spektros, fotoefektā, sakarsēta ķermeņa starojumā tā ir kor­puskulu (daļiņu) plūsma. Bet gaisma taču ir viena?!

Jā, gaisma ir viena. Bet tai ir divas dabas. Tā ir korpuskulu plūsma, kas izplatās pēc viļņu kustības likumiem. Nevis viens vai otrs, bet gan viens un otrs (sk. 14. eseju un 35. attēlu 78. lpp.). Un, kā vēlāk redzēsim, kvantu teorija rāda, ka šāds viļņa un korpuskulas duālisms ir raksturīgs ne tikai gaismai. Tā ir visas mikropasaules īpatnība, kas raksturīga gan elektroniem, gan atomiem un mole­kulām (sk. 16. eseju). Tā redzam, ka gaismas stars, kas jau senāk bija kļuvis par ceļvedi uz kosmosu, galu galā kļuva arī par instrumentu, kas deva iespēju ieska­tīties mikropasaulē. Un vēl daudz vairāk. Šis gaismas stars ir ari izgaismojis Lielo Patiesību meklējumu būtību. Tas mūs ievada 20. gs. modernās kvantu fizikas pasaulē, kurā mehāniskais determinisms ir tikai viena no Lielajām Patiesībām.

Šis īsais gaismas dabas apskats ir tikai uvertīra modernās 20. gs. fizikas «polifonijai» — uvertīra, ko veidojuši izcilākie mūsu gadsimta dižgari Makss Planks, Alberts Einšteins un Nilss Bors.

Minētie trīs gadsimta sākuma fundamentālie atklājumi veidoja tālāko bāzi jaunai fizikas nozarei — kvantu mehānikai, kas radās un veidojās 20. gs. trīs­desmitajos gados. Zinātnes vēsturē ienāca principiāli jauna paradigma, kas būtiski izmainīja vai, pareizāk sakot un atceroties Lielo Patiesību definīciju, papildināja iepriekšējo ņūtoniski dekartisko pasaules uzskatu.

5.5. Determinisms un indeterminisms kā komplementāri pretmeti

Kvantu mehānika, kā tālāk redzēsim, parādīja, ka mikropasaulē nedarbojas Ņūtona mehāniskā determinisma principi. Mikrodaļiņu «uzvedību» var aprakstīt tikai varbūtības teorijas ietvaros, to var aprēķināt tikai statistiskā

tuvinājumā. Striktās kauzalitātes vietā stājas statistiskā varbūtība, determinismu aizstāj (vai, pareizāk, papildina) izteikts indeterminisms. Ja Ņūtona mehānikas pamatos ir striktas noteiktības likumi, tad procesus mikrokosmā ierobežo t. s. nenoteiktības princips, ko 1924. gadā atklāja vācu fiziķis Verners Heizenbergs. Savukārt paradoksālo gaismas vilņa/daļiņas duālistisko koeksistenci mazliet vēlāk apraksta Nilsa Bora formulētais komplementaritātes princips. Šos un citus jaunās paradigmas jēdzienus un koncepcijas detalizēti aplūkosim citās šīs grāmatas esejās. Tie būtībā ir šo eseju vadmotīvs.

Laplasa tautietis franču matemātiķis Anrī Puankarē jau 1903. gadā paradig- miski epohālajā darbā «Zinātne un Metode» {«Science er Methode») parādīja, ka Ņūtona determinisms nav spēkā arī procesos, kas norit sarežģītās makro- sistēmās. Laplass uzskatīja, ka, ja vien precīzi zinām dabas likumus un sākot­nējo apskatāmās sistēmas (vai — saskaņā ar Laplasu — pat Visuma) stāvokli, tad mēs varam precīzi aprēķināt šīs sistēmas tālāko uzvedību, varam strikti prognozēt nākotnes notikumus, kā arī konstatēt visu, kas noticis pagātnē. Puankarē norāda, ka sarežģītās sistēmās sākotnējo stāvokli var noteikt tikai aptuveni (kvantu mehānika vēlāk pierādīja, ka daļiņas stāvokli principā nevar noteikt precīzi). Un, ja aprakstītā sistēma pēc savas dabas ir nelineāra, tad nelielas izmaiņas sākotnējā stāvoklī noved pie ārkārtīgi lielām izmaiņām tālākajā procesa gaitā, līdz tiek sasniegts galīgais sistēmas līdzsvara stāvoklis. Tikai vienkāršās, lineārās sistēmās darbojas Ņūtona deterministiskais mehā­nisms. Komplicēto, nelineāro sistēmu dinamiku var aprakstīt tikai ar statis­tiskām metodēm. Jaunās paradigmas būtību ar vizuāli uzskatāmām metaforām trāpīgi raksturojis vācu filozofs un loģikis Hanss Reihenbahs: «Norises dabā vairāk līdzinās ripojošiem spēļu kauliņiem nekā rotējošiem debesu ķerme­ņiem; tās nosaka varbūtību likumi, nevis kauzalitāte. Tāpēc šobrīd zinātnieks vairāk līdzinās ruletes spēlmanim nekā pravietim.»

6. EINŠTEINA RELATIVITĀTES TEORIJA UN JAUNĀ PARADIGMA ĢEOMETRIJĀ

Ņūtona mehānikas uzskatus par absolūtu un nemainīgu telpu un laiku, kurā noris determinētie dabas procesi, pašos pamatos satricināja Alberta Ein­šteina (5. att. 1. piel.) 1905. gadā formulētā speciālā relativitātes teorija.. Izrā­dījās, ka telpas un laika dimensijas ir atkarīgas no novērotāja kustības ātruma, tās nav absolūtas un nemainīgas, bet relatīvas.

Šķietami abstraktā relativitātes jēdziena filozofisko vispārinājumu vizuāli lieliski atainojis ģeniālais holandiešu grafiķis Mauritss Eshers. Šis zīmējums (6. att. 1. piel.) jāuztver kā vizuāla metafora, kurā parādīta relativitātes teorijas būtiskākā iezīme, proti, katram novērotājam, kas atrodas kustībā, ir sava atskaites sistēma.

Tālākajā jaunās paradigmas attīstības gaitā Einšteins 1915. gadā formulēja t. s. vispārīgo relativitātes teoriju. Saskaņā ar šo teoriju telpa un laiks veido saistītu četrdimensionālu telplaiku, kas ir nevis plakans, bet izliekts. Tā aprak­stam vairs nav piemērojama «plakanā» Eiklīda, bet gan jaunā — «sfēriskā» Rīmana ģeometrija (72. att. 199. lpp.).

Vai tas nozīmētu, ka Ņūtona mehānika ir principā aplama un noraidāma? Nebūt ne! Te darbojas Lielo Patiesību «saglabāšanas likums». Ņūtona mehā­nika kā Lielā Patiesība ir korekta noteiktā lietojamības diapazonā, proti, ja ķermeņu kustības ātrumi salīdzinājumā ar gaismas ātrumu nav lieli un ja pro­cesi nenoris loti blīvu vielas masu apkaimē. Mūsu ikdienā, kā arī visos inže­niertehniskajos aprēķinos un Saules sistēmas debesu mehānikā pietiekami precīzi darbojas Ņūtona mehānikas likumi. Turpretim, aprakstot visa kos­mosa evolūciju un uzbūvi, jālieto Einšteina vispārīgā relativitātes teorija. Citiem vārdiem sakot, Ņūtona un Einšteina mehānika viena otru papildina, tās ir komplementāras. Tas pats jāsaka par Eiklīda un Rīmana ģeometrijām. Zemes mērniecībā varam droši lietot Eiklīda ģeometrijas sakarības, bet «mērījumiem» kosmosa uzbūvē vajadzīga Rīmana ģeometrija.

7. JAUNO 20. GADSIMTA PARADIGMU VIENOTAIS KULTŪRSLĀNIS

Rezumējot iepriekšējās esejās iezīmētās domas, vēlreiz gribas uzsvērt, ka paradigmu maiņa zinātnē parasti ir saistīta ar laikmetam atbilstošām paradigmu maiņām citās cilvēces gara darbības sfērās — tādās kā filozofija, psiholoģija, māksla, literatūra, mūzika. Par šādu laikā horizontālu, ģeoloģisku noslāņo- jumu atgādinošu vienojošu kultūrslāni jau runājām, aplūkojot ģeocentriskās paradigmas aizstāšanu ar heliocentrisko, t. i., Ptolemaja pasaules uzbūves mode|a aizstāšanu ar Kopernika modeli.

Zinātnisko paradigmu maiņa 20. gadsimtā patiešām ari korelē ar jaunām tendencēm un avangardiskiem pagriezieniem gan bioloģiski antropoloģiskās, gan humanitārās zinātnēs, gan visās citās cilvēces gara aktivitātes sfērās. Tā pretmetā klasiskajai uz racionālismu vai biheiviorismu balstītajai psiholoģijai veidojas t. s. dzīļu jeb bezapziņas psiholoģija, Freida, Ādlera un Junga analī­tiskās psiholoģijas skolas. Tās pirmo reizi parāda cilvēka bezapziņas (vai zem­apziņas) procesu būtisko lomu un izcel racionālisma pretmeta— nacionā­lisma— nozīmi.

Mākslā sāk dominēt reālistiskās, figurālās mākslas pretmeti: atgādināsim Pikaso daudzšķautņainos, vairākdimensionālos «polifoniskā» skatījuma audek­lus (76. att. 4. piel.) un skulptūras vai modernā abstrakcionisma celmlauža Kandinska kolorītās gleznas, kur tēlus aizstāj krāsu mūzika (87. att. 4. piel.). Visspilgtāk un visadekvātāk 20. gs. jauno paradigmu idejas vizuālās metaforās un alegorijās atainojis holandiešu mākslinieks Mauritss Eshers [187]. Mēs jau minējām Eshera grafiku «Relativitāte» (6. att. 1. piel.), kas vizuāli ataino Ein­šteina speciālās relativitātes teorijas dziļāko būtību. Savukārt grafiku «Diena un nakts» ar baltajiem un melnajiem putniem var uzskatīt par ģeniālu vizuāli filozofisku Dao jan un iņ pretmetu un komplementaritātes principa vispāri­nājumu (9. att. 1. piel.). Satura bagātībā un idejiskā vispārinājuma ziņā nepār­spējams ir Eshera zīmējums «Kārtība un haoss», kas vizuālā alegorijā izsaka entropijas pieauguma būtību (46. att. 2. piel.). Beidzot, Eshera grafika ••Zīmējošas rokas» ilustrē paradoksu loģikas dīvainās cilpas (Strange Loops, 48. att. 2. piel.).

Literatūrā zemapziņas procesus lieliski atainojis Džeimss Džoiss romānā «Uliss» [78] un Marsels Prusts triloģijā «Zudušo laiku meklējot»; viņi radīja apziņas plūsmas asociatīvo ainu literāro aprakstu. Moderno mūziku iezvana Arnolda Šēnberga atonālais polifonisms, ko literatūrā tik dzi[i un uzskatāmi atainojis Tomass Manns ģeniālajā romānā «Doktors Fausts» [112]. Filozofijā varam minēt filozofiskā intuitīvisma pārstāvi francūzi Anrī Bergsonu, kas, lai arī būdams talantīgs matemātiķis, aicināja jēdzienisko domāšanu aizstāt ar iejūtu (intuīciju) un dabaszinātnisko, objektīvo laiku — ar psihisko ilgsta- mību, kas sasaista sevī pagātni, tagadni un nākotni. Psihiskā laika relativitāti mākslinieciski visspilgtāk izgaismojis Marsels Prusts romānā «Zudušo laiku meklējot». Jāpiemin arī viens no mūsu gadsimta izcilākajiem filozofiem Martins Heidegers. Viņš iezvana metafiziskās filozofijas galu [67, 126]. Viņu interesē racionāli nedefinējamais esamības slānis, kam var pietuvoties tikai dzejā un mākslā. Heidegers, tāpat kā Bors, pārmet tiltu starp Rietumu analī­tisko racionālismu un Austrumu misticismu. Viņš dziļāk nekā citi Rietumu filo­zofi izpratis dzenbudisma būtību [126].

Šie ir tikai daži piemēri, kā dažādās Cilvēces radošā gara sfērās gandrīz sinhroni mijiedarbojās jaunās paradigmas pamatiezīmes.

Varam teikt, ka laikmetu raksturojošā paradigma veido šā laikmeta kul­tūras «ģeoloģiskā slāņa» īpatnējo struktūru. Mūsu laikmetam atbilstošajā aug­šējā un vēl augošajā kultūras slānī sakņojas visdažādāko eksakto zinātņu un daiļo mākslu savdabīgās, it kā nošķirtās lapotnes. Bet to saknes savijas vienotā tīklā, barojas kopējā augsnē, kas veido mūsu laikmetam raksturīgo, vienrei­zējo, neatkārtojamo tekstūru.

Gandrīz visas Cilvēces gara aktivitātes 20. gs. paradigmu maiņā it kā apvie­nojas kopējā ansamblī, lai daudzveidīgā polifonijā iesaistītos Lielo Patiesību meklējumos. Pie šīs dominējošās paradigmas sinkrētiskās dabas atgriezīsi­mies vēlāk.

8. KVANTU FIZIKAS DZIMTĀS VIETAS: KEMBRIDŽA, GETINGENE, KOPENHĀGENA

Jaunā kvantu fizika mūsu gadsimta trīsdesmitajos gados neiznira kā Afro- dīte no paradigmu maiņas izraisītā paisuma putām. Tai pamatus ar paradok­sāliem (no klasiskās fizikas viedokļa) atklājumiem jau gadsimta sākumā bija likuši toreiz vēl jaunie fizikas «patriarhi» — Makss Planks, Alberts Einšteins un Nilss Bors.

Jaunās paradigmas dzimšana, bērnība un pubertāte norisa trijos izcilos Eiropas zinātnes centros: Kembridžā, Getingenē un Kopenhāgenā. Un tieši Kopenhāgena gadsimta divdesmitajos un trīsdesmitajos gados kļuva par mo­dernās atomfizikas Romu, Meku un Medinu — tur kā svētceļnieki pulcējās pasaules talantīgie fiziķi, jaunās fizikas adepti un vēlākie maestro. Sākumā Kopenhāgena gan šķietami nevarēja konkurēt ar vecākajām māsām — Kem­bridžu un Getingeni. Kembridžu apvija senās slavas oreols, tās gotisko koledžu pagalmos bija staigājuši Ņūtons un Maksvels, tur bija gan angļu fizikas tradī­ciju gaisotne, gan modernās fizikas vēsmas, ko ienesa jaunais Kevendiša labo­ratorijas galva, titāniskais Rezerfords, kas pirmais sadalīja «nedalāmo» atomu (etimologisks paradokss: «atoms» — grieķu vai. «nedalāmais»). Arī Getingene bija viens no Eiropas intelektuālajiem centriem. Kopš Gausa laikiem, kurš ģeniāli apvienoja pētījumus matemātikā un fizikā, tur bija vēsturiski izveido­jusies talantīgu matemātiķu un fiziķu sadraudze, kas veidoja bāzi abstraktu un matemātiski formalizētu teoriju radīšanai.

Šo lielo māsu sabiedrībā Kopenhāgena varēja šķist tikai pelnrušķīte, iznākusi 110 Andersena pasaku valstības. Par Kopenhāgenas pievilkšanas centru kļuva jaunais, ar viedīgu prātu un radošu intuīciju apveltītais dāņu fiziķis Nilss Bors (7. att. 1. piel.). Kā daudzsološs jauns fiziķis viņš sāka strādāt veiksmīgā eksperi- mentatora Rezerforda laboratorijā Mančesterā. Šī Meistara un Mācekļa sadar­bība bija necerēti auglīga. Bors izstrādāja jaunu atoma uzbūves modeli, kura ietvaros varēja veiksmīgi interpretēt Rezerforda slavenā eksperimenta rezultātus par (x daļiņu izkliedi atomā. Bet šis Bora modelis bija it kā nesamierināmā pretrunā ar zināmajiem klasiskās mehāniskas principiem. Pie šā jautājuma sīkāk pakavēsimies turpmākajā diskusijā. Tagad tikai piebildīsim, ka Bora atoma modelis un tā vispārinājumi pamatā balstījās tikai uz ģeniālu intuīciju, jo, pats to neapzinādamies, zinātnieks jau 1913. gadā izmantoja komplementaritātes principu, kam veltītas šīs esejas un ko viņš formulēja tikai 1927. gadā. Bet šie veiksmīgi uzsāktie novatoriskie pētījumi atomu uzbūves teorijā vainagojās ar Nobela prēmiju jau 1922. gadā.

Pēc Bora atgriešanās Kopenhāgenā Dānijas valdība un sabiedrība darīja visu iespējamo, lai savam izcilākajam zinātniekam un pirmajam dānim — Nobela prēmijas laureātam nodrošinātu pētījumu iespējas. Ar valsts atbalstu tika radīts vēlāk leģendārais Bora Atomfizikas institūts. Tas kļuva par pievilk­šanas centru daudziem talantīgiem fiziķiem, kas no visas pasaules brauca mācī­ties un strādāt pie Nilsa Bora un vēlāk kļuva par jaunās fizikas nozares — kvantu mehānikas— radītājiem. Nilss Bors bija ne tikvien talantīgs, ar ģeniālu intuīciju apdāvināts zinātnieks, bet arī lielisks cilvēks: labsirdīgs un iecietīgs. Viņa credo bija meklēt skolniekus, kas spētu kļūt gudrāki par savu skolotāju. Tas bija viens no Bora skolas sasniegumu pamatiem. Bors vienmēr bija atsaucīgs pret savu skolnieku un kolēģu īpaši trakajām idejām. Tai p^šā laikā viņš lieliski prata aizstāvēt savas idejas, kā to apliecināja viņa vairāk nekā desmit gadus ilgā diskusija ar otru gara titānu — Albertu Einšteinu. Tikai zinātnieks ar šādām dotībām varēja kļūt par zinātniskās skolas radītāju. Un drīz vien Kopenhāgenas skola, Andersena pelnrušķīte, kļuva par pasaules vadošo centru atomu un kodolu fizikā.

Bora Atomfizikas institūts atrodas Universitātes parkā Kopenhāgenas cen­trā. Ārēji tas ir visai necils trīsstāvu ēku komplekss, bez īpaša šika un arhitekto­niskiem varenības apliecinājumiem. Askētiski vienkārša ir arī leģendārā audi­torija A, kur Bors lasījis lekcijas un pirmajās rindās tajos slavas laikos parasti sēdējis krietns pusducis Nobela laureātu. Pēc Bora nāves no senās godības maz kas palicis — galvenokārt institūta vēstures liecības, kas tiek rūpīgi glabātas, krātas un sistematizētas institūta «bēniņos» (trešajā stāvā).

Getingenes spožo teorētiķu skolu vācu nacisti sagrāva jau trīsdesmitajos gados, kad no universitātes tika padzīti ebreju izcelsmes zinātnieki. Solida­rizējoties Getingeni pameta ari daudzi viņu kolēģi. No slavas oreola palikušas tikai piemiņas plāksnes: pie viesnīcas «Ēdene», kur Getingenes apmeklējuma laikā bija dzīvojis Nilss Bors, pie namu fasādēm, kur semināros un konfe­rencēs piedalījās Marija Kirī, Alberts Einšteins un daudzi citi tā brāzmainā laika spīdekļi; vientuļš palicis ari kvantu fizikas pioniera Maksa Planka kaps Getingenes kapsētā ar masīvu pieminekli, kurā iegravēta Planka konstantes skaitliskā vērtība.

Arī Kembridžas atomfizikas centra slava lēnām izplēnēja pēc lielā titāna Rezerforda nāves 1937. gadā. Rezerforda vietā nāca kristālfiziķis Bregs, kas labo­ratoriju ievadīja pavisam citās sliedēs un pēc pāris gadu desmitiem atnesa slavu, saistītu ar pēckara gadu ievirzi molekulārajā biofizikā: 1959. gadā Votsons un Kriks atklāja iedzimtības nesējas DNS dubultspirāles struktūru (14. att. 47. lpp.).

Otrā pasaules kara gados lielum lielais vairums antinacistiski noskaņoto izcilo zinātnieku no Eiropas emigrēja uz ASV. Daļa no viņiem piedalījās

Manhetenas projektā, kura ietvaros tapa pirmā atombumba, kas izmainīja visu tālāko cilvēces attīstības gaitu — vai uz labu vai ļaunu, to vēl rādīs nākotne. Bet paši izcilākie teorētiķi — gan fiziķi, gan matemātiķi —* pulcējās jaunajā pasaules smadzeņu centrā Prinstonas Padziļināto pētījumu institūtā (Institute for Advanced Studies). Šā institūta parkā bieži varēja redzēt kopējā pastaigā mūsu gadsimta fizikas gigantu Albertu Einšteinu un ģeniālo matemā­tiķi Kurtu Gēdelu: viņi — mūžīgie Lielās Patiesības meklētāji un jaunās para­digmas aizsācēji — totāli revolucionizēja gan 20. gs. fiziku, gan matemātiku.

Kad nacisti okupēja Dāniju, Nilss Bors bija spiests bēgt — vispirms uz Zviedriju, pēc tam uz ASV. Viņš gan piedalījās Manhetenas projektā, gan bija biežs viesis Prinstonā, lai atkal turpinātu sen iesākto dueli ar Einšteinu par kvantu fizikas pamatproblēmām (sk. [201]). Tieši tur pie Padziļināto pētī­jumu institūta ēkas bronzā iemūžināta Nilsa Bora piemiņa. Tas ir franču skulptora Antuāna Pevznera abstraktās formās veidotais piemineklis ar nosau­kumu «Konstrukcija Trešajā un Ceturtajā Dimensijā Nilsa Bora (1885—1962) piemiņai» (3. att. 15. lpp.). Uzraksts «Komplementaritātesprincipa autoram» liecina, ka no daudziem Bora sasniegumiem pieminekļa iecerētāji par visnozī­mīgāko atzinuši komplementaritātes principu, kuru patiešām var uzskatīt par visas mūsdienu dabaszinātņu filozofisko stūrakmeni.

Nezinātāju varbūt pārsteidz, ka zem šā uzraksta redzams pazīstamais dao- isma in un jan simbols (1. att. 14. lpp.) un tā formulējums «Contraria sunt cornplementa». Daoisma simbolu Bors dzīves laikā tika izmantojis arī savas dzimtas ģerbonī (2. att. 14. lpp.).

Viens no šo eseju mērķiem ir izsekot, kā saistās šis modernās fizikas (un ne tikai fizikas, bet visu dabaszinātņu) nozīmīgākais princips ar orientālo filo­zofiju, senķīniešu traktātu «Idzin» («Pārvērtību grāmatu»), Dao mācību un dzenbudisma pamatnostādnēm. Kas tad galu galā pēc būtības ir šis daudzi­nātais komplementaritātes princips?

9. KOMPLEMENTARITĀTES PRINCIPS, TĀ VĒSTURISKĀS SAKNES UN UNIVERSĀLA NOZĪMĪBA

Komplementaritāti var uzskatīt par universālu principu, kas atklājas dabas daudzveidīgo parādību pamatos un veido filozofisko bāzi mūsdienu dabas­zinātnēm, it īpaši kvantu fizikai un ķīmijai, molekulārajai bioloģijai, kā arī virknei jauno integrālo zinātņu, piemēram, kibernētikai, sinerģētikai un haosa teorijai.

Komplementaritātes principa zinātnisko pamatojumu, kā jau minējām, formulējis Nilss Bors. Tā filozofiskais vispārinājums izsakāms apgalvojumā «CONTRARIA SUNT COMPLEMENTA», ko varētu tulkot — pretmeti papil­dina viens otru. Šis princips latviskā terminoloģijā pazīstams arī kā papildi- nāmibas princips.

Ar komplementaritātes principu kā nozīmīgāko vispārinājumu modernajā kvantu fizikā Nilss Bors plašāku speciālistu auditoriju pirmo reizi iepazīstināja 1927. gada septembrī starptautiskajā fiziku kongresā Komo pilsētiņā Itālijā. Izklāstā viņš parādīja, ka vācu fizika Vernera Heizenberga tajā pašā gadā for­mulētais nenoteiktības relācijas princips būtībā ir daudz universālākā komple­mentaritātes principa īpašgadījums. Te jāpiebilst, ka nenoteiktības relācija ir kvantu mehānikas pamatprincips, kas ir vēl nozīmīgāks nekā Ņūtona likumi klasiskajā mehānikā. Būtībā visa kvantu mehānika balstās tieši uz nenoteik­tības principa postulātiem un var tikt atvasināta no tiem. Pēc diviem mēne­šiem — 1927. gada novembrī — Briselē sanāca atomfiziku Solveja kongress. Tajā centrālais jautājums bija jaunās kvantu fizikas pamatprincipu — neno­teiktības relācijas un komplementaritātes principa — vispusīga apspriešana. Kongresā piedalījās pasaules fiziku un fizikokīmiķu zieds: teoriju dižgari Planks, Einšteins, Bors, Heizenbergs, Šrēdingers, Pauli, Diraks, de Brojī, Borns, pazīstamie eksperimentatori Marija Kirī, Bregs, Komptons, Lengmīrs — visi vai nu jau esošie, vai arī nākamie Nobela prēmijas laureāti (sk. 8. att. 1. piel. un 1. tabulu 31. lpp.). Šajā forumā Nilss Bors formulēja un aizstāvēja universālo komplementaritātes principu, tā lomu fizikā, ķīmijā, bioloģijā, arī filozofijā.

Visdzīvākā diskusija risinājās starp Boru un Einšteinu. Einšteins izdomāja arvien jaunus iebildumus nenoteiktības relācijai un komplementaritātes prin­cipam, un Bors tos vienu pēc otra atspēkoja. Abu ģēniju duelis atgādināja pasaules šaha čempionu cīniņu. Šī diskusija turpinājās vēl daudzus gadus līdz pat Einšteina nāvei. Diskusija un ar to saistītās problēmas sīki iztirzātas Endrjū Vaitekera plašajā monogrāfijā «Einšteins, Bors un kvantu dilemma» («Einstein, Bohr and the Ģuantum Dilemma», [201]).

Jauno kvantu mehānikas interpretāciju aizstāvēja lielais ģēniju piecnieks — Bors, Heizenbergs, Pauli, Diraks un Borns (sk. 1. tabulu 31. lpp.). To vēstu­riski pazīst kā kvantu fizikas Kopenhāgenas interpretāciju. Einšteins šajā duelī palika neatzīts vienpatnis, un šobrīd modernajā atomzifikā kvantu fizikas sta­tistiskā interpretācija ir vispārpieņemta, to apstiprina daudzi jo daudzi eksperi­mentāli novērojumi.

Bors, tāpat arī Heizenbergs vēlākajos gados plaši diskutēja par komple­mentaritātes principa filozofiskajām konsekvencēm un nozīmi [12, 68]. Tomēr par konsekventāko komplementaritātes principa vispārinātāju kļuva šveicietis Volfgangs Pauli [103,135]. Viņš, viens no viskritiskāk domājošajiem fiziķiem, postulēja zinātnes un reliģijas komplementaritāti kā divu Lielo Patiesību reprezentāciju, kuras nevis izslēdz, bet papildina viena otru. Šajā kontekstā Pauli uzskatīja, ka savstarpēji papildinās arī pasaules lielās kultū­ras — Rietumu analītiski racionālā un Austrumu intuitīvi mistiskā pasaules uztvere. Pēdējā dzīves posmā viņš cieši sadarbojās ar vienu no analītiskās psiholoģijas pamatlicējiem Kārlu Gustavu Jungu un kopējos pētījumos parā­dīja racionālās un intuitīvās domāšanas, apziņas un bezapziņas komplemen­tāro būtību (sk. [135], 149. lpp., arī 72. eseju).

Komplementaritātes principa dziļāko būtību, kā jau minējām, izsaka Bora formulētais moto — pretmeti papildina viens otru. Tā nebūt nav hēgeliska pretrunu cīņa. Tā ir divu Lielo Patiesību vienība: katra no pusēm ietver dalu no Patiesības, bet tikai to apvienojums — visu Patiesību. Lielās Patiesības aina ir nepilnīga, ja nav pārstāvētas abas puses. Komplementaritātes principam pie­mīt dzi|a filozofiska jēga. Sākotnēji to uztvēra kā jaunu modernās zinātnes pamatprincipu, kā ultramodernās fizikas ideju. Bet drīz vien Nilss Bors, iepa­zinies ar Austrumu filozofiju — it īpaši ceļojuma laikā Japānā —, atklāja, ka šis «jaunais» princips īstenībā ir viens no cilvēces filozofiskās domas vissenāka­jiem vispārinājumiem. Šis filozofiskais vispārinājums vizuāli ietverts senkīniešu Dao reliģiskajā simbolā kā vīrišķā jan un sievišķā iņ pretmetu apvienojums.

Senķīniešu filozofijā jan un iņ ir divi pretmetu kosmoloģiskie pamatprin­cipi, kas nosaka visu lietu, parādību, notikumu un laika periodu kārtību [69]. Šie divi vispārinātie pretmeti rada duālismu, divējādību, kas, pēc Dao mācības, savukārt rodas no Pirmatnējā, Veselā [101]. Jan un iņ pāri vizuāli atveido kā apli, ko simetriski pārdala S veida līnija; viena laukuma dala ir tumša, otra — gaiša, taču vidū katram no šiem laukumiem ir punkts otra laukuma krāsā kā jan un iņ principu savstarpējā atkarība (1. att. 14. lpp.).

Jāuzsver, ka Senās Ķīnas filozofijā jan un iņ netika uzskatīti par antagonis­tiskiem pretstatiem (kā, piemēram, tēze un antitēze Hēge|a filozofijā), bet par pusēm, kas savstarpēji viena otru papildina, ciešā S veida līklīnijas formā simetriski piekļaujoties viena otrai. Jan un iņ ietekmes nav nesamierināmi pretējas, tās atrodas nepārtrauktā mijiedarbībā, un viena vai otra pamatprin­cipa ietekme periodiski te pieaug, te samazinās atbilstoši noteiktiem laika intervāliem. Austrumu filozofijā attīstību simbolizē aplis. Lielo Patiesību kom- plementaritāte un to līdzvērtība ir periodiski mainīga attīstības ciklos. Šo cik­liskās attīstības modeli lieliski apstiprina jau aplūkotie Lielo Patiesību meklēju­mi, kas veido modernās kvantu fizikas, relativitātes teorijas, sinerģētikas, haosa teorijas un, kā tālāk redzēsim, arī moderno kosmoloģisko teoriju pamatus.

Jan un iņ simboliku tiešām var uzskatīt par visģeniālāko cilvēces filozofis­kās domas vispārinājumu. Tur uzskatāmi redzams, ka vizuāli simboliskā izteik­smes forma ir ar nesalīdzināmi bagātāku informatīvo slodzi nekā jebkura ver­bāla izteiksme vai apraksts. Jan un iņ simbols spēj aizstāt plašu traktātu un ietver kā senās orientālās filozofijas pamatkategorijas, tā mūsdienu moderno dabaszinātņu alfa un omega—universālo komplementaritātes principu. Jan un iņ simbols nav statisks, tas sevī ietver ari attīstības dinamiku. To parāda sie­višķā iedīgļa (melnā punkta) klātiene vīrišķajā pusē un vīrišķā iedīgļa (baltā punkta) klātiene sievišķajā pusē. Šie iedīgli nesaraujami sasaista abas puses un norāda uz to kopējo izcelsmi no pirmatnējā substrāta.

Jāuzsver, ka jan un iņ simbolikas interpretācija ir daudz plašāka, vīrišķais un sievišķais tajā parādās dažādās citās metaforiskās izteiksmes formās. Tā. jan simbolizē ari gaismu, dienu, debesis, iņ — tumsu, nakti, zemi. Jan saistās arī ar stipro, auksto, cieto, arī ar tēvu, iņ — ar vājo, silto, pakļāvīgo, ari ar māti. Šajā simbolikā parādās gan vispārinātas, vizualizētas filozofiskās kategorijas un jēdzieni, gan tīri bioloģiskas un antropoloģiskas iezīmes, piemēram, jan saistās ar galvu, tātad racionālo, prātīgo, bet iņ ar vēderu — emocionālo, juteklisko. Tātad jan un iņ simbols sevī ietver radniecīgu, komplementāru kategoriju, jēdzienu un iezīmju kopu.

Vienreizīgs komplementaritātes ideju paudējs ir holandiešu grafiķis Mauritss Eshers. Komplementaritātes princips dominē daudzās jo daudzās viņa lieliska­jās grafikās, visspilgtāk — darbā «Diena un nakts», kas būtībā ir izvērsts, modernizēts un detalizēts jan un iņ simbolikas atveids (9. att. 1. piel.). Tā dzi(o filozofisko (un ari zinātnisko) saturu grūti aprakstīt vārdos. Līdzās kom­plementaritātes idejai tajā vispārinātā formā risināta objekta un fona prob­lēma. Baltie putni pakāpeniski klust par melno putnu fonu — un otrādi. Te uzreiz rodas viens no uztveres psiholoģijas mezgla jautājumiem: kas ir uztveres priekšmets un kas — fons?

Savdabīgu jan un iņ interpretāciju devusi māksliniece Māra Rikmane šīs esejas autoram veltītajā grāmatzīmē (10. att. 1. piel.). Šajā ekslibrī uz tradi­cionālā jan un iņ fona attēlotas divas mūzas. Viena no mūzām simbolizē zinātni, otra — mākslu. Šī vizuālā metafora uzsver zinātnes un mākslas sav­starpējo komplemcntaritāti.

10.JAŅ UN iŅ pretmeti senĶlnieŠu «daodedzin» un «idzin» tekstos

Verbāli jan un iņ filozofiskā būtība izteikta senkīniešu «Daodedzin» tekstos, par kuru autoru uzskata Dao reliģijas dibinātāju Laodzi. Vēsturiski par Laodzi maz kas zināms: ir zinas, ka viņš dzimis 604. gadā pirms Kristus un tātad dzīvo­jis vienlaicīgi ar Budu (623.-544. g. pr. Kr.), budisma pamatlicēju Indijā.

Vārds «Laodzi» tiešā tulkojumā nozīmējot «Vecais bērns». Tas saistīts ar leģendu, ka Laodzi māte iznēsājusi astoņdesmit gadus un piedzimstot viņš jau bijis vecs vīrs. Šī leģenda simboliski izteic Laodzi filozofijas būtību — viņš vienā personā apvienojis vecuma viedumu un pieredzi ar bērna atvērtību pasau­lei [94]. Laodzi visu mūžu nav baidījies uzdot gan sev, gan pasaulei netriviālus, bērnišķīgi naivus jautājumus un apšaubīt gadsimtiem ilgi pieņemtas atziņas. Tieši tas, šķiet, atvēris durvis uz apskaidrību, uz jaunām patiesībām.

Astoņdesmit septiņu gadu vecumā (517. g. pr. Kr.) Lao ticies ar otru lielo Ķīnas reliģijas un filozofijas titānu — trīsdesmit četrus gadus veco Konfūciju. Šī tikšanās atstājusi neizdzēšamu iespaidu uz Konfūciju, kas Lao salīdzina ar neuzvaramu pūķi, kurš ir viņpus visa viņam zināmā [101].

Saskaņā ar leģendu Laodzi devies prom no Ķīnas rietumu, t. i., Indijas, virzienā un robežpostenī atstājis 5000 hieroglifu garo traktātu «Daodedzin». (Vai simboliskā saikne ar budismu? Budisms izplatās pretējā — austrumu virzienā — vispirms Ķīnā un vēlāk Japānā.) Šā senkīniešu filozofiski reliģiskā traktāta nosaukums «Daodedzin» (grāmata par Dao un De) hieroglifu pierak­stā un tā leģendārais autors parādīts 11. attēlā (1. piel.). «Dzin» savukārt inter­pretē kā «prāta spēku» vai «dzīvības spēku».

Dao filozofijas jēga visspilgtāk formulēta «Daodedzin» XLII fragmentā [101]:

Dao radījis vienu.

No viena divējādība cēlusies.

Divējādība veidojusi trejādību.

Bet trejādība radījusi visas būtnes.

Būtnēm aizmugurē palikusi tumsa,

Pretī atspīd gaismas vizēšana,

Bet visu būtņu pirmsākumu veido abu saplūdums.

8 komplementārus kombināciju pārus tāras gan ar savu simbolisko nozīmi, saistītās trigrammas iegūst, atbilstoši

«Dao» tradicionāli tiek interpretēts kā Ceļš, pa kuru attīstās Pasaule. Tā būtība — pēc Laodzi — nav izsakāma vārdos. Patie­sības neizsakāmība vārdos ir viena no daoisma un budisma pamattēzēm. «Viens» tiek skaidrots kā haoss, no kura veidojas jan un iņ divējādība, starp kuriem — starp gaismu un tumsu — rit Pasaules Ceļš. Lai izprastu trejādības vei­došanos no jan un iņ pāra, jāielūkojas vienā no pasaules vecākajiem literatūras avotiem — senķīniešu «Idzin» — «Pārvērtību grā­matā». Šī enigmatiskā grāmata, iespē­jams, radusies ap 8. gs. pr. Kr. Tajā ap­kopoti teksti, kas veidojušies mītiskā Ķīnas valdnieka Fo Hi laikā ap 2950. g. pr. Kr. [101, 50],

«Idzin» (ang|u transkripcijā «I Ching», [50]) satur visabstraktākās rakstu zīmes agrīnajā cilvēces vēsturē. Atšķirībā no ēģiptiešu hieroglifiem, kurus veido vi­zuālas reālo lietu vai norišu pikto- grammas, vai vairāk abstrahētiem ķīniešu hieroglifiem «Idzin» tekstus veido tri­grammas vai heksagrammas, kas sastāv no nepārtrauktas vai pārtrauktas svītras. Nepārtrauktā svītra (—) simbolizē jan,

pārtrauktā svītra (- ) — iņ. Tēlainā

12. att. a — daoiskais jan un iņ simbols un no tā atvasinātās 8 trigrammas, kas ilustrē «Daodedzin» XLII fragmenta tek­stu: «Divējādība veidojusi trejādību»; b — senkīnieSu «Idzin» («Pārvērtību grā­matas») vispārināto jēdzienu 8 trigram­mas, t. s. Fo Hi (principalarrangemeni) sakārtojumā.

uztverē nepārtrauktā svītra (jan) tradi­cionāli nozīmē kalna dienvidu nogāzi, ko apspīd saule, bet pārtrauktā svītra (iņ) — kalna ēnaino ziemeļu nogāzi. Kombinē­jot šīs divas zīmes trigrammās, iegūstam (12. att.). Šīs trigrammas ir komplemen- gan ar matemātiski simetrisko jēgu, jo apmainot katru jan zīmi ar atbilstošo iņ

zīmi. \2.a attēlā simboliski atveidots, kā jan un iņ divējādība veido tre-

jadibu (trigrammas) «ldzv («Pārvērtību grāmatas») vis­

pārināto jēdzienu pamat simbolus [50], Fo Hi

sakārtojumā {«primal arrangement») trigram­

mas izvietotas pa apli {\2.b att.). Uz svarī­gākās N—S (ziemeļu— dienvidu) ass novietotas trigrammas, kas simbolizē

jan \Lh ieri) un iņ (Kun). Atbilstošās simboliskās pret­metu nozīmes mēs jau nosau­

cām (debesis — zeme; auksts silts; gaisma — tumsa; stiprs

stings — pakļāvīgs). Uz Ł-W(austrumu ļļ. a tt. «Idzin» («Pārvērtību gramatas»)

un rietumu) ass atrodas Li un K'an tri- 64 heksagrammas, kas iegūtas, trīs

grammas. Li simbolizē uguni, sauli, reizes sadalot trigrammas. Zīmējumā

zibeni, vasaru, skaistu, atkarīgu; K'an — attčlots viens no kanoniskās «Idzin» grā-

ūdeni, mēnesi, ziemu, bīstamu, grūtu, matas tckstiem divu vcidu sakārtojumā

r r civ/ a tc •/-"■/ o — kvadrātā un aplī.

attistosu. Uz vS w—Nt ass ir Lhen un Sun r

trigrammas: Chen simbolizē pērkonu,

pavasari, aktivitāti, kustīgumu; Sun — vēju, koku, maigumu, lokanību. U11, bei­dzot, uz SE—NWass atrodas Ken un Tui trigrammas: Ken simbolizē kalnu, atpū­tu, stūrgalvību, nekustīgumu; Tui — ezeru, lietu, rudeni, dzīvesprieku, pakalpību, apmierinājumu.

Kā redzams, šie simboli ir pietiekami vispārināti, tie apraksta gan nozīmī­gākos dabas objektus un parādības, gan cilvēka attiecības ar dabu un līdz­cilvēkiem.

Nozīmīgākais šajā filozofiski simboliskajā izklāstā ir tas, ka ar šādu abstraktu pierakstu var izteikt un parādīt svarīgākos savstarpēji korelējošos un papildi­nošos jēdzienus un īpašību pārus.

Līniju kombināciju tālāku attīstību piedēvē pusmītiskajam Ķīnas valdnie­kam Venam Vangam (ap 1150. g. pr. Kr.). Vens Vangs izmantoja Fo Hi bināro dalīšanas metodi, ar kuru sākotnējo Universa stāvokli — bez formas un tukšu, ko mūsdienu fizikā izprotam kā idealizētu haosa stāvokli (T'AICHI «without form, and void»), — sadala divos pretmetos jan un iņ. Vēl divreiz dalot katru jan un iņ, iegūst 8 trigrammas (8 = 23 ). Savukārt, trīs reizes dalot šīs tri­grammas, iegūst 64 heksagrammas (64 = 26 ).

Pazīstami divi trigrammu un heksagrammu sakārtojumi: Fo Hi («primal arrangement») un Vena Vanga {«inner-tvorld arrangement») [50].

Fo Hi trigrammas redzamas 12. Ł attēlā (44. lpp.). Vēl trīs reizes tās sadalot, iegūst 64 heksagrammas (13. att. 45. lpp.). Šajā zīmējumā attēlots viens no kanoniskās «Idzin» grāmatas tekstiem divos sakārtojuma veidos — kvadrāta un apļa formā. Fo Hi tekstos jan un iņ atrodas diametrāli pretējos polos — kvadrātā kā labējā apakšējā un kreisā augšējā stūra heksagrammas. Ari apļa sakārtojumā jan un iņ zīmes atrodas pretpolos. Turpretim Vena Vanga sakārtojumā jan un iņ atrodas blakus pozīcijās [50].

«Idzin» pamatteksts tad arī uzrakstīts heksagrammās, un, kā norādījis amerikāņu matemātiķis Martins Gārdners, ar 64 heksagrammu palīdzību var praktiski aprakstīt itin visu virs Zemes un Debesīs [50, 51]. Turklāt nozīmīga ir jēdzienu pakārtotība: jan un iņ ir visaptverošākie jēdzieni, trigrammās — tiem pakārtotie (12. att. 44. lpp.) un, beidzot, heksagrammās jau konkrēti pakārtotie jēdzieni, vārdi un aforismi.

«Idzin» neapšaubāmi ir viens no visvecākajiem Austrumu literāri filozo­fiskajiem traktātiem. Pēc formas un satura tas ar savu simboliku ir visabstrak­tākais un kabalistiskākais sacerējums. Tas atstājis dziļas un paliekošas pēdas gan daoismā, gan konfucionismā. Būtībā iņ un jan vispārināto komplemen­tāro pāru simbolikas pirmsākumi meklējumi tieši «Idzin» Ch'ien un K'un trigrammās. Austrumos «Idzin» heksagrammas skaidrojošie aforismi daudzus gadsimtus izmantoti orākuliskiem nākotnes zīlējumiem [50].

Pravietiskās heksagrammas skaidrojošās vārdiskās formulas un aforismus sameklē īpašā sakrālā rituālā, kas pēc būtības balstās uz stohastiskiem, gadī­juma virzītiem principiem. Tos realizē ar 49 īpašām nūjiņām, tās grupējot un sadalot reglamentētu formulu ietvaros. Rezultātā iegūst rituālos skaitļus 6, 7, 8 vai 9. Pāra skaitli (6 vai 8) norāda iņ (pārtraukto), bet nepāra (7 vai 9) — jan (nepārtraukto) heksagrammas līniju. Savukārt 6 vai 9 norāda virzību uz citu — nākotni vēstošo heksagrammu. Kā jau līdzīgos orākula zīlējumos, atrastie aforismi var būt ar diezgan aizplīvurotu saturu, palaikam divdomīgi un tāpēc diezgan brīvi interpretējami.

«Idzin» angliskā tulkojuma priekšvārdā ievērojamais šveiciešu psihoana­lītiķis Karls Gustavs Jungs skaidro šā traktāta orakulāro iedabu ar minēto 64 heksagrammu arhetipisko raksturu, kas ļauj pieslēgties cilvēces kolektīvajai bezapziņai [50], Šāds skaidrojums sakņojas Junga teorijā par psihisko un fizikālo notikumu «sinhronismu» [50, 82, 135]. Šādu sinhronismu nevar interpretēt kā kauzāli saistītus notikumus Rietumu deterministiskās paradigmas izpratnē. Tie ir «necēloniski» saistīti kā daļa no kosmosa vispārīgā mērķvirzītā «dizaina», kas atrodas aiz racionāli analītiskās izziņas robežas, bet var tikt uztverts un fiksēts pa cilvēces kolektīvās bezapziņas iracionālajiem arhetipu kanāliem.

Nav grūti saskatīt «Idzin» principu tuvību Hermana Heses «Stikla pērlīšu

Dezoksiribozes -

14. att. Ģenētiska koda nesējas dczoksiribonukleīnskābes (DNS) makromolekulas she­matisks attēls. Ģenētiskā informācija ierakstīta DNS bāzu (A, T, G, C) četrburtu alfabētā (sk. 61. att. 154. lpp.). Gc »čtiskā koda pamatelementu kodonu — veido 3 DNS bāzu triplets. DNS «alfabētā» ir 64 tripletu «burti», kur katrs triplets kodē noteiktu aminoskābi un nosaka to secību proteīnu (olbaltumu) makromolekulu sintēzē.

spēlei» — kastāliskā garīguma augstākajai izpausmei, kurā Hese ietvēris priekšstatus par universālu zīmju valodu un to lomu augstākās patiesības mek­lējumos [71].

Interesanti, ka 17. gs. dzīvojušais vācu filozofs un matemātiķis Gotfrīds Vilhelms Leibnics bija pārliecināts, ka viņš pirmais izgudrojis bināro skaitī­šanas metodi. Liels bija Leibnica pārsteigums, kad jezuītu misionārs Tēvs Joahims Būvē pēc atgriešanās no Ķīnas viņam pavēstīja, ka binārā skaitīšanas sistēma Fo I ii bijusi pazīstama 3000 gadus pr. Kr. [50]!

Patiesi dzi(u apbrīnu un pietāti izraisa Austrumu viedīgo prātnieku spēja ar intuitīvu, iekšēji vērstu skatījumu apjaust un izgaismot Lielo Patiesību arheti­pus. Šo intraverto, iracionālo skatījumu, intuitīvo, racionāli analītiskam prā­tam grūti sasniedzamo apgaismību, ko dažkārt nosauc par mistiski dievišķo skatījumu, bet dzenbudisti — par augstāko, tikai meditācijā sasniedzamo apskaidrību satori, modernās arhetipiskās dzīļu psiholoģijas pamatlicējs Karls

Gustavs Jungs [79, 80, 81, 82] skaidro kā cilvēces kolektīvās bezapziņas arhetipisko atklāsmi. Gārdners konstatē, ka binārā skaitīšanas sistēma un skaitļa 2 pakāpes funkcijas (2n ) dominē daudzās matemātiskās un fizikālās struktūrās [50]. Vēl jāpiebilst, ka ari mūsdienu datoru, tāpat kā digitālo tele­komunikāciju un kompaktdisku «valoda» ir bināra.

Atgriežamies pie «Idzin» valodas. Iezīmējas dīvaina sakritība: «Idzin» pirm­teksts parāda, ka ar 64 heksagrammām (t. i., 64 = 26 — binārā pierakstā) var izteikt visu tā daudzveidību, kas ar komplementāriem jēdzieniem un vārdiem aprakstāms pasaulē. Ievērojamais lingvists un semiotikas speciālists Vjačeslavs Ivanovs grāmatā «Pāris un nepāris» norāda ([76], 95. lpp.), ka arī ģenētiskā koda «valoda» veidota no 26 = 64 elementiem. Ģenētiskā koda pamatelemen­tu — «burtu» — veido trīs DNS (dezoksiribonukleīnskābes) bāzes triplets (kodons) un tai komplementārā bāzu triāde DNS dubultspirālē (14. att. 47. lpp.). DNS «alfabētā» ir 64 tripletu «burti», turklāt katrs «burts» kodē noteiktu aminoskābi un nosaka tās secību proteīnu (olbaltumvielu) makro- molekulu sintēzē. Un tā ar šiem 64 DNS «burtiem» var ģenētiski ieprogrammēt visu bezgalīgo formu daudzveidību, kas parādās dzīvajā dabā. (Te gan jāpiebilst, ka ģenētiskais kods ir informatīvi «pārsātināts» vai, kā pieņemts sacīt, deģene­rēts. DNS alfabēta 64 bāzu tripleti tiek izmantoti 20 dzīvos organismos sasto­pamu aminoskābju sintēzei. Tas nozīmē, ka vienu aminoskābi kodē vairāki bāzu tripleti. īpaši tripleti tiek izmantoti interpunkcijai — ģenētiskā teksta «teikumu» sākuma un nobeiguma apzīmēšanai.)

Pēc Ivanova domām [76], arī cilvēku valoda veidojusies pēc līdzīgiem struktūras principiem. Tas viss liek apbrīnot dziļo filozofisko domu, ar ko sākas Jāņa evaņģēlijs, — «Pirmsākumā bija Vārds» [11]. Šīs domas dziļums īpaši izprotams mūsdienu molekulārās bioloģijas atziņu kontekstā. Pēc ģenē­tiskā koda atšifrēšanas (ko figurāli var salīdzināt ar ēģiptiešu hieroglifu atšif­rēšanu) kļuva skaidrs, ka visas dzīvās radības daudzveidīgās formas un to iz­pausmes ir tekstuāli ieprogrammētas DNS bāzu tripletu (kodonu) alfabētā, kura «burti» veido vārdus un teikumus. Un tāpēc patiesi varam sacīt: «Pirm­sākumā bija Vārds!»

Ilustrācijai 15. attēlā parādīts visprimitīvākā mikroorganisma — bakteriālā vīrusa <t>X174 — ģenētiskais teksts, kas ietverts vienā DNS makromolekulas ķēdē. Ikvienu šā teksta burtu veido DNS bāzu triplets. Tātad šeit tiek izman­tots alfabēts, kas sastāv no četrām zīmēm G, A, T un C. Šis teksts satur ap 1800 tripletu burtus, un tas jālasa mums ierastā manierē no kreisās puses uz labo, rindu pēc rindas. Cilvēka genoma teksti ir nesalīdzināmi ietilpīgāki, tie tālu pārsniedz Bībeles vai «īliadas» apjomus. Interesanti, ka proteīnu sintēzē šis četrzīmju alfabēts tiek pārveidots divdesmitzīmju alfabētā, jo proteīni (olbaltumvielas) veidojas no 20 aminoskābēm. Ari pie šīs tēmas vēl atgriezī­simies 29. un 40. esejā.

OAGT TTTATCGCTTCCATGACGCAOAAGTTAACACTTTCGGATAT TTCTGATGAGTCGAA

AAATTATCTTOATAAAGCAGGAATTACTACTGCTTGTTTACGAATTAAATCGAAGTOGAC

TGCTOGCOGAAAAĪOAOAAAATTCOACCTATCCTTŪCGCAOCTCOAOAAGCTCTTACTTT

GCOACCTTTCGCCATCAACTAACOATTCTOTCAAAAACTGACOCGTTGOATGAGGAGAAG

TGGCTTAATATGCTTGGCACGTTCGTCAAGGACTGGTTTAGATATGAOTCACATTTTGTT

CATGGTAOAGATTCTCTTGTTGACATTTTAAAAGAGCGTOOATTACTATCTGAGTCCGAT

GCTGTTCAACCACTAATAGGTAAGAAATCATOAGTCAAGTTACTGAACAATCCOTACGTT

TCCAGACCGC TTTGOCCTCTATTAAGCTCATTCAGOC ĪTCTDCCGTTTTGOATTTAACCfi

AAGATGATTTCGATTTTCTGACOAGTAACAAAGTTT GGATTGCTACTGACCGCTCTCGTG

CTCGTCOCTGCOTTOAOOCTTGCOTTTATOOTACGCTGGACTTTGTGGGATACCCTCOCT

TTCCTGCTCCTOTTOAOTTTATTOCTOCCGTCATTGCTTATTATGTTCATCCCOTCAACA

TTCAAACOOCCTGTCTCATCATGOAAOOCOCTOAATTTACOOAAAACATTATTAATGGCG

TCOAGCGTCCOflTTAAAOCCGCTGAATTOTTCOCOTTTACCTTOCGTGTACOCGCAGGAA

ACACTGACGTTCTTAC-TGACGCAOAAGAAAACGTGCGTCAAAAATTACGTGCGGAAGGAG

TGATOTAATGTCTAAAGGTAAAAAACGTTCTGGCGCTCGCCCTOGTCGTCCGCAGCCGTT

OCOAGOTACTAAAGGCAAOCGTAAAGGCOCTCGTCTTTGGTATGrAGGTGGTCAACAATT

TTAATTGCAGGGGCTTCOGCCCCTTACTTGAGGATAAATTATGTCTAATATTCAAACTGG

CGCCGAGCGTATGCCGCATGACCTTTCCCATCTTGGCTTCCTTGCTOGTCAGATTGGTCG

TCTTATTACCATTTCAACTACTCCGGTTATCGCTGGCGACTCCTTCGAGATCOACGCCGl

TGOCOCTCTCČOTCTTTCTCCATTOCGTCOTOGCCT TGCTAT TGAC TCTACTGT AGACA f

TTTTACTTTTTATGTCCCTCATCOTCACGTTTATGGTGAACAGTGGATTAAGTTCATGAA

GGATGGTGTTAATGCCACTCCTCTCCCGACTGT TAACACTACTGGTTATATTGACCATGC

CGCTTTTCTTOGCACGATTAACCCTGATACCAATAAAATCCCTAAGCATTTGTTTCAOGG

TTATTTGAATATCTATAACAACTATTTTAAAGCOCCOTGOATGCCTOACCGTACCGAGGC

TAACCCTAATOAOCTTAATCAAGATOATOCTCGTTATGGTTTCCGTTGCTGCCATCTCAA

AAACATTTGGACTGCTCCGCTTCCTCCTGAGACTGAGCTTTCTCGCCAAATBACGACTTC

TACCACATCTATTGACATTATDGGTCTOCAAGCTGCTTATGCTAATTTGCATACTGACCA

AOAACGTGATTACTTCATOCAOCOTTACCATGATOTTATTTCTTCATTTGGAGGTAAAAC

CTCTTATOACOCTGACAACCOTCCTTTACTTGTCATGCGCTCTAATCTCTGGGCATCTGG

CTATGATGTTGATGOAACTOACCAAACOTCGTTAOGCCAGTTTTCTGGTCGTGTTCAACA

GACCTATAAACATTCTGTGCCOCGTTTCTTTOTTCCTGAGCATGGCACTATGT TTAC TCT

TGCGCTTGTTCGTTTTCCOCCTACTGCGACfAAAOAOATTCAGTACCTTAACGCTAAAGG

TGCTTTGACTTATACCOATATTOCTGOCOACCCTGTTTTGTATGGCAACTtGCCGCCGCG

TGAAAT TTCTATGAAGGATOTT TTCCGTTCTGGTGA TTCGTCT AAGAAGTT TAAGATTGC

TGAGGGTCAGTOOTATCGT TATGCGCCTTCGTATGT T TCTCCTOCTTATCACCTTCT TGA

AGOCTTCCCATTCATTCAGGAACCGCCTTCTGGTGAT TTGCAAGAACGCGTAC TTAT TCG

CCACCATGATTATGACCAGTGTTTCCAOTCCGTTCAGTTGTTGCAGTDGAATAGTCAGGT

TAAATTTAATOTGACCOTTTATCGCAATCTOCCGACCACTCGCGATTCAATCATGACTTC

GTOATAAAAGATTGAOTOTGAGGTTATAACOCCGAAGCGOTAAAAATTTTAATTTTTOCl'

GCTOAGGGGTTGACCAAGCGAAGCGCGGTAGGTTTTCTGCTTAGGAGTTTAATCATGTTT

CAGACTTTTATTTCTCOCCATAATTCAAACTTTTTTTCTGATAAGCTGOTTCTCACTTCT

GTTACTCCAGCTTCTTCOGCACCTGTTTTACAGACACCTAAAGCTACATCGTCAACGTTA

TATTTTGATAGTTTOACOGTTAATGCTOOTAATGOTGOTTTTCTTCATT'ļCATTCAGArG

GATACATCTGTCAACGCCGCTAATCAGGTTGTTTCTGTTGGTGCTGATAIrGCITUGAl

GCCGACCC TAAAT TTTTTOCCTGTTTGGTTCGCT TTOAGTCT TCTTCGGTTCCGAC TACC

CTCCCGACTOCCTATOATOTTTATCCTTTGAATGOTCOCCATGATGGTGGTTATTATACC

OTCAAGOACTGTGTOACTATTGACGTCCTTCGCCOTACGCCOGGCAATAACGT T TATGT T

GGTTTCATGGTTTGGTCTAACTTTACCGCTACTAAATGCCGCGGATTGGTTTCGCTGAAT

CAOOTTATTAAAOAOATTATTTOTCTCCAOCCACTTAAGTOAOOTOATTTATOTTTOGTG

CTAT TGCTGGCGGTATTGCT TCTGCTCTT6CTGGTG0CGCCATGTC TAAAT TGTTTGGAG

OCGGTCAAAAAGCCGCCTCCGOTGGCATTCAAOOTOATOTOCTTOCTACCCATAACAATA

CTGTAGGCATGGOTGATGCTGGTATTAAATCTOCCATTCAAOOCTCTAATGTTCCTAACC

CTOATOAGGCCOCCCCTAGTTTTOTTTCTOOTOCTATGOCTAAAGCTGOTAAAOOACTp:

TTGAAGGTACGTTGCAGGCTOGCACTTCTGCCOTTTCTGATAAGTTGCTTGATTTGGTTP

G ACTTGGTGGC AAGTC TOCCGC TG AT AAAOOAAAGGA TACTCGTGATTATCTTGCTOCTO

CATTTCCTGAGCTTAATGCTTGGGAGCGTGCTGGTGCTGATGCTTCCTCTGCTGGTATGG

TTGACGCCOGATTTGAGAATCAAAAAOAGCTTACTAAAATGCAACTGGACAATCAGAAAG

AGAT TGCCGAOATOCAAAATOAOACTCAAAAAGAGATTGCTGGCA ĪTCAGTCGOCfiACTT

CACGCCAGAATACGAAAGACCAGGT ATATGCACAAAATGAOATGCTTGCT tATCAACAGA

AOGAOTCTACTGCTCOCGTTGCGTCTATTATGOAAAACACCAATCT TTCCAAGCAACAGC

AGGTTTCCGAGATTATOCGCCAAATGCTTACTCAAGCTCAAACGGCTGGTCAOTATTTTA

CCAATGACCAAATCAAAGAAATGACTCGCAAGGTTAGTGCTGAGGTTGACTTAGTTCATC

AGCAAACOCAGAATCAGCGGTATGGCTCTTC TCATATTGGCGCTACTGCAAAGGATATTT

CTAATGTCGTCACTGATGCTGCTTCTGOTGTOGTTOATATTTTTCATGGTATTGATAAAG

CTGTTGCCGATACTTGGAACAATT1CTGOAAAGACGGTAAAGCTGATGG1ATTGOCTCTA

ATTTOTCTAOGAAATAACCGTCAOOATTGACACCCTCCCAATTGTATGT TTICATGCCTC

CAAATCTTGGAOGCTTTTTTATGGTTCGTTCTTATTACCCTTCTOAATGTCACGCTGATT

ATTTTGACTTT0A0C0TATC0A00CTCTTAAACCT0CTATT6AGGCTTGTGGCATTTCTA

CTCTTTCTCAATCCCCAATGCTTGGCTTCCATAAGCAGATGGATAACCGCATCAAGCTCT

TGGAAOAGATTCTGTCTT TTCGTATGCAGGGCGTTGAGTTCGATAATGGTGATATGTATG

TTGACGGCCATAAGGCTOCTTCTGACGTTCGTGATGAGTTTOTATCTGTTACTGAGAAGT

TAATGGATOAATTGGCACAATGCTACAATGTGCTCCCCCAACTTGAT AT TAATAAC ACTA

TAGACCACCGCCCCGAAGGGGACGAAAAATGGTTTTTAGAGAACGAGAAGACGGTTACGC

AOTTTTOCCGCAAGCTGOCTOCTOAACGCCCTCT TAAGGATATTCGCGATGAGTATAAT T

ACCCCAAAAAGAAAGGTATTAAGGATOAGTGTTCAAGATTOCTGGAGGCCTCCACTATGA

AATCGCGTAGAGGCTTTGCTATTCAOCGTTTGATOAATGCAATGCGACAGGCTCATGCTG

ATGGTTGGTTTATCOTTTTTGACACTCTCACOTTGOCTGACGACCGATTAGAGGCGTTTT

ATGATAATCCCAATGCTTTGCGTGACTATT TTCGTGATATTGOTCGT ATOGT TCTTOCTG

CCGAOGGTCGCAAGGCTAATGATTCACACGCCGACTGCTATCAGTATTTTTGTGTGCCTG

AGTATGGTACAOCTAATOOCCGTCTTCATTTCCATGCOGTGCACTTTATGCGGACACTTC

CTACAaGTAGCGTTOACCCTAATTTTOGTCGTCGOGTACGCAATCGCCGCCAOT TAAATA

GCTTOCAAAATACGTGOCCTTATGGTTACAGTATGCCCATCGCAGTTCGCTACACGCAGG

ACGCTTTTTCACOTTCTGGTTGGTTGTGGCCTGTTGATGCTAAAGGTGAGCCGCTTAAAG

CTACCAGTTATATGOCTGTTOOTTTCTATGTGOCTAAATACGTTAACAAAAAGTCAGATA

TGGACCTTGCTGCTAAAGGTCTAGGAGCTAAAGAATGGAACAACTCACTAAAAACCAAGC

TOTCGCTACTTCCCAAGAAOCTGTTCAOAATCAGAATGAOCCGCAACTTCGGGATGAAAA

TOCTCACAATGACAAATCTOTCCACOOAGTBCTTAATCCAACT TACCAAGC'GGGTTACG

ACGCGACGCCGTTCAACCAGATATTGAAGCACAACGCAAAAAGAGAOA TGAGA T TGAGGC

TGOOAAAAUTTACTGTAGCCOACGTTTTGGCGGCGCAACCTGTGACGACAAATCTGCTCA

AATTTATGCOCOCTTCGATAAAAATGATTGGCGTATCCAACCTGCA

15. att. Visvienkāršākā mikroorganisma — bakteriālā fāga <t>X174 — ģenētiskais kods, kas ieslēgts vienā DNS makromolekulas kčdē. Šis teksts satur 1800 tripletu «burtus» (kodonus), kas jālasa ierastā manierē no kreisās uz labo, rindu pēc rindas, un ilustrē Jāija evaņģēlija filozofisko domu: «Pirmsākumā bija Vārds.»

10.1. TrejAdiba «Idzin>> trigrammas

un ikebanas simbolikā

Citātā no «Daodedzin» pieminētā trejādiba var tikt attēlota gan aplūkotajās «Idzin» trigrammās (12. att. 44. lpp.), gan vispārinātā triādes simbolā (16. att.), kas gan ir mazāk izplatīts nekā jan un iņ simbols. Šī triāde simbolizē saikni starp Debesīm, Zemi un Cilvēku; Cilvēks ir kā starpnieks starp Debesīm un Zemi. Šādu simbolu eseju autors pirmo reizi redzēja Japānā Horjudzi 7. gs. budistu tempļa Saiendo (Rietumu rotondas) jumta dekorējumos. Šajā pirms vairāk nekā 1300 gadiem būvētajā oktagonālajā svētnīcā glabājas Būdas attēli no 6. gadsimta, un tā ieņem vienu no pirmajām vietām Japānas nacionālo kul­tūras dārgumu zelta fondā.

Šādai triādei ir izcila loma japāņu puku sakārtojuma — ikebanas —- sim­bolikā, kur katram komponentam — Debesīm, Cilvēkam un Zemei — at­bilst savs ziedu kopas zars. Fotogrāfijā (17. att. 1. piel.) attēlotā sakārtojuma augšējais kuplais zars simbolizē Debesis vai Dievu (shin), nelielais zars, kas no­liecas pa labi, — Cilvēku (soe), bet sar­kanīgo ziedu kopa — Zemi (taij) [ 153]. Līdzīgi triādes simbolikā veidoti ziedu sakārtojumi visbiežāk sastopami japāņu mājokļos estētiskajā svētvietā — nišā, ko sauc par tokonomu. Šo goda vietu līdz ar vienīgo ziedu kārtojumu rotā vēl tikai viena filozofiska ainava vai tīstoklis ar kaligrāfiskiem hieroglifu rakstiem — visbiežāk dzeju vai aforismiem. Ne velti dižais japāņu rakstnieks Kavabata Jasu- nari raksta: «Viens zieds daudz labāk nekā simt ziedu izsaka puķes īsteno burvību.» Japāņu estētikas pamatā ir vienkāršība, asimetrija un šķietama nepa­beigtība, ko raksturo estētiskā kategorija šibui.

Ikebanai ir ļoti senas tradīcijas. Tā jfi {t ienāca Japānā jau 6. gadsimtā līdz ar

Daoiskā triāde________________________ budismu un meditatīvām tējas dzeršanas

Debesis, Zeme, Cilvēks. ceremonijām. Pazīstami ap trīsdesmit

tradicionālie ikebanas stili. Vissenākais no tiem ir Rikka [49] — ziedu sakārto­jums budistu tempļos kā ziedojums dieviem. Šis sakārtojums ir komplicētāks un parasti satur 7 vai 9 simboliskus elementus. Ziedojums dieviem — kā senās japāņu reliģijas sintoisma dievībām, tā budisma svētajiem — arī satur trīs pamata elementus: gaismu, smaržas un ziedus. Bet nekad asiņu upurus kā daudzās citās pasaules reliģijās.

Jāuzsver, ka skaitlim trīs piedēvēta īpaša nozīmība gan daudzu tautu mito- loģijās, gan reliģijās. Gan kristietībā ir trīsvienība: Tēvs, dēls un Svētais Gars, gan hinduismā — dievu triāde: Brahma, Višnu un Šiva, gan Senajā Ēģiptē — Izīda, Ozīriss un Hors. Kristietības pamatā ir arī trīs tikumi: ticība, cerība un mīlestība. Bet universāls radošas piepildītības simbols ir trijotne — vīrietis, sieviete, bērns [69].

11. jan un IŅ pretmetu lĪdzĪbas rietumu PASAULĒ

Austrumu «Idzin» meistariem ir cieša gara radniecība ar sengrieķu pitago- riešu filozofisko skolu. Pitagorieši par visa pirmsākumu — gan par matērijas, gan par tās stāvokļu un īpašību pamatu — uzskata skaitli. Skaitļa pretmetu vispārinātie pamatelementi — analogi Austrumu jan un iņ — ir pārīgais un nepārīgais. Nepārīgais ir ierobežots, pārīgais — neierobežots. Pāris un nepāris savukārt veido vienoto.

Aristotelis darbā «Metafizika» skaidro pitagoriešu filozofiskās pamettēzes. Viņi apgalvo, ka eksistē desmit pa pāriem sakārtotu pirmsākumu: ierobežotais un neierobežotais, nepārīgais un pārīgais, vienotais un kopa, labais un kreisais, vīrišķais un sievišķais, mierā esošais un kustīgais, taisnais un līkais, gaisma un tumsa, labais un ļaunais, kvadrātiskais un garenais ([76], 99. lpp.).

Redzam, ka pitagoriešiem — līdzīgi kā Dao filozofijas pārstāvjiem — pasaules pamatus veido komplementāri kategoriju pāri, jan un iņ tipa pret­meti, kas papildina viens otru. Sos pretmetus veido Pirmā, sākotnējā primāta polarizāciju daudzveidība (sal. ar Dao traktātu, sk. 10. eseju).

Morāli ētisko un filozofisko kategoriju pretmetus Svētais Asīzes Francisks brīnišķi iekļāvis savā Miera lūgšanā, kuru uzskata par vienu no skaistākajām kristiešu lūgšanām:

Dievs, lai topu par Tavu miera ieroci:

Lai nesu mīlestību tur, kur valda naids, Lai p iedošanu dēstu tur, kur pārestība, Lai vienotība iemājo, kur nesaskaņa, Lai p a t i e s ī b a tur, kur maldi iedēstīti, Lai ticība tur iedegas, kur šaubas māc, Lai uzvar cerības, kur izmisums, Lai gaisma uzaust tur, kur tumsība, Lai p r i e k u nesu tur, kur skumība!

Cik skaisti šajā Svētā Franciska lūgšanā sapāroti pretmeti: mīlestība — naids, piedošana — pārestība, vienotība — nesaskaņa, patiesība — maldi, ticība — šaubas, cerības — izmisums, gaisma — tumsība un prieks — skumība. Ar šo burvīgo, filozofiski tik bagāto lūgšanu sasaucas Svētā Franciska skulpturālais attēls Galilejas jūras (Kinereta) krastā (18. att. 1. piel.). Kaper- naumas muzeja rožu dārzā, kur Jēzus no Nācaretes pirmo reizi pulcināja savus mīļākos mācekļus, vēlākos apustuļus un Viņa mācības sludinātājus, Francisks pacēlis rokas lūgšanā pret zilajām Galilejas debesīm.

Zenta Mauriņa ar Svētā Franciska lūgšanu vienmēr uzsākusi un nobeigusi mācību semestri Mūrmuižas Tautas universitātē [114]. Svētā Franciska Dieva pielūgsmei ir vēl cita iezīme, kas to tuvina panteismam un Austrumu reliģiski filozofiskajām nostādnēm. Francisks pielūdz ne vien monoteisko, kristietiski antropoloģizēto Dievu, bet arī Dabu kā Dieva gara izpausmi. Viņš uzrunā Sauli par savu māsu, sauc kokus un puķes par saviem brāļiem un māsām. Francisks sarunājas ar putniem. Šo panteistisko, kristietībai tik neparasto ievirzi atainojis Mauritss Eshers vienā no saviem agrīnajiem darbiem. Svētā Franciska dvēselē Dieva un Dabas pielūgsme apvienota ar dāsnu cilvēkmīlestību.

Dante «Dievišķajā Komēdijā» Svētajam Franciskam ierādījis vietu Debess- rozē tuvu Dievam, līdzās Marijai un Beatričei [30]. Un tiešām, Sv. Franciska dzīve un darbība ir apliecinājums, ka viņš savā kristieša ideālismā ir patiesākais Kristus mācības sekotājs. Franciskāņu mūki vēl šodien vispašaizliedzīgāk kopj Bētlemes, Nācaretes un Golgātas svētvietas un kalpo tajās.

Filozofiskā skatījumā gaismas un tumsas pretmeti itin bieži tiek izmantoti kā adekvāta metafora patiesībai un maldiem. Iracionālistiem un mistiķiem tumsa simbolizē prātam neizdibināmo, «tai pusē» zināšanām esošo, kantisko «Dinge an sich» (lietu sevī), Dieva būtības neizdibināmību. Gaismas un tumsas atdalīšana Pasaules radīšanas sākumā daudzu tautu kosmogoniskajos priekš­statos nozīmē kārtības iedibināšanu pirmatnējā haosā [69].

Arī Pirmās Mozus grāmatas, sauktas «Genesis» [11], Pasaules radīšanas aprakstā, kā jau minējām, Dievs vispirms atdala gaismu no tumsas, tā iedibi­nādams kārtību pirmatnējā tukšumā. Šo primāro radīšanas aktu kongruentā tuvinājumā ģeniāli atveidojis Mikelandželo Siksta kapelas griestu gleznojumā (19. att. 1. piel.). Tikai visuvarenais, visuzinošais Mikelandželo Dievs spēj strikti atdalīt gaismu no tumsas, patiesību no maldiem. Cilvēka uztverē gaisma pāriet tumsā caur mijkrēsli, šī pāreja nav asa un stingri norobežota. Līdzīgi kā pāreja starp cilvēcisko patiesību un maldiem. Šo parādību latinizētā aforismā visviedīgāk formulējis 17. gs. domātājs filozofs Benedikts Spinoza:

.. sicut lux seipsam et tenebras manifestat, sic veritas norma sui et faLsi est.

Latviski tas skanētu:

.. tāpat kā gaisma ietver sevī tumsu, tā patiesība satur sevī arī maldus.

Par patiesības gaismu, kas apžilbina izzinātāja acis, padarot viņu aklu,

c i

tēlainās vārsmās, kurās kā melodisks vadmotīvs septiņas reizes atkārtojas vārds light (gaisma), rakstījis dižais renesanses meistars Viljams Šekspīrs:

To seek the light of truth, while truth the while Doth falsely blind the eyessight of his look; Light seeking light, doth ligh t of light beguiles; So ere you find where li gh t in darkness lies, Your light grows dark by losing ofyour eyes.

Šīs vārsmas grūti latviskojamas, nezaudējot to melodisko burvību un satura autentitāti. To pamatdoma ir šāda: Patiesības gaisma var maldīgi aptumšot izzinātāja acu skatu; pirms viņš atrod, kur tumsā gaisma mīt, šī gaisma tumsā pazūd acu skatam.

Robežlīnijas problēmas gaismas un tumsas pretmetos un šo pretmetu filo­zofiski metaforiskās konsekvences visspilgtāk tēlotājas mākslas ietvaros iezīmē­juši divi izcili 17. gs. gleznotāji: holandiešu dižmeistars Rembrants un mums varbūt mazāk pazīstamais franču gleznotājs Žoržļs de Latūrs. Abi meistari izman­to t. s. chiaroscuro jeb gaismas un ēnas tehniku, gleznieciski konkretizējot gais­mas un tumsas pretmetus, jan un iņ radīto pasaules daudzveidību. Vai, kā teikts «Daodedzin» tekstos, — «Pasaule mūžīgi rit starp gaismu un tumsu, jan un iņ».

No gleznas tumšā fona gaisma iznirst gan loģiski pamatota, gan iracionāla, loģiski nepamatota, bet mēs šo pretrunu pat nenojaušam, jo glezna uz mums iedarbojas ar tādu spēku, kādu mākslā pat lielie renesanses meistari līdz tam nebija atraduši. Šis spēks raisās no gaismas un ēnas pretmetu filozofiskajām dzīlēm, kas iedarbojas vienlaicīgi gan uz mūsu racionālo apziņu, gan uz bez- apziņā slēptajiem iracionālajiem arhetipiem.

Tāda fascinējoša glezna ir de Latūra «Marija Magdalēna ar eļļas lampu» Luvrā (20. att. 1. piel.). Miniatūrais gaismeklis uzbur apkārtējā tumsā pār­domu pilno Marijas seju — viņa veras sīkajā eļļas lampas liesmiņā. Par ko gan domā svētā grēciniece no Magdalas Galilejas jūras krastos? Vai par maldiem savā dzīvē, līdz Kapernaumā sastapa jaunas Patiesības sludinātāju Jēzu no Nācaretes, kuram viņa pielūgsmē sekoja līdz pat Golgātai? Vai par Patiesības gaismu, kas staro no Svētajiem Rakstiem, kuros teikts: «Pirmsākumā bija Vārds .. un Vārds bija Dievs.» Un kā šai Patiesības gaismai būs kliedēt tumsu visā plašajā pasaulē? Varbūt viņa svētlaimē atceras, ka tieši viņai — vārgai sievietei un grēciniecei — pašai pirmajai parādījās Kristus pēc augšāmcelšanās.

Gleznas izraisītās filozofiskās apceres diapazonu paplašina Marijas labā roka, kas balstās uz galvaskausa viņai klēpī. Vai arī Mariju moka hamletiskais jautājums par dzīvības un nāves pretmetiem — jautājums, vai nāve ir ieiešana jaunā gaismā vai pazušana mūžīgā tumsībā?

Žorža de Latūra gleznā mēs nemeklējam detaļas. Tieši gaismas un ēnu saspēles holistiskā kopaina paver brīnumainus asociatīvus ceļus uz jaunu Patie­sību atklāsmēm.

Gaismas un ēnu pretmeta kontekstā īpaši gribas izcelt chiaroscuro izcilākā meistara Rembranta filozofiskās ievirzes gleznu «Aristoteļa pārdomas pie Homēra krūšutēla». Glezna glabājas Ņujorkas Metropolitēna muzejā (21. att. 1. piel.). Šī ir neparasta kompozīcija: uz viena audekla attēlots sengrieķu filo­zofs Aristotelis — vēsturiska persona — un leģendārā grieķu dziesminieka Homēra, eposu «īliada» un «Odiseja» sacerētāja, tradicionālais krūšutēls. Arī šīs gleznas kvintesence ir gaismas un ēnas pretmetu saspēle. Aristoteļa bālā seja, kuru vēl vairāk izceļ baltā un melnā kontrasts greznajā tērpā, tik tikko iezīmējas uz tumsas fona. Turpretim Homēra galva, uz kuras pārdomās roku uzlicis Aristotelis, ir zeltītas gaismas apmirdzēta.

Tikpat atšķirīgi kā gaismas un ēnas simboliskie pretmeti ir abi sengrieķu dižgari. Aristotelis — filozofs racionālists, sava laika izcilākais enciklopēdists un zinātņu sistematizētājs, formālās loģikas izveidotājs, pragmatisks reālists, «zelta vidusceļa» apoloģēts. Viņš ticēja deduktīvās domāšanas spēkam, uzska­tot to par drošu «instrumentu» (Organum) patiesības atklāšanā. Tieši tāpēc Aristotelis kļuva par «vienīgās patiesības» apliecinātāju lielāko autoritāti gan viduslaikos — sholastikas dogmatisko adeptu saimē —, gan vēlāk — racio­nālisma ziedu laikos, deduktīvās domāšanas metodes un formālās loģikas siloģismu cienītāju vidū. Tas daļēji turpinājās līdz pat mūsu gadsimta komple­mentaritātes paradigmai, kas parādīja, ka vienpusīgā racionāli deduktīvā doma nevar sasniegt pilnīgu un galīgu Patiesību.

Vai Homēra personība nebija diametrāli pretēja Aristotelim? Leģendārais neredzīgais dziesminieks, dievu mīlulis un izredzētais, visu laiku lielākais dzej­nieks (kam līdzināties varbūt var vienīgi Šekspīrs), apveltīts ar ģeniālu intuīciju, pasakaini bagātu iztēli un fantastisku atminu. Tas viss ir viens vienīgs iracio­nāls brīnums, ko nevar skaidrot racionālas analīzes ietvaros.

Kā var iztēloties no Aristoteļa kontemplatīvā skatiena, viņš zina, ka Homērs ir viņa racionāli analītiskajam prātam nesasniedzams un neizprotams brīnums. Homēra daiļradi nevar ieslēgt siloģismu Prokrusta gultā. Tāpat kā Šekspīru vai pašu Rembrantu.

Rembranta duālistiskais gaismas un ēnas filozofiskais skatījums pārsteidz un sajūsmina vēl citos viņa audeklos. Te lai minam kaut vai Luvrā skatāmo Batšebu, lasot Ķēniņa Dāvida mīlestības vēstuli (ar satriecošiem izmisuma un prieka pretmetiem Ūrija skaistās sievas sejā), Ermitāžā izstādīto iespaidīgo «Pazudušo dēlu» un Rembranta pašportretus, īpaši vecumā.

Pasaules parādību pretmetus apcerējis arī Johans Volfgangs Gēte izklāstā «Polaritāte» ([76], 8. lpp.):

MĒs un priekšmeti, Gaisma un tumsa, Miesa un dvēsele, Dievs un Pasaule,

Doma un Izplatība, Ideālais un reālais, Jutekliskums un sapratne. Fantāzija un prāts, Ķermeņa divas puses, Labais un kreisais.

Turpat Gēte raksta, ka atsevišķais mūs ved uz vispārējo, vispārējais— uz atsevišķo. Arī sava mūža izcilākajā darbā «Fausts» dzejnieks simboliski iemieso­jis cilvēka dabas polāros pretmetus: Faustā — ideālismu, cēlumu, zinātgribu, kas tomēr nepaglābj no ļaunā, un Mefistofelī — ironiju, cinismu, visa nolie­gumu, kas vienmēr ļaunu grib, bet tomēr labu dara.

Ģeniālu cilvēciskās dabas pretpolu vispārinājumu atrodam Servantesa «Donā Kihotā» [164] — romantiskā ideālista Dona Kihota un pragmatiskā reālista Sančo Pansas tēlos. Pirmais pārstāv astēnisko, otrais — piknisko cilvēka tipu. Bet ikvienā cilvēkā gan gara struktūrā, gan ķermeņa uzbūvē iemiesojas — tiesa, dažādās proporcijās — abi šie komponenti (22. att. 58. lpp. un 23. att. 59. lpp.).

Dona Kihota un Sančo atainojums divu izcilu mākslinieku interpretācijā uzskatāmi ilustrē gadsimta paradigmu maiņu šo cilvēciskās dabas pretpolu vispārinājuma vizuālajā atainošanā. Franču mākslinieka Gistava Dorē ilustrā­cijā (1863) mākslinieka spilgtā iztēle iegrožota 19. gs. reālistisko tradīciju rāmjos (22. att. 58. lpp.). Tomēr gara pretpoli vizuāli iezīmēti visā spilgtumā. Dona Kihota tēlā viss tiecas augšup, uz debesīm. Asais šķēps kā gotiskas kated­rāles smaile un tam pievērstais no reālās pasaules attālinātais skatiens. Arī Rosinante, bruņinieka dedzības iedvesmots, ir atrāvies no zemes un it kā lido gaisos. Turpretim Sančo un viņa ēzelītis ir visnotaļ piezemēti. Un, lai ari viņi uzticīgi seko cēlo ideju apsēstajam bruņiniekam, ieročnesēja skatā jūtama pragmatiska skepse un šaubas.

Turpretim Pablo Pikaso 1955. gada grafiskais zīmējums (23. att. 59. lpp.) visā pilnībā atbilst mūsu gadsimta paradigmu raksturīgajām ievirzēm un ieturēts modernā abstrakcionisma tradīciju garā. Zīmējumu veido lakoniski vienkāršotu, kaligrāfiski abstrahētu līniju saspēle: vertikālā dominante veido astēnisko dona Kihota tēlu, bet noapaļotās, ciklotīmās līnijas — piknisko, piezemēto Sančo. Kā metaforas donkihotiskiem ideāliem kalpo shematiskie vējdzirnavu attēli zīmējumu fonā.

Visaugstāko novērtējumu Servantesa «Donam Kihotam» devis Fjodors Dostojevskis, apliecinādams, ka tā ir vienīgā grāmata, kuru viņš ņemtu līdzi, stājoties Dieva priekšā. Ari Einšteinu Servantesa grāmata pavadījusi visu dzīvi, viņš to atkal un atkal pārlasījis, sevišķi mūža nogalē [174].

Jan un iņ pamatpostulātu iezīmes nav grūti saskatīt arī mūsu gadsimta izcilā psihoanalītiķa Karla Gustava Junga teorijā, ka ikvienā vīrietī iemiesojas sievišķīgie elementi, ko Jungs sauc par anima, tāpat kā katrā sievietē — vīrišķīgie (animus) elementi ([81], 183. lpp.). Tie īpaši parādās kā arhetipi cilvēku kolektīvajā bezapziņā [80, 82],

Šos animus un anima pretmetus Jungs apzīmē ar grieķiskas cilmes vārdu sizigija, kas nozīmē — «kopsaistība». Šis ir astronomijā (un arī astroloģijā) izmantots termins, kas vienlaikus apzīmē konjunkciju un opozīciju. Vai tas viss burvīgi neatspoguļojas jan un iņ vizuālajā simbolā (1. att. 14. lpp.)? Tas saskan arī ar modernās fizioloģijas atziņām: vīrieša organismā endokrīnie dzie­dzeri ražo zināmu sievišķo — estrogēno hormonu devu, tāpat kā sievietes organismā tie ražo vīrišķos — androgēnos hormonus.

Šai kontekstā gribas atcerēties Platona atstāstītu sengrieķu leģendu par tālā senatnē dzīvojušu divdzimumu būtni androgīnu — vīrsievieti. Tā bijusi būtne, kurā apvienoti vīrietis un sieviete, — ar četrām rokām un četrām kājām, un divām pretēji vērstām sejām — vīrieša un sievietes. (Vai šim mitoloģiska­jam androgīna tēlam nav kopējs arhetips ar vispārināto jan un iņ — vīrieša un sievietes — pretmetu simboliku?)

Androgīni bijuši pati pilnība, skaistāki par cilvēkiem, īsti Saules un Zemes bērni, kuros apvienotas abas būtības — vīrišķīgā un sievišķīgā. Viņi bijuši tik stipri un lepni, ka līdzīgi titāniem nolēmuši sacelties pret dieviem un padzīt tos no Olimpa ([118], 559. lpp.). Zevs sacelšanos nežēlīgi apspiedis. Tomēr, nevēlēdamies dumpiniekus iznīcināt galīgi, pāršķēlis ar zibeni androgīnus uz pusēm, tā radīdams Sievieti un Vīrieti, lai saglabātu pielūdzējus un upurus. (Interesanti, ka šajā radīšanas aktā tiek saglabāta abu pušu šķietamā ekviva­lence atšķirībā no leģendas Vecajā Derībā, kur Ieva tiek veidota no Ādama ribas.) Kopš tiem laikiem abas puses — vīrietis un sieviete — ar fatālu neno- vēršamību tiecas viena pēc otras, lai atjaunotu pirmatnējo vienību. Cik trāpīgi šī mitoloģiskā metafora par sašķelto pirmbūtni skaidro vīrieša un sievietes tiek­smi savienoties gan fiziski, gan dvēseliski! Tā var izpausties kā saldkaislā iekārē, tā romantiskā, apgarotā mīlestībā. Vienā galējībā to var reducēt uz atkailinātu seksualitāti vai egocentrisku libido, uz baudkāri, ko psihoanalītiķis Zigmunds Freids uzskata par cilvēka zemapziņas galveno dzinējspēku. Otrā galējībā to simbolizē Dantes apgarotā, dievišķā Mīlestība uz Beatriči — Mīlestība, «kas garu Debess dzīlēs aiznes un visam ritēt liek» [30],

Tieši šī Dantes un Petrarkas apdziedātā apgarotā mīlestība atradusi izpausmi daudzos pasaules literatūras, mākslas un mūzikas šedevros — lai pieminam vien Šekspīra «Romeo un Džuljetu» vai Vāgnera «Tristanu un Izoldi»…

Zenta Mauriņa esejā «Par mīlestību un nāvi» ([116], 7. lpp.) šādi mēģina skaidrot mīlestības iracionālo būtību: «Mīlestība no sava vidus punkta sniedzas visos dvēseles slāņos un nav atvasināma no kaut kāda cita principa… Būdama loģikas pretiniece, mīlestība nav pierādāma, un te slēpjas tās neatminamība. Tā kā tās daba ir iracionāla, bet mūsu valoda — racionāla, tās būtība vārdos nav izsakāma, bet vienīgi aprādāma un aprakstāma.»

22. iitt. Franču 19. gs. māksliniekā G. Dorč ilustrācija Servantesa grāmatai «Dons Kihocs».

23. att. P. Pikaso grafika «Dons Kiliots un Sančo Pansa» (1955).

Psihoanalītiski dziļu mīlestības (un tās ēnas — greizsirdības) iracionālās dabas aprakstu devis viens no mūsu gadsimta izcilākajiem franču rakst­niekiem Marsels Prusts triloģijas «Zudušo laiku meklējot» otrajā daļā «Svana mīlestība».

Atgriežoties pie mitoloģiskās pirmbūtnes androgīna, jāuzsver, ka Zeva šķē­lums nebūt nebija īsti simetrisks. Vīrišķā un sievišķā puse ir nevis ekvivalen­tas, bet gan savstarpēji komplementāras. Līdzīgi kā jan un iņ simbolā, vienu pusi raksturo spēks, otru — maigums un grācija; vīrietis lepojas ar prātu, sie­viete — ar viedīgu intuīciju. Šos vīrišķības un sievišķības pretmetus, manu­prāt, ģeniālā vispārinājumā 1905. g. atveidojis Pablo Pikaso agrīnā t. s. «zili rozā» perioda audeklā «Akrobāte uz bumbas» (24. att. 2. piel.). Pēc idejiskā satura gleznu varētu nosaukt «Vīrieša un Sievietes pretmeti». Gleznā atainoto vīru var uzskatīt par spēka un stabilitātes simbolu, spēks staro no viņa atlētiskā auguma, stabilitāti un līdzsvaru pauž kubs, uz kura viņš sēž. Tam pretstatā meitenes delikātais augums izstaro skaistumu un dinamisku grāciju. Viņa akrobātiski balansē uz apaļās bumbas — kā nelīdzsvarota pretmeta kubiskajai stabilitātei.

Šī filozofiskās pārdomas rosinošā glezna man asociējas ar sievieti un vīrieti apzīmējošiem hieroglifiem japāņu valodā (25. att.). Vai hieroglifs sieviete, kas abstrahēts līdz četru līniju saspēlei, nav tikpat skaists, delikāts un graciozs kā mei­tene uz bumbas? Hieroglifu vīrietis veido divu neatkarīgu hieroglifu kombinācija:

četrstūris apzīmē risa lauku, bet hieroglifs zem tā — spēku. Citiem vārdiem, pēc japāņu tradīcijām vīrieša dzejiskā metafora ir «spēks rīsa laukā». Arī te nav grūti saskatīt šīs abstrahētās zīmes līdzību ar vīrieti Pikaso gleznā. Un kāda dīvaina, laika tecē­jumā apgriezta sakarība! Pikaso vēlīnā perioda ab- strahētais, stilizētais dons Kihots (23. att. 59. lpp.) ilustrē laikmeta paradigmu maiņu, salīdzinot ar Dorē reālistisko zīmējumu (22. att. 58. lpp.). Tur­pretim viņa agrīnais darbs (24. att. 2. piel.), vēl ieturēts reālisma tradīcijās, radies daudz vēlāk nekā abstrahētie hieroglifi, kas Japānā bija pazīstami jau 6. gadsimtā!

Tas rāda paradigmu ciklisko maiņu laika gaitā un arī Rietumu paradigmu gadsimtiem ilgo no­bīdi attiecībā pret līdzīgām Austrumu paradig­mām. Vai te nav saskatāma analoģija ar Nilsa Bora atklāto komplementaritātes principu kvantu fizikā un tā seno Austrumu prototipu —jan un iņ simbolu?

12. KONKRĒTAIS UN ABSTRAKTAIS. NO TĒLA UZ SIMBOLU UN ZĪMI

Interesanti konstatēt, ka realitātes attēlojumā jau aizvēsturiskajos akmens laikmeta mākslinieku zīmējumos parādas abas cilvēka vizuālās jaunrades pret­runīgās tendences, ko veido jēdzienu pāris konkrētais un abstraktais. Pirmā tendence — vēlme pēc iespējas reālistiski, ar figurālu, konkretizētu tēlu atai­not, piemēram, akmens laikmeta cilvēkam tik nozīmīgo dzīvnieku — bizonu. Laika gaitā sāk dominēt pretējā tendence — reālistisko atainojumu aizstāt ar stilizētu, abstrahētu zīmējumu, kas reducējas uz nedaudzām visraksturīgāka­jām līnijām, kļūstot par attēlojamā objekta piktogrammu vai simbolu.

Raksturīgi, ka vissenākajā aizvēsturiskajā akmens laikmetā, t. s. paleolīta periodā, ko datē laika posmā pirms apmēram 35 līdz 10 tūkstošiem gadu, dominē reālistisks zīmējums, bet tam sekojošā jaunākā akmens laikmeta, t. s. neolīta, periodā (no apmēram 6. līdz 2. gadu tūkstotim pr. Kr.) par valdošo zīmējumos kļūst tieši ornamentālais un abstrahētais stils [140, 156]. Visvairāk pētīti un aprakstīti pagājušā gadsimta astoņdesmitajos gados Spānijā atklātie Altamiras paleolīta laikmeta alu zīmējumi. Vēlāk akmens laikmeta alu zīmē­jumi tika atrasti daudzās pasaules zemēs, īpaši daudz Dienvidāfrikā.

Bet, kā norāda angļu rakstnieks un esejists Oldess Hakslijs esejā «Cilvēks un Daba» («Man and Nature»), paleolīta aizvēsturisko alu mākslinieku zīmējumi nav reālistiski, tie ir drīzāk impresionistiski ([75], 34. lpp.). Arhaiskais vis­senākā paleolīta laikmeta mākslinieks it kā mēģina apvilkt kontūrlīnijas saviem vizuālajiem atmiņas tēliem. Hakslijs šais zīmējumos pat saskata līdzību ar franču impresionista Degā audekliem. Te jāpiebilst, ka mūsdienās vizuālās uztveres pētījumi parādījuši, ka kontūrlīnijas dabā neeksistē, tās tiek radītas cil­vēka vizuālās uztveres procesā. Kontrastainais, ar asām kontūrlīnijām sadalītais vizuālais apkārtējās vides attēls rodas acs tīklenes nervu šūnu daudzveidīgo, vertikāli un horizontāli saistīto sinapšu saišu mijiedarbības rezultātā ([40], 121. lpp.). Horizontāli izvietotie acs tīklenes šūnu slāņi sasaista tīklenes redzes lauka atsevišķās daļas un pastiprina, vājina vai integrē optisko signālu. Tīklenes nervu šūnu sistēmu var ar pilnām tiesībām uzskatīt par periferiāli izvirzītu smadzeņu sastāvdaļu, kas veic vissarežģītākās optisko signālu pārveidošanas un integrēšanas funkcijas. Tā spēj nodrošināt augstu attēla kontrastainību, mainoties apgaismojuma intensitātei. Tādējādi neirālais attēls, kas pa nervu šķiedrām

sasniedz vizuālos centrus, ievērojami atšķiras no attēla, kas projicējas uz acs tīklenes. Neirālais attēls dod daudz kontrastaināku pasaules ainu, veidojot ap attēla objektiem asas kontūrlīnijas.

Šai pašā kontekstā interesants fakts: runājot par cilvēku un dabu, 18. gs. angļu dzejnieks, mistiķis un gleznotājs Viljams Bleiks ir izteicis intuitīvu apgal­vojumu, ka dabā nav kontūrlīniju, ka tās rada cilvēka iztēle ([75], 34. lpp.). Pārsteidzoši — šo tīri intuitīvo secinājumu tiešām apstiprina mūsdienu cilvēka vizuālās uztveres pētījumi. Tātad pasauli mēs redzam nevis tādu, kāda tā ir, bet gan tādu, kādu to rāda mūsu acs! Un tā pavisam citādi vienu un to pašu ainu redz kamene un tauriņš ar savām mozaīkas fasetacīm, suņi un kaķi, kuriem pasaule ir bezkrāsaina, vai daltoniķis, kas nevat atšķirt zaļo un sarkano krāsu. Tāpēc varam apgalvot, ka pat visreālistiskākais ārējās pasaules atainojums zīmējumā vai gleznā nebūt nav pasīva kopija, bet indivīda vizuālās jaunrades produkts.

Interesants ir «Lielā bizona» («Great buffalo») atveidojums uz Altamiras alas griestiem Ziemeļspānijā (26. att.). Pirms apmēram 15 tūkstošiem gadu

radītajā paleolīta laikmeta zīmējumā aizvēsturiskais mākslinieks jau izmantojis t. s. puantilisma tehniku, veidojot dzīvnieku kontūrlīnijas no blīviem «pun­ktiņiem». Un vai atkal nav apbrīnojami, ka šo tehniku neoimpresionisti Žoržs Serā un Pols Siņaks pagājušā gadsimta astoņdesmitajos gados «atklāja» no jauna ([140], 476. lpp.)?

Vēl iespaidīgāks ir Dienvidāfrikas akmens laikmeta klinšu gleznojums «Skrejošie karavīri» (27. att. 62. lpp.). Vai šeit nav sasniegts tāds pats abstrak­cijas līmenis kā Pikaso «Dona Kihota un Sančo Pansas» zīmējumā (23. att. 59. lpp.)? Atkal rodas vēlme vilkt arhetipiskas paralēles starp Dorē un Pikaso darbiem un tiem analogiem paleolīta laikmeta zīmējumiem — Altamiras bizoniem un Dienvidāfrikas skrejošajiem karavīriem.

Paleolīta periodam sekojošā neolīta glezniecībā arvien spēcīgāk sāk domi­nēt ornamentālie elementi, stilizēti vispārinājumi un abstrakcijas [75]. Priekš­metu impresionistiskās kontūrlīnijas aizstāj vispārināti hieroglifiski simboli intelektuālu abstrakciju līmeni. Tā aplītis attēlo cilvēka galvu, ovāls — tā torsu, četras līnijas — rokas un kājas. Konkrētu cilvēka tēlu aizstāj cilvēka sim­bols. Un tieši simbolam, kā atzīst Karls Gustavs Jungs [79, 80], ir tā milzīgā priekšrocība, ka vienā vispārinātā tēlā tiek apvienoti daudzi atšķirīgi objekti vai parādības.

Ja mums rastos iedoma apgalvot, ka abstrahētā neolīta māksla salīdzi­nājumā ar paleolīta mākslu ir dekadentiska (fr. dēcadence— pagrimums), tad kas līdzīgs būtu jāsaka (un dažkārt dzirdami šādi apgalvojumi), ka Pikaso abstrakcionisms ir dekadentisks attie­cībā pret impresionismu un, turpinot šo domu gaitu, ka impresionisms savu­kārt ir dekadentisks salīdzinājumā ar 19. gs. akadēmisko reālismu. Te drīzāk būtu jārunā par pieaugošu abstrahē- šanās tendenci vai dominanti dažādos tēlotājas mākslas vēsturiskās virzības posmos, par ciklisku paradigmu maiņu kā senajā akmens laikmetā, tā mūs­dienu modernajā mākslā.

Vizualizētas abstrakcijas visizteiktāk dominē Austrumu kultūrās. Tādas ir li- nearizētās «Idzin» zīmes (12. un 13. att. 44., 45. lpp.), arī ķīniešu hieroglifi, kas etimoloģiski evolucionējuši no reālam piktogrammām (25. att. 60. lpp., 28. att. 63- lpp). Turpretī vairums ēģiptiešu hie­roglifu palicis tieši reālu piktogrammu

formā (29. att.). Ķīniešu un ēģiptiešu hieroglifu evolūcijā redzamas atšķirīgas, diametrāli pretē­jas tendences.

Ķīniešu hieroglifu rakstības pirmsākumi meklējami apmēram 1200 gadus pr. Kr. Uz­skata, ka sākotnēji ķīniešu hieroglifi bijuši reālas piktogrammas, kas vēlāk abstrahējušās par simboliem, kurus veido noteikta skaita un orientācijas līniju zīmējums (pattern). Tādē­jādi, saglabājot vizuālās aprises, hieroglifi veido kriptogrāfisku kodu, kur katrs burts nozīmē noteiktu vārdu vai jēdzienu. Vai, citiem vār­diem, katrs hieroglifs kļūst par ideogrammu vai logogrammu. Šis process uzskatāmi attēlots 28. zīmējumā (63. lpp.) [156], Tur redzams, kā reāla pik- togramma evolucionē par abstraktu ideogrammu, apzīmējot vārdus «sieviete», «bērns», «rīsa lauks» vai jēdzienu «spēks». Vīrieša vārds, kā jau minējām, kom- binējas no vārdiem «spēks» un «rīsa lauks», t. i., vīrietis identificējas ar spēku rīsa laukā.

10. att. Mākslinieces M. Rikmanes grāmatzīme. So ekslibri var uzskatīt par vēl vienu mūsdienu jan un in simbolikas variāciju. Viena no mūzām simbolizē zinātni, otra — mākslu, atainojot zinātnes un mākslas komplementāro dabu.

17. att. Trejādes atainojums japāņu puku sakār­tojuma ikebanas simbolikā. Katram trejādes komponentam — Debesim, Zemei un Cilvē­kam — atbilst savs ziedu kopas zars. Ziedu sakārtojumu japāni parasti noliek mājokļa estētiskajā svētvietā — nišā, ko sauc par tokono- mu. Tokonomā parasti izvieto ari vienu filo­zofisku ainavu vai tīstokli ar kaligrāfiskiem hieroglifu rakstiem.

II. att. Leģendārais senkīniešu domātājs l.iiodzl u/. sava reliģiski filozofiskā traktāta Ikiodedtiii (uramata par Dao un De) vilka 1H. att. Svētā Asizes Franciska memoriālā skulp­tūra Kapernaumā, Galilejas jūras (Kinereta) krastā Izraēlā.

21. att. Rembranta filozofiskā glezna "Aristoteļa pārdomās pie Homēra krūšutēla" Ņujorkas Metropolitēna muzejā.

Ēģiptiešu hieroglifi, iespējams, parādījušies jau 3000 gadus pr. Kr. Sākotnēji tie, visticamāk, tiešām bijuši reālas piktogrammas. Vēlāk, lai uzrakstītu valdnieku vai ģeogrāfisko vietu nosaukumus, piktogrammām pierakstīja konkrētus alfabēta burtus. Un tā ēģiptiešu hieroglifi evolucionēja par alfabētiskām fonētiskā pierak­sta zīmēm. To atšifrēšanu veiksmīgi uzsāka angļu fiziķis, ārsts un lingvists Tomass Jungs, bet līdz spožam finālam noveda franču zinātnieks Žans Fransuā Šampo- lions. Atšifrēšanai izmantoja Napoleona karavīru no Ēģiptes pārvesto t. s. Rozetas akmeni, kas tagad glabājas Britu muzejā Londonā, un uzrakstus uz Fīlaejā atrastā obeliska, kas arī tagad atrodas Anglijā, Dorsetā. Abos senajos Ēģiptes kultūras pieminekļos Šampolionam izdevās identificēt atkārtotus Senās Ēģiptes pēdējās valdnieces Ptolemaja dinastijas pārstāves Kleopatras, kā arī Ptolemaja vārdus (29. att. 64. lpp.). Tā Šampolions atrada atslēgu ēģiptiešu hieroglifu alfabētiska­jiem burtiem. Kā redzams, noteikta piktogramma atbilst noteiktam burtam. Tā lauvas piktogramma apzīmē burtu L, kas atkārtojas gan Kleopatras, gan Ptolemaja vārdā, savukārt burts t ir homofons, tam ir divas atšķirīgas zīmes, kas apzīmē vienu un to pašu skanu (līdzīgi kā burti j un gvai iun c angļu valodā, piemēram, vārdos «practise» un «practice». Iespējams, ka ēģiptiešu hieroglifu evolūciju par alfabētiskām zīmēm ietekmējuši blakus esošās Mezopotāmijas kultūras ķīļu raksti.

Ķīlu rakstību lietoja ar Mezopotāmijas kultūru saistītās senās tautas — šumeri, babilonieši, asīrieši un senpersieši, tajā rakstīti arī Hamurapi likumi (30. att. 66. lpp.). Ķīļu raksti ir cilvēces visvecākās rakstu zīmes: vissenākie pieraksti uz māla plāksnēm radušies 3300 gadu pirms Kristus dzimšanas.

Ķīļu rakstus veido galēji abstrahētas piramidālas trīsstūrformas zīmes, kas atšķiras tikai ar orientāciju un sakārtojumu (30. att. 66. lpp.). Kad eiropieši 17. gs. atklāja Mezopotāmijas ķīlu zīmju plāksnītes, viņi domāja, ka tās ir vienkārši bezsatura etnogrāfiskas zīmes.

Ķīļu rakstu visveiksmīgāk atšifrēja vācu zinātnieks Getingenes universitātes profesors Georgs Gotefrends. Ķīļu raksts izrādījās daļēji burtu, daļēji zilbju alfa­bēts. Tātad fonētiski alfabētiskā rakstība atšķirībā no Austrumu ideogrāfiskās rakstības bija kļuvusi dominējošā Rietumos. No Senās Ēģiptes un Babilonijas ar fēniķiešu, grieķu un romiešu starpniecību tā iekaroja visu Rietumu pasauli. Un, lai gan pati latīņu valoda ir mirusi, tās alfabētu lieto miljoniem cilvēku visā pasaulē, un latīņu valoda kļuvusi par zinātniskās valodas mugurkaulu.

Kā norāda Endrjū Robinsons [156], t. s. alfabētiskais efekts ir lielā mērā noteicis Rietumu un Austrumu kultūru īpatnības un atšķirīgo domāšanas stilu. Alfabētiskā rakstība stimulē galvenā kārtā lineāro, «burts-pēc-burta» domāšanu, un tā ir loģiski analītiskās domāšanas pamatā. Turpretī ķīniešu hieroglifu piktoriālo ideogrammu rakstība veicina vizuāli tēlaino domāšanu, kas ir raksturīga un dominējoša Austrumu kultūrās (Ķīnā, Japānā, Korejā). Citiem vārdiem, linearizētā alfabētiskā rakstība veicina redukcionistisku, bet piktoriāli ideogrāfiskā rakstība — holistisku domāšanu.

30. att. Dažādo tautu un kultūru rakstības kolāža. Augšējā kreisajā malā līdz šim neat­šifrēts Lieldienu salas raksts uz 4 x 35 collu koka plāksnēm. Tālāk (pulksteņrādītāja kus­tības virzienā) vertikāli rakstītās mongoļu rakstu zīmes: augšā — mūsdienu raksts, apakšā — dokuments, kas rakstīts 1314. gadā. Apakšējā labajā stūrī Rabindranata Tagores poēma bengāļu valodā. Nākošais (trekniem burtiem) ir avīzes virsraksts Mala- jamalā (Rietumu Keralā Dienvidindijā). Virs tā — filigrānais līklīniju raksts tamilu valodā (Austrumu Keralā). Tālāk (sīkais zigzaga raksts) ir pasaka buginēzu valodā (Cele- bedas salā Indonēzijā). Kolāžas centrā ir teksts taizemiešu valodā, bet virs tā— 14. gs. rūnu raksts no Skanibas provinces Dienvidzviedrijā. Un, beidzot, kreisajā pusē ir frag­ments no Hammurapi likuma asīriešu ķīļrakstā (pēc [72]).

Šie secinājumi vēlreiz apstiprina mūsu aizstāvēto koncepciju par loģiski analītiskās un vizuāli tēlainās domāšanas, par Rietumu un Austrumu kultūru savstarpējo komplementaritāti.

Duglass Hofsteters fascinējošajā grāmatā «Gēdels, Eshers, Bahs» («Godel, Escher, Bach», [72]) izveidojis lielisku un pārdomas rosinošu dažādu tautu un kultūru rakstības kolāžu no Lieldienu salas neatšifrētajiem tekstiem līdz ķīlu raksta fragmentiem no Hamurapi akmenī kaltajiem likumiem (30. att. 66. lpp.). Šī kolāža jāskata pa apli pulksteņa rādītāju virzienā. Tad līdz ar autoru varam apjūsmot šos cilveces radošās domas «aperiodiskos kristālus», to grafiski vizuālo skaistumu, to formu daudzveidību un iekšējās struktūras līdzību. Šie raksti ir linearizēti un tāpēc būtiski atšķiras no ķīniešu hieroglifu nelineāri «telpiskās» kali­grāfijas, kuras piemērs skatāms 11. attēlā (1. piel.) Laodzi traktāta «Daodedzin» titulnosaukumā.

Japāņu kaligrāfija sjodo ir augsti attīstīts tēlotājas mākslas paveids un hiero­glifu atveidošanai izmanto otu fude un melno tušu sumi. Par suverēnu mākslas nozari tā k[ūst jau Heianas laikmetā (8.-12. gs.). 31. attēlā (2. piel.) parādīts seno japāņu Heianas perioda kaligrāfijas paraugs. Japāņu kaligrāfiju var uzskatīt par analogu Eiropas nefigurālajam abstrakcionismam (tas gan parādās daudzus gadsimtus vēlāk). Kaligrāfija vienlaikus izpilda divas funkcijas: skatītāju iepriecina hieroglifiskā raksta grafiskais skaistums un bagātina ideogrammu informatīvais vēstījums. Parādītais attēls ir saturā vēl bagātāks un skatāms divās plaknēs. Priekšējā plaknē kaligrāfiskais raksts, bet tā fonā — reāli figurāls zīmējums.

Par pretpoliem var uzskatīt grieķu un romiešu reālistiskās tradīcijās veido­tās skulptūras un izteikti abstraktos ķeltu skulpturālos veidojumus. Ķelti bija lieliski apguvuši metālapstrādes un gravīras tehniku. Viņu mākslā dominē abstrahēti ģeometriski taisnlīniju un spirālveida līkņu motīvi. Cilvēki, dzīvnieki vai augi tiek attēloti dimensionāli abstrahētās vai grafiski stilizētās formās 11401. Katrā ziņā ķeltu mākslā — atšķirībā no grieķiem un romiešiem — abstraktais dominē pār konkrēto.

Līdz pat mūsu ēras sākumam šis atšķirīgās tēlotājas mākslas formas eksistē- j.i neatkarīgi, neietekmējot viena otru, bet Cēzara gailu karos neapvienotās ķeltu ciltis tika uzvarētas un iekļautas Romas impērijā. Tika sagrauta ķeltu savdabīgā kultūra, ko romieši uzskatīja par barbarisku, jo tā neatbilda Romas ideāliem. Pasaule to iepazina tikai pēc arheoloģiskajiem izrakumiem mūsu gadsimtā.

Ciadsimtiem ilgi Eiropas tēlotāja māksla faktiski pārmantoja grieķu un romiešu reālistisko tradīciju un turpināja attīstīties tās garā. Tikai 20. gs. para­digmu maiņa noveda pie abstraktās mākslas atdzimšanas. Katrā ziņā, piemē- 1,1111, Pablo Pikaso gleznas vai Alberto Džakometi skulptūras tuvākas ķeltu .ibstr.ikcionisma stilam nekā grieķu un romiešu reālistiskajām tradīcijām.

Ķelti saglabāja savu valodu, kultūru un tradīcijas tikai no kontinenta izolē­tajās Britu salās — Īrijā, Velsā, daļēji Skotijā. Un tieši no ķeltu kultūras dzīlēm un ģenētiskā fonda nāk 20. gs. jaunās paradigmas iedibinātājs literatūrā Džeimss Džoiss un ironisko paradoksu meistars Bernards Šovs. Ar to cikls ir atkal noslēdzies.

Jāsecina, ka abi vizuālās jaunrades pretpoli — reālisms un abstrakcionisms — ir pastāvējuši kā komplementāri pretpoli visā cilvēces kultūras attīstības vēs­turē, kļūstot par dominanti atbilstoši katra laikmeta vadošajām paradigmām.

13. anima un animus pretmetu simbioze

Ir dzirdēts apgalvojums, ka sievišķīgie maigas dabas vīrieši ir gara kultūras veidotāji (dzejnieki, mūziķi, gleznotāji), bet tipiski vīrišķīgie, atlētiskie vīrieši ir vai nu drosmīgi karotāji, vai veiksmīgi sportisti. Tie ir maiguma un agresi­vitātes pretpoli. Tomēr tā ir tikai daļēja patiesība. Ja māksliniekus dalītu pēc šādas diezgan patvaļīgas tipoloģijas, gandrīz vienlīdz bieži varētu sastapt gan vīrišķīgas, gan sievišķīgas ievirzes daiļo mākslu meistarus.

Runājot par renesanses laika dižgariem, pie vīrišķīgajiem māksliniekiem būtu jāierindo Mikelandželo. Raupjš pēc dabas un izskatā, ekscentrisks un agresīvs, tik līdzīgs Vecās Derības bargajiem praviešiem — Dieva dusmības paudējiem. Pēc ģīmja un līdzības viņš atgādina patriarhu Mozu, Dieva likumu tulku. Viņa Dāvids nav trauslais, viedīgais avju gans, bet titānisks, muskuļots milzis, drīzāk sava pretinieka Goliāta prototips.

Pavisam netradicionāls ir Mikelandželo Siksta kapelas «Pastarās tiesas» Kristus. Tas nav žēlsirdības un mīlestības Dievs, bet bargs soģis, kas grēci­niekiem pasludina fatālo, negrozāmo Pastarās tiesas lēmumu — «Eita nost no manis, jūs nolādētie, mūžīgā ugunī .. Un tie ieies mūžīgā sodībā, bet taisnie mūžīgā dzīvē» ([11), Mateja evaņģēlijs 25: 41—46). Kā pretstats tam ir «Pietā» Sv. Pētera bazilikā Romā. Dievmāte Marija tur klēpī mīļoto dēlu, kas miris pie krusta, lai uzņemtos visus cilvēku grēkus.

Kura no šīm patiesībām ir īstā?

Atšķirībā no Mikelandželo otrs renesanses laika gara titāns, viņa laikabiedrs Leonardo da Vinči var tikt uzskatīts par « sievišķīgu» ģēniju. Viņa pašportrets izstaro dvēselisku harmoniju un līdzsvaru, filozofisku mieru, apgarotu skais­tumu [196]. Šajā jau vecumdienās zīmētajā pašportretā mēģina saskatīt līdzību .ii slaveno Monu Lizu Džokondu (La Gioconda), kas glabājas Luvrā Parīzē. Vel vairāk, daži pētnieki, savietojot šos portretus, saskata Leonardo pašportreta elementus Monas Lizas vaibstos. Šādas datorizētas savietošanas tehnikas i u amība ir visai apšaubāma (sk. Scientific American, April 1995, p. 80). Te Initu vietā pavisam citi apsvērumi. Mākslinieks, pat strikti reālistiski atainojot modeli, gleznā var ielikt savu dvēselisko un dažkārt arī fizisko pašportretu.

Pēdējos piecus vismierīgākos dzīves gadus Leonardo pavadīja Francijā, Klū (( Joux) pili Ambuāzā (Amboise). Pili viņa rīcībā nodeva jauneklīgais Francijas karalis Fransuā I, mākslas patrons un Leonardo cienītājs. Vecumdienas mākslinieks varēja pavadīt greznā savrupmājā skaistās Ambuāzas pils pievārtē un nodoties filozofiskām apcerēm. Viņa mīļāko grāmatu vidū, no kurām viņš nekad nešķirās, bija filozofu Platona, Senekas un Plotīna traktāti, Eiklīda «Ģeometrija» un latinizēta Bībele. Dzīves nogalē — 1515. gadā — tapusi vis­neparastākā Leonardo glezna, viņa dzīves credo— «Jānis Kristītājs».

Tradicionāli Jāni Kristītāju parasti attēlo kā mežonīgu, drūmu, novājējušu askētu. Leonardo turpretī viņu gleznojis kā skaistu, meitenīgu jaunekli (32. att. 2. piel.). Šī glezna, kas atradusi vietu Luvrā blakus dievišķi burvīgajai «Klinšu Madonnai» (80.rf un b att. 4. piel.), tiek uzskatīta par Leonardo dzīves un mākslas kvintesenci.

Kā grāmatā par Leonardo raksta Dmitrijs Merežkovskis [118], mākslinieks Jāņa tēlā mēģinājis apvienot sievišķības un vīrišķības ideālu, savienojot atdalī­tas puses jaunā platoniskā androgīna atveidā. Varbūt to uzskatit par konkre­tizētu un personificētu jan un iņ principu izpausmi? Jāņa tēls it kā iznirst no tumsas. Bet šī tumsa, kas pirmajā mirklī šķiet necaurredzama, kļūst arvien caurspīdīgāka, pašas tumšākās ēnas, saglabādamas savu noslēpumainību, it kā saplūst ar baltāko gaismu, kas nav ne gaisma, ne tumsa, bet veido to, ko pats Leonardo esot nosaucis par «gaišu ēnu» vai «tumšu gaismu». Tā ir savdabīga dienas un nakts, gaismas un tumsas pretmetu sintēze. Tā nav de Latūra vai Rembranta gaismas ēna, kurā gaisma ir it kā atdalīta no tumsas (20. un 21. att. 1. piel.). Leonardo gleznā gaisma ir izkususi tumsā un tumsa saplūdusi ar gaismu. Līdzīgi brīnumam, līdzīgi parādībai, bet dzīvīgāk par pašu dzīvi no gaišās tumsas iznirst sievišķīgā, skaistā Jaunekļa seja un stāvs.

Pirmajā brīdī to var noturēt par Dionīsu vai Bakbu — vīna un līksmes dievu. Bet, ieskatoties vērīgāk, redzams, ka rokā viņam ir nevis tirss, efeju un vīnogu lapām apvītais Dionīsa zizlis, bet gan krusts no tuksneša niedras, kura apveidu tik tikko var saskatīt jauktajā gaismas un tumsas mijkrēslī. Noliecis galvu, it kā ieklausīdamies pravieša sludinātajos vārdos, Jānis Kristītājs norāda uz krusta zīmi, tā pareģodams Kristus Golgātas ceļu. Tai pašā laikā ar otru roku viņš norāda uz sevi, it kā atkārtodams evaņģēlista vārdus: «Bet pēc manis nāks cits, kuram es neesmu cienīgs kurpju siksnas atraisīt.» Skatītāju visvairāk pārsteidza Jāņa enigmatiskais smaids — tāds pats kā Monai Lizai: mīklainu, daudzslāņainu pretmetu mistrojums. Šo smaidu var uztvert gan kā pavedi­nošu, gan kā noraidošu; gan kā ironisku, gan kā saprotošu; gan kā svētā smaidu, kas sludina Kristus atnākšanu, gan kā Dionīsa smaidu, kas aicina uz saldkaislām orģijām. Līdzīgi Monas Lizas enigmatisko smaidu var piedēvēt gan svētajai, gan kurtizānei.

Lūk, šajā visfilozofiskākajā no visiem Leonardo darbiem tik bagāti un daudzslāņaini savijas pretmetu kopas — gan mīklainajā Jāņa Kristītāja smaidā, gan idealizētajā vīrišķīgās un sievišķīgās iedabas sintēzē vienā personā, gan gaismas un tumsas mijkrēslīgajā sajaukumā gleznas fonā. Mūža nogalē Ambuāzā pie Leonardo glabājās tikai trīs viņa mīļākās gleznas: «Mona Liza», «Svētā Anna» un «Jānis Kristītājs». Kā skaisti pateicis Roberts Voless, lieliskās grā­matas «Leonardo pasaule» («The World of Leonardo») autors: «Nav grūti iedomāties, ka, vecajam vīram mirstot, viņa skats bija piesaistīts Jāņa Kristītāja paceltajam pirkstam un enigmatiskajam smaidam.» [196]

Austrumi ceļotājam no Rietumu pasaules vienmēr sagādā negaidītus pār­steigumus. Kad 1996. gada martā ciemojos Kioto universitātē, mans draugs, profesors Naoki Sato aizveda mani uz 603. gadā celto vecāko Kioto budistu templi Karjodzi. Tempļa kompleksā izvietots Nacionālo dārgumu muzejs (Reikohan), kurā saglabātas visvecākās Būdas skulptūras no Asukas perioda (552—645) — arī slavenā smaidošā Būdas Miroku Botsasu koka figūra (33. att. 2. piel.). Cik liels bija mans pārsteigums, kad uz paaugstinājuma izgaismotā Būdas sejā ieraudzīju to pašu enigmatisko smaidu, kuru tūkstoš gadus vēlāk Leonardo iemūžināja Monas Lizas un Jāņa Kristitāja vaibstos!

Arī Miroku Botsasu raksturīgs sievišķīgs skaistums un grācija, ko vēl pastip­rina savdabīgais, arī enigmatiskais labās rokas žests un draiski pāri celim pār­mestā kāja. So sakritību, manuprāt, var izskaidrot vienīgi ar Karla Gustava Junga kolektīvās bezapziņas arhetipu izpausmi — arhetipu, kas spēj realizēties laikā un telpā tik attālinātos mākslinieciskās jaunrades procesos.

14. DAĻIŅAS UN VIĻŅA KOMPLEMENTARITĀTE KVANTU FIZIKĀ

Senkīniešu un vēlāk Dao un dzenbudistu filozofisko kategoriju un vispāri­nāto tēlu pretmetu uzskaitījumam Bors pievienoja fizikā visnozīmīgāko kom­plementāro pretmetu pāri: daļiņas (korpuskulas) un viļņa komplementaritāti.

Kā redzējām gaismas fizikālās dabas pētījumu apskatā (sk. 5. eseju), šie jēdzieni līdz pat kvantu mehānikas dzimšanai mūsu gadsimta divdes'mitajos gados šķita absolūti nesavienojami. Tajos it kā fokusējās visa fizikas pamat­ideju attīstības vēsture kopš Ņūtona laikiem. Vai gaisma ir da|inu plūsma vai vilnis kādā nepārtrauktā vidē?

Formālā loģika (un arī veselais saprāts) lika izvēlēties vai nu vienu, vai otru alternatīvu. Ņūtona mehānikā sakņotai domāšanai pieņemamākā bija gaismas korpuskulārā teorija. (Tā domāja arī senie ēģiptieši — Saules dieva pielūdzēji [40]).

Tomēr fiziķi — Ņūtona pēcteči, gaismas viļņu teorijas izveidotāji Kristiāns Heigenss, Tomass Jungs, Ogistēns Frenels un citi —, balstoties uz acīmredza­majiem interferences un difrakcijas efektiem, šķietami nepārprotami pierādīja gaismas vi|ņveida dabu. Šo attīstību vainagoja Maksvela elektromagnētisko viļņu teorija, kuras ietvaros, balstoties uz elegantu matemātisku formālismu (122. att. 282. lpp.), varēja vienotā sistēmā aprakstīt visu elektromagnētisko vi|ņu svārstību spektru no radioviļņiem līdz Rentgena un gamma starojumam.

Maksvela teorija šķita esam pati pilnība, perfekta kā pēc satura, tā arī pēc formas. Bet jau 20. gs. sākums nāca ar jauniem revolucionāriem atklājumiem un jaunām paradigmām, kas satricināja gan Ņūtona mehānikas, gan Maksvela elektrodinamikas toreiz jau par klasisko fiziku nosauktās teorētiskās sistēmas. Ja visas elektromagnētiskās svārstības — ari redzamā gaisma — izplatās kā viļņi, tad nepieciešama kāda nepārtraukta vide, kurā šie viļņi var izplatīties. Par tādu kļuva hipotētiskais ēters, kam bija jākļūst par fundamentu, uz kuru balstīt teorijas «arhitektoniskās» celtnes. Bet jaunu laikmetu iezvanīja, kā jau redzējām, kāds negatīvs eksperiments. Maikelsons un Morlijs, nosakot Zemes kustības sagaidāmo ietekmi uz gaismas ātrumu, konstatēja, ka šis ātrums ir konstants (c = 3 x 10^ km/s), neatkarīgs no Zemes kustības šajā ētera «jūrā». Tātad hipotētiskais ēters vispār neeksistē! Tas tika padzīts no fizikas «paradī­zes» un atrada savu vietu tikai masu mediju leksikā.

Šis atklājums saskanēja ar Einšteina speciālās relativitātes teorijas pamat­postulātu, kas kā plašāks mehānikas vispārinājums nomainīja līdz tam «nemal­dīgo» Ņūtona mehāniku vai, pareizāk sakot, inkorporēja to kā specifisku, noteiktiem apstākļiem tuvinātu mehānisko parādību aprakstu. Bet šis atklā­jums satricināja ari gaismas vilnu teorijas pamatnostādnes.

Tajā pašā 20. gs. pirmajā desmitgadē sekoja jauns dramatisks atklājums. Maksvela teorijai draudēja katastrofa no pavisam citas puses. Tā nekādi neva­rēja izskaidrot t. s. melnā ķermeņa starojuma spektru.

Vācu fiziķis Makss Planks 1900. gadā pierādīja, ka, lai izskaidrotu šā spek­tra raksturu, jāpieņem, ka gaisma nevis izplatās kā nepārtraukts viļņveidīgs starojums, bet sastāv no gaismas kvantiem, kuriem ir diskrēts, tātad faktiski korpuskulārs raksturs. Planks parādīja, ka gaismas kvantu enerģija aprakstāma ar ļoti vienkāršu formulu:

E = hv, (1)

kur v ir gaismas starojuma frekvence, bet h (tāpat kā gaismas ātrums c) ir universāla dabas konstante, saukta ari par akcijas kvantu h = 6,28 x 10-34 J s un pazīstama kā Planka konstante. (Jāpiebilst, ka saskaņā ar Maksvela teoriju gaismas starojuma enerģijai vajadzētu būt proporcionālai nevis frekvencei, bet gan svārstību amplitūdas kvadrātam.)

Mazliet vēlāk — 1905. gadā — Alberts Einšteins atklāja, ka ari fotoelek- triskajā efektā gaisma parādās kā sastāvoša no korpuskulām, kuras nosauca par fotoniem. Tā bija it kā šķietami nesavienojamu īpašību izpausme: dažos proce­sos — piemēram, difrakcijā un interferencē — gaisma uzvedās kā vilnis, citos — piemēram, fotoelektronu emisijā un starojuma procesos — kā daļiņu, korpuskulu plūsma. Šāds vienas substances — gaismas — daļiņas un viļņa duālisms likās nesavienojams paradokss, kas runāja pretim klasiskās fizi­kas formālajai loģikai un šķietami ari veselajam saprātam (sk. 16. eseju un 35. att. 78. lpp.).

Negaidīti atklājumi sekoja arī mikrodaļiņu fizikā. 1924. gadā franču fiziķis, senas aristokrātu dzimtas atvase, hercogs Luijs de Brojī veica vienu no gad­simta ģeniālākajiem atklājumiem. Pie šā atklājuma viņu noveda paradoksāli vienkārša doma. Ja gaismas fotoni ir ne vien vilnis, bet arī daļiņas, kāpēc gan nevarētu būt, ka elektronam, kas līdz šim tika uzskatīts par daļiņu, nevarētu piemist arī viļņa daba? Tas bija tīri intuitīvs slēdziens, balstīts nevis uz deduk- (ivo analīzi, bet vienkārši uz analoģiju. Luijs de Brojī parādīja, ka ar elektronu (kā arī ar jebkuru citu mikrodaļiņu) saistītā viļņa garums X nosakāms ar ļoti vienkāršu formulu:

(2)

kur h ir Planka konstante, bet p — daļiņas impulss {p = mv, kur m ir daļiņas masa, bet v— tās ātrums).

Formulas (1) un (2) uzskatāmas par matērijas īpašību visuniversālāko aprakstu un, kā redzams, ir dievišķas savā vienkāršībā un skaidrībā. Pirmā for­mula (1) postulē gaismas viļņa korpuskulāro dabu, otrā (2) — daļiņu viļņ- veida dabu; abas kopā tās postulē viļņa un korpuskulas jebkuras matērijas formas komplementāro raksturu.

Pirmais, kas izprata de Brojī atklājuma nozīmīgumu, bija Alberts Einšteins. Vēstulē Lanževēnam viņš ar sev piemītošo filozofisko humoru rakstīja: «Er hat einen Zipfel des grossen Schleiers geliiftet (Viņš ir pacēlis liela plīvura stūri).» Tiešām, pagāja tikai daži gadi (1927. g.), un angļu fiziķi Dēvisons, Džermers un Tomsons eksperimentāli konstatēja elektrona difrakcijas ainu, elektronu plūsmai izejot caur plānu metāla foliju. Ar to tika eksperimentāli apstiprināts, ka elektroniem (un arī citām mikrodaļiņām — neitroniem un protoniem) tiešām piemīt daļiņas un viļņa īpašības. Pašlaik elektronu difrakcijas metodi plaši izmanto vielas struktūras pētījumos.

15. VIELAS UN ENERĢIJAS PRETMETI

Līdz par Einšteina darbiem relativitātes teorijā klasiskā fizika aplūkoja vielu un enerģiju kā savstarpēji atrautus matērijas atribūtus. Atsevišķi bija formulēts vielas nezūdamības (Lavuazjē, Lomonosovs) un enerģijas nezūdamības (Maiers, Helmholcs, Džouls) likums. Einšteins parādīja, ka viela un enerģija ir komplementāri matērijas atribūti, un postulēja universālu vielas un enerģijas nezūdamības likumu, saskaņā ar kuru viela var pārvērsties enerģijā un ener­ģija — vielā. Šos abus matērijas atribūtus (vielu ar masu m un enerģiju E) atkal saista paradoksāli vienkārša formula:

E = mc2 , (3)

kur c ir gaismas ātrums vakuumā (c = 3 x 1010 cm/s), arī Visuma univer­sāla konstante. Šai konstantei ir tikpat ievērojama loma Einšteina relativitātes teorijā kā Planka konstantei h kvantu teorijā.

Loti aizraujoša un reizē pamācoša ir šīs vienkāršās formulas tapšanas vēs­ture. Sākotnēji 1912. gadā relativitātes teorijai veltītajā rakstā Einšteins šo for­mulu, paplašinādams Ņūtona mehānikas priekšstatus, bija uzrakstījis šādā vispārīgā formā:

EL = mc2 + T j-q2 + … (3a)

Kā redzams no manuskripta kopijas 34. att., lielumu L, kas bija domāts kā konstante, Einšteins drosmīgi nosvītrojis. īpaša nozīme nav arī otrajam locek­lim, kas apraksta ņūtonisko kinētisko enerģiju un nenoliedzami ir mazāks par pirmo locekli. Rezultātā paliek fundamentālā izteiksme (3), kas postulē

. v av)

.14. att. Fragments no Einšteina rokraksta, kurā redzams, kā Einšteins 1912. gadā izvedis slaveno vielas un enerģijas ekvivalences formulu (3): E = mc2 . Kopija no žurnāla «Scientific American» 1996. gada maija numura. Manuskripta oriģināls glabājas Izraēlas muzejā Jeruzalemē.

enerģijas un masas ekvivalenci un pamatoti tiek uzskatīta par epohālu atklā­jumu. Šī formula apraksta vielas pārvēršanos enerģijā un ir pamatā visām kodolreakcijām, arī tām, kuras norisinās atombumbas sprādzienā. Šīs vien­kāršās formulas atklāšana bija zinātnes lielākais triumfs un reizē arī posts, kas noveda pie Hirosimas. Formulas izmantošana masu iznīcināšanas ieroču izveidē bija viena no Einšteina dzīves smagākajām traģēdijām. Nodzeltējušo manuskriptu nesen kāds ebreju bagātnieks nopirka par trim miljoniem dolāru un uzdāvināja Izraēlas muzejam Jeruzalemē. Mēs ar šā slavenā manu­skripta fragmentu ilustrējam ģēnija intuitīvo atklāsmi, kad tiek atmests maznozīmīgais, nosvītrojot L un tālākos locekļus, un postulēts pats būtis­kākais, t. i., formula (3). Austrumu fdozofi un mistiķi to sauc par satori — Dievišķo Apgaismību.

Formulas (1—3) patiesi jāsauc par dievišķām, jo tās apraksta visuniver­sālākās Visuma īpašības, kas ietvertas daļiņas — viļņa un vielas — enerģijas komplementārajos pāros. Tās ir Bora pretmetu Lielās Patiesības jan un iņ principa interpretācija mūsdienu zinātnē. Tās ir tikpat vienkāršas un skaistas.

' Jo lielāka kāda Patiesība, jo vienkāršākā formā tā izsakāma.

16. NENOTEIKTĪBAS RELĀCIJA UN KOMPLEMENTARITĀTES PRINCIPS

Nākamais fatālais trieciens klasiskās fizikas pamatprincipiem nāca no jaunā, talantīgā vācu fizika Vernera Heizenberga. 1927. gadā viņš formulēja nenoteiktības relāciju. Saskaņā ar šo principu, kas vēlāk kļuva par kvantu fizikas stūrakmeni, nav iespējams vienlaicīgi precīzi noteikt mikrodaļiņas koordinā­tas q un tās impulsu p. Šo lielumu noteikšanas kļūdu Aq un Ap reizinājums vienmēr būs vienāds vai lielāks par Planka konstanti h\

A q. Ap > h. (4)

Kā redzams no izteiksmes (4), ja nosakām daļiņas koordinātas A^ar augstu precizitāti (Aq —> 0), tad vienlaicīgi daļiņas impulsa noteikšanas kļūda kļūst bezgala liela {Ap —> un otrādi. Tas arī ir nenoteiktības relācijas matemā­tiskais formulējums. Bet kā saprast šādas nenoteiktības fizikālo jēgu? Pats nenoteiktības jēdziens bija svešs un nepieņemams klasiskajai Ņūtona un Laplasa fizikai, kurā viss bija stingri determinēts, pakļauts kauzalitātes liku­mam. Zinot jebkuras materiālās daļiņas sākotnējās koordinātas un impulsu, kā arī spēkus, kas uz to iedarbojas, var nepārprotami, kā izriet no klasiskās mehānikas, prognozēt daļiņas nākotni, tās vienīgo iespējamo trajektoriju, kā arī pagātni, no kuras tā nākusi. Arī pats Heizenbergs rakstā, kas tika iesniegts žurnālam «Physikalische Zeitschrifi», nespēja dot atbildi uz šo jautājumu.

Atbildi deva Bors, kura domāšana bija ievirzīta citādi nekā lielam vairumam kolēģu. Bors dabas parādību fizikālo izpratni balstīja nevis uz matemātisku for­mālismu un deduktīvu analīzi, bet uz ģeniālu intuīciju un pieeju, kas rakstu- rīga orientālajam daoismam un dzenbudismam. Pēc dzenbudistu pārliecības, apskaidrību (satori) var dot tikai jautājuma paradoksāla nostādne, racionālā prāta iedzīšana strupceļā. Nenoteiktības relācija Boram bija kā sava veida dzenbudistu koana, kurā atbilde uz jautājumu iespējama tikai paradoksālā risinājumā. Ne velti Bora zinātniskais credo skanēja — «No progress luithout />aradox (Progress nav iespējams bez paradoksiem)». Viņam nebija pieņemama «vienīgās» objektīvās patiesības ideoloģija, jo — «Great truth is a truth who's opposite is also a Great truth». Citiem vārdiem, pretmetu patiesības papildina viena otru. Šis postulāts jāuzskata par filozofiski vispārinātu komplementaritātes

principa definīciju. Tās ietvaros zināt­niekam vienmēr jābūt gatavam atzīt, «ka varētu būt arī citādi». Un tā Bors 1927. g. septembrī pasaules vadošo fiziķu Solveja kongresā (8. att. 1. piel.) varēja formulēt gan vispārināto komple- mentaritātes principu, gan tā lietojumu nenoteiktības relācijas fizikālajā inter­pretācijā.

Saskaņā ar šo principu mikrodaļiņas kā viļņa un kā korpuskulas apraksti ir savstarpēji komplementāri un tikai abi šie traktējumi dod iespēju pilnībā izprast mikropasauli. Fiziķis var izvēlē­ties vai nu viļņveida, vai korpuskulāro aprakstu un tā ietvaros interpretēt eksperimentu. Abas it kā savstarpēji izslēdzošās pieejas var būt pareizas. Korpuskulārā traktējumā mēs vilni uztveram kā lokalizētu viļņu paketi un varam precizēt tās koordinātas q. Bet tai pašā laikā mēs nevaram precīzi noteikt viļņa garumu X, kas nosaka daļiņas impulsu. Viļņa interpretācijā savukārt daļiņa tiek apskatīta kā de- lokalizēta un mēs zaudējām iespēju uz šī viļņa noteikt daļiņas koordinātas q. Bet tai pašā laikā mēs varam precīzi noteikt viļņa periodu vai frekvenci un atbilstoši daļiņas impulsu p. Tā ir pati svarīgākā kvantu mehānikas nostādne, kas nosaka jebkuras mikrodaļiņas, kā ari gaismas fotonu «uzvedības normas». Vilnis, viļņa pakete un daļiņa shema­tiski attēlota 35. attēlā.

(5)

Ar Bora līdzdalību tika formulēta arī otra nenoteiktības relācija, kas

sasaista enerģiju Ear laiku t. Šajā gadī­jumā enerģijas un laika noteikšanas precizitāti AE un At saista analoga nenoteiktības relācija:

AE.Atžh.

Ja gribam precīzi noteikt laiku, kurā izmainās mikroshēmas enerģētiskais stāvoklis, mēs nevaram vienlaicīgi konstatēt enerģijas lielumu, kas mainās. Un otrādi, ja mēs precīzi nosakām enerģijas izmaiņas, mēs zaudējam iespēju noteikt laika intervālu, kurā šīs izmainās notiek. Relācija (5) ir vispārīgāka un daudzos mikroprocesu novērtējumos nozīmīgāka par relāciju (4), un to loti bieži izmanto fiziķi, novērtējot dažādu mikroprocesu norises dabu un virzienu.

Formulas (4) un (5) ir tikpat universālas kā formulas (1—3), tikai tās ienes jaunu kategoriju dabas aprakstā — nenoteiktību; vienlīdzības zīmes = vietā parādās nenoteiktība > (lielāks vai vienāds).

Tā divdesmito gadu fizikā ienāk jauna paradigma— nenoteiktības princips. Tas ir pretrunā ar visu dabaszinātnieku iepriekšējo pamattendenci — noteik­tības un stingru fizikālo pamatlikumu meklējumiem. Tā «search for certainty» (noteiktības meklējumi) kā pamatdzinulis zinātniskajā domāšanā tiek aizstāts ar pretmetu — nenoteiktību. Raksturīgi, ka amerikāņu autoru V. V. Spradlina un P. Porterfīldas viedīgā ekskursija cilvēces zinātniskās domas attīstībā grāmatā «Noteiktības meklējumi» («Search for Certainty», [180]) beidzas ar nodalu «Noteiktības bojāeja» («Death of Certainty»), kurā atspoguļotas mūs­dienu fizikas pamatnostādnes, kas balstītas uz nenoteiktības principu.

Līdzīgi viens no jaunās paradigmas iedibinātājiem mūsdienu fizikā, Nobela prēmijas laureāts Iļja Prigožins savai nesen iznākušajai filozofiskas ievirzes grāmatai devis nosaukumu «Noteiktības gals» («The End of Certainty», [150]). Prigožins šajā grāmatā apskata tādas modernās fizikas filozofiskās kategorijas kā laiks un haoss un parāda, kā tās veido pamatus jaunai dabas likumu izpratnei.

Nenoteiktība kāda procesa vai notikuma norisē vai tā prognozēšana saistīta ar varbūtību, ka šis process vai notikums tiešām realizēsies. Pētnieks var tikai novērtēt šīs varbūtības lielumu un tā prognozēt parādību iespējamo norisi. Tādā kārtā stingri determinētu norišu izklāsta vietā stājas statistiska novērtēju­mu metodika. Blakus kvantu fizikai, kas pilnībā balstās uz statistiskiem prin­cipiem, izveidojās plaša fizikas nozare, kas pazīstama kā statistiskā fizika. Svarīgākā ir atziņa, ka mikropasaules norises nepakļaujas determinētai cēloņu un seku ķēdei, kauzalitātes principu aizstāj statistiskais nenoteiktības princips un indeterminisms kā fizikāla realitāte (un nevis kā mūsu nespēja precīzi fiksēt mikropasaules sarežģītos procesus).

Tam pamatā ir apstāklis, ka mikrodaļiņas nevar apskatīt izolēti, tās jāapskata ka kopa, statistisks ansamblis, kur katra daļiņa ir saistīta mijiedarbībā ar dau­dzām citām. To formulējis Nilss Bors: «Izolēta daļiņa ir abstrakcija, katra daļiņa ir jāapskata mijiedarbībā ar citām.» Turklāt, kā jau redzējām, katra daļiņa pati par sevi jāapraksta statistiski, tā var būt gan korpuskula, gan vilnis.

17. INDRAS TIKLA METAFORA

Un atkal līdzīgu nostādni, bet vēl plašākā filozofiskā kontekstā atrodam senā budistu sūtrā (Avatamsakasūtrā): «Līdzīgi kā tīklu veido mezglu rindas, tāpat viss šai pasaulē ir saistīts mezglotā tiklveida «audumā». Ja kāds iedomājas, ka šajā tīklā kaut viens mezgliņš ir neatkarīgs, viņš dziļi maldās.» ([186], 42. lpp.) Tā ir budistu filozofiskā alegorija — «Indras tīkls», kas saistīts telpā un laikā.

Indras tīklu veido bezgalīgs saistošo šķiedru vijums, kas plešas cauri Visu­mam. Horizontālās šķiedras vijas cauri telpai, vertikālās — cauri laikam. Vai tas nav brīnišķīgs einšteiniskā telplaika atveids? Bet Indras tīkla alegoriskā jēga ir vēl dziļāka. Katrā mezglu punktā ir indivīds, un katrs indivīds ir kristāliska pērlīte tīkla mezglā. «Absolūtās Būtnes» Lielā Gaisma izgaismo un iespiežas ikkatrā kristāla pērlītē. Katra pērlīte savukārt atstaro gaismu ne tikvien no citām tīkla pērlītēm, bet arī uztver starojumu no visa Universa ([72], 258. lpp.) Šo dziļi filozofisko savstarpējās atstarošanās ideju konģeniāli atveidojis Mauritss Eshers grafikā «Trīs Lodes II» (36. att. 2. piel.). Tajā katrā zīmējumā attēlotā daļa atspoguļo citu un tiek atspoguļota citā. Rakstāmgalda virsma atspoguļo lodes uz tās, lodes atspoguļo viena otru, kā arī rakstāmgaldu, pašu ložu zīmējumu un mākslinieku, kas zīmē. Tā simboliskā vispārinājumā atveidota visu pasaules lietu savstarpējā sakarība un atkarība. Šī gleznieciskā metafora lieliski atklāj gan Indras tīkla, gan modernās kvantu fizikas idejiskās pamatnostādnes.

Eshera «Trīs Lodes II» rosina arī uz citām asociatīvām pārdomām. Labējā lodē un tās spoguļattēlos jaušama lieliska gaismēnu «chiaroscuro» — saspēle, kas vedina uz domām par gaismas un tumsas pretmetiem. Šai kontekstā krei­sās lodes spoguļattēlā nav grūti saskatīt mazliet deformētu iņ un jan simbolu. Pats sevi mākslinieks ievietojis lodē kā Indras tīkla kristāla pērli, kurā atsta­rojas Lielā Gaisma no visa Universa.

«Indras tīkla» metaforas kontekstā tad arī jāizprot Nilsa Bora teiktais, ka izolēta mikrodaļiņa ir tīrā abstrakcija, katra daļiņa ir jāapskata mijiedarbībā ar citām. Tāpēc šādā daļiņu kopā nevar runāt par atsevišķas daļiņas «uzvedību», tā vietā jāskata visu daļiņu ansambļa kooperatīvā mijiedarbība. Nevar mainīt vienas daļiņas stāvokli, reizē neietekmējot pārējās. Klasiskā divu mijiedarbo­jošos ķermeņu fizika nav piemērojama daudzdaļiņu ansambļa aprakstam, kā tas ir debesu mehānikā. Tā raksturošanai jāizmanto statistiska pieeja, nevis kauzalitātes princips.

18. atommodeļi, orbītas un orbitāles. pulksteņa un mākoņa metafora

Debesu mehānika, kur apraksts reducējas uz divu ķermeņu (zvaigznes un planētas vai zvaigznes un komētas) mijiedarbību (pārējo planētu iedarbību var uzskatīt tikai par nelielu perturbējošu faktoru), katra ķermeņa trajektoriju var precīzi aprēķināt un prognozēt. Sākotnēji, aprakstot mikropasauli, elektronu kustību atomā mēģināja parādīt ar planetāru modeli. Tas ir t. s. Rezerforda atoma modelis, kuru angļu fiziķis proponēja 1911. gadā. Šis modelis izrādījās dzīvotnespējīgs, jo bija pretrunā ar kvantu mehānikas pamatlikumiem. Kustībā pa šādu planetāru trajektoriju elektronam būtu jāzaudē enerģija nepārtrauktā starojumā un galarezultātā jānokrīt uz atoma kodola. Šāds atomu sabrukums netiek novērots. Turklāt atoma starojums nav nepārtraukts — enerģija tiek izstarota diskrētu kvantu veidā.

Rezerforda planetāro, Ņūtona mehā­nikas garā izveidoto atommodeli jau 1913. gadā centās glābt Nilss Bors, ieviešot kvan­tu postulātus. Saskaņā ar šiem postulā­tiem elektroni kustas ap atoma kodolu pa stacionārām riņķveida vai eliptiskām or­bītām, kas līdzīgas planētu trajektorijām ap zvaigznēm. Šādā kvazistacionārā atoma modelī gaisma tiek absorbēta vai izstarota diskrētu gaismas kvantu hv veidā, elektro­nam pārlecot no vienas stacionārās orbī­tas uz otru.

Bora postulētais atomu modelis bija dīvains klasiskās un kvantu mehānikas hi­brīds. Tajā tika iemiesota atomu staro­juma diskrētā kvantveida daba, saglabājot klasiskās mehānikas trajektoriju nepār­trauktības principus. Bet jau šajā sākot­nējā Bora atommodeli nav grūti saskatīt daļiņas un viļņa komplementaritātes idejas iedīgļus — idejas, kuru Bors formulēja pēc

četrpadsmit gadiem 1927. gada Solveja kongresā. Redzams, ka Bors, proponējot šo modeli, jau tīri intuitīvi balstījās uz kvantu mehānikas pamatprincipu — nenoteiktības relāciju. Bora atommodelis deva iespēju gan kvantitatīvi aprakstīt ūdeņraža atoma spektra diskrēto dabu, gan kvalitatīvi citu — sarežģītāku periodiskās sistēmas elementu atomstruktūru. 37. attēlā (81. lpp.) parādītas nātrija un argona «planetāro» atoma mode|u elektronu trajektorijas. Kā redzams, inertai cēlgāzei argonam veidojas simetriski noslēgtas elektronu orbītu čaulas, turpretī ķīmiski aktīvajam nātrijam valentā elektrona trajektorija, līdzīgi komētai, aiziet tālu no atoma kodola un to var viegli ķīmiskā reakcijā atrauc. Turpmākajā kvantu mehānikas attīstības gaitā — pēc nenoteiktības relācijas atklājuma — sākotnējo Bora orbitālo atommodeli nācās fundamentāli modificēt.

Saskaņā ar kvantu mehānikas nenoteiktības relāciju principā nav iespējams noteikt elektronu trajektoriju orbītas atomā. Var aprēķināt tikai elektrona atra­šanās varbūtību telpā ap atoma kodolu. Elektrona kustība atomā pakļaujas nevis Ņūtona, bet kvantu mehānikas likumiem, to apraksta t. s. Šrēdingera viļņu vienādojums. Šo vienādojumu atrisinot, var iegūt īpašfunkcijas, t. s. viļņu funkcijas V|/ , un elektrona enerģijas īpašvērtības En . Viļņu funkcijas \\i moduļa kvadrāts l\)/h tad arī dod iespēju noteikt elektrona atrašanās varbūtību kodola tuvumā. So vērtību kopa veido t. s. orbitāles, kas nav īstās elektrona orbītas (trajektorijas), bet raksturo telpas apgabalus, kuros visvarbūtīgāk atrast elek­tronu. Tātad orbitāle faktiski reprezentē elektrona varbūtības sadalījumu telpā, citiem vārdiem, varbūtību atrast elektronu kādā telpas punktā.

Lai gan etimoloģiski (un arī vēsturiski) orbitāles nosaukums atvasināts no jēdziena «orbīta», tam būtībā ir pilnīgi cita fizikālā jēga. Tas apraksta nevis konkrētu elektrona trajektoriju, bet iespējamu trajektoriju superpozīciju, kas veido elektronu mākoni ap atoma kodolu. 38. attēlā (83. lpp ) vizualizētas ārējo valento elektronu atomārās orbitāles oglekļa atomam (a) un molekulārās orbitāles metāna (b) un benzola (c) molekulām. Orbitāles raksturo ar trim kvantu skaitļiem-, pirmais nosaka orbitāles enerģētisko līmeni (un tātad orbi­tāles izmērus), otrais — leņķisko momentu (tātad orbitāles formu), trešais — orbitāles orientāciju. Saskaņā ar kvantu mehānikas Pauli principu katrā orbi- tālē var izvietoties tikai divi elektroni ar pretējiem spiniem.

Elektronu spinu resp. elektrona mehāniskā momenta orientāciju savukārt raksturo ceturtais kvantu skaitlis. Tātad elektrona stāvokli atomā vai molekulā nosaka četri kvantu skaitļi.

Volfgangs Pauli, kas ieviesa ceturto elektrona spinu raksturojošo kvantu skaitli, šim apstāklim piedēvēja īpašu filozofisku nozīmīgumu. Viņš bija aizrāvies ar skaitļu mistiku. Vai četri kvantu skaitļi, kas nosaka mikropasaules strukturālos pamatus, neapstiprina pitagoriešu mācību par skaitļu primātu Visuma uzbūvē?

Pauli īpaši uzsvēra, ka eksistē tieši četri kvantu skaitli un ka tieši viņš atklājis ceturto. Jo skaitlim četri bija īpaša loma pitagoriešu filozofijā. Tas bija sakrāls

skaitlis, kas simbolizēja vienību starp Debesīm un Zemi. Četri ir ari kvaternitātes principa pamatā; šim principam bija būtiska nozīme gan sengrieķu, gan vidus­laiku filozofijā un vēlāk Kanta un Šopenhauera filozofiskajos traktātos. Kvater- ninātes principu izmantoja arī pats Volfgangs Pauli, paplašinādams komplemen­tāro pretmetu pāri ar polāro pretmetu pāri ([103], 125. lpp. un 78. eseja). Salīdzinot 37. un 38. attēlu, redzams, ka planetārā mode|a ģeometrizētajām orbītām un kvantu mehāniskā modeļa difuzo orbitālu «mākoņiem» ne vien fizi­kālā satura, bet arī ārējās formas ziņā nav gandrīz nekā kopēja. Tas vizuāli demonstrē principiālo atšķirību starp klasisko un kvantu mehāniku.

Kvantu atommodeļa elektronu orbitālēm var piemist fantastiski daudzveidī­gas formas, tās var veidot gan sfēras, gan simetriskas un asimetriskas hanteles, gan deformētus elipsoīdus, gredzenus, torus un citas simetriskas un nesimetriskas figūras. 39. attēlā (84. lpp.) parādītas elektronu orbitāles vara heksadekahlor- ftalocianīna molekulā kristāliskā stāvoklī. Atšķirībā no orbitālēm 38. attēlā, kas

iegūtas aprēķinu ce|ā, 39. attēlā parādīta reāla aina, kas iegūta ar ļoti augstas izšķiršanas spējas elektronu mikroskopu. Šī reālā mikrogramma pilnīgi adekvāti ataino kvantu ķīmijas teorētiskos priekšstatus par atomu un molekulu uzbūvi un elektronu orbitālu formām. Mikrogramma skaidri saskatāmas 16 periferālo hlora atomu nedaudz izstieptās orbitāles, kas mazliet pārklājas ar blakusmolekulu orbitālēm atbilstoši kvantu ķīmijas teorētiskajiem priekšsta­tiem. Centrā redzama gandrīz sfēriskā vara atoma orbitāle, kas ar četrām koordinatīvām saitēm mijiedarbojas ar ftalocianīna četriem slāpekļa atomiem. Nedaudz difūzāki ir oglekļa un slāpekļa atomu veidotie cikli.

Šo elektronu mikrogrammu, kas iegūta profesora T. Kobajaši laboratorijā Kioto universitātes Lietišķās ķīmijas institūtā, var praktiski uzskatīt par epo- hālu mūsdienu eksperimentālās tehnikas sasniegumu. Mikrogrammā iegūta fantastiska izšķiršanas spēja 1,5 A robežās. Tas nozīmē, ka sasniegts apmēram 100 miljonu reižu liels palielinājums!

Šajā mikrogrammā cilvēka acs pirmo reizi var saskatīt atsevišķus vielas ato­mus, īpaši vara atomu molekulas centrā un 16 hlora atomus tās perifērijā. Molekulas attēls, kā redzams, tieši atbilst tās ķīmiskajai struktūrformulai! Un fantastiski — tas lieliski atbilst ķīmiskās fizikas teorētiķu intelektuāli izstrādā­tajiem modeļiem!

Jāuzsver, ka filozofiskā aspektā kvantu mākoņveida orbitāles var uzskatīt par vizualizētiem kvantu fizikas statistiskā indeterminisma prototipiem. Mūs­dienu izcilais zinātnes filozofs Karls Popers vispārinātam vizuālam determi­nisma un indeterminisma atainojumam kā metaforas ieteicis atbilstoši pulksteni un mākoni ([148], 33. lpp.).

Kā jau minējām, Ņūtona deterministiskā pasaule, kas reducēta no plane- tārās debesu mehānikas, patiešām var tikt identificēta ar precīzi darbojošos pulksteņa mehānismu. Šī metafora ir patiešām perfekta! Bet tikpat perfekta ir mikropasaules indeterminismu raksturojošā mākoņa metafora. Tai lieliski atbilst elektronu orbitāļu mākoņi un to fizikālā iedaba. Bet mākoņi, kā redzē­sim tālāk, arī makropasaulē var būt indeterminētu haotisku parādību proto­tips. Laika apstākļi ir tikpat grūti prognozējami kā elektronu trajektorija atomā. Bet tas viss jau iekļaujas modernās haosa teorijas un fraktāļu ģeometri­jas ietvaros; par to visu nedaudz vēlāk.

Pašlaik uzsvērsim: abi — determinisms un indeterminisms— ir komple­mentāras Lielo Patiesību puses. Reālajā Pasaulē tie abi pastāv līdzās.

19. KOPENHĀGENAS SUPERZVAIGZŅU KVINTETS UN VIENTUĻNIEKS ALBERTS EINŠTEINS

Kvantu mehānikas statistiskais skaidrojums pazīstams ar nosaukumu «Kopenhāgenas interpretācija». To formulēja un teorētiski pamatoja kopen- hāgenietis Nilss Bors un divi viņa talantīgākie skolnieki vācietis Verners Heizenbergs un anglis Pols Diraks. Šai kvantu fizikas superzvaigzņu triādei drīz pievienojās arī Volfgangs Pauli, kas kļuva nemirstīgs ar cita nozīmīga mikropasaules likuma, t. s. Pauli principa, atklājumu, un Makss Borns, kas vis­pārliecinošāk pamatoja kvantu fizikas statistisko būtību, kā arī parādīja, ka kvantu mehānikas likumu pieraksts matricu matemātikā, ko pirmais formulēja Heizenbergs, un viļņu vienādojuma formā, kā ieteica Šrēdingers, ir pēc būtības komplementāri pieraksti. Tādējādi kvantu fizikas statistisko interpretā­ciju, kas sākotnēji bija grūti pieņemama vecās klasiskās skolas fiziķiem, spoži aizstāvēja pieci kvantu fizikas dižgari, kas visi kā viens saņēma augstāko balvu zinātnē — Nobela prēmiju (sk. 1. tabulu 31. lpp.).

Savdabīgu nostādni šai problemātikā ieņēma Alberts Einšteins. Tieši viņa fotoelektriskā efekta skaidrojums 1905. gadā iezvanīja jaunu — kvantu fizikas ēru. Šis atklājums bija tik nozīmīgs, ka atnesa viņam Nobela balvu 1921. gadā. Tātad augsto apbalvojumu Einšteins saņēma nevis par speciālās relativitātes teorijas izstrādi tajā pašā 1905. gadā — tā ari izraisīja revolūciju Ņūtona mehānikas fizikālajos priekšstatos par telpu, laiku un ķermeņa kustību —, bet tieši par kvantu fizikas pamatu izveidi. Einšteins un Planks ielika stūrak­meņus, uz kuriem vēlāk tika būvēta visa monumentālā kvantu fizikas celtne. Neizmērojams ir arī Einšteina ieguldījums statistiskās fizikas kā zinātnes nozares izveidošanā. Tajā pašā 1905. gadā viņš izstrādāja teoriju Brauna kustības statistiskajam aprakstam. 1924. gadā, padziļinot un paplašinot indiešu fizika Š. Bozes idejas, Einšteins radīja jaunu statistiskās fizikas nozari, kas pazīstama kā Einšteina-Bozes statistika. Šī statistika, kas lietojama daļi­ņām ar veselu spinu 5= 1 (piemēram, fotoniem), līdz ar Fermī—Diraka statis­tiku, ko izmanto daļiņām ar spinu S= 1/2, (piemēram, elektroniem), veido teorētisko bāzi mikrodaļiņu ansambļa aprakstam.

Taču Einšteinam — sevišķi dzīves otrajā pusē — nobrieda principiāli iebil­dumi pret dabas procesu statistisko interpretāciju. Tie gan drīzāk bija filozofiska nekā fizikāla rakstura un cieši saistīti ar viņa filozofisko credo un lielā mērā reliģisko pārliecību. Savā būtībā Einšteins, kā liecina viņa fizikāli filozofiskās esejas un sarakste ar tā laika izcilākajiem fiziķiem, it īpaši ar Bornu [13, 43], bija panteists, kas dzi(i ticēja, ka visu parādību pamatā jābūt stingri determi­nētiem likumiem, kuri jāmeklē un jāatrod. Filozofiski Einšteinam vispieņema­mākais bija Spinozas deterministiskais monisms un no tā izrietošais panteisms. Parādību statistiskais skaidrojums viņam šķita nepietiekami dziļš izzinātāja skatījums pašu parādību būtībā.

Vairāk nekā desmit gadus pasaules vadošo atomfiziķu sanāksmēs turpinājās divu fizikas gigantu — Bora un Einšteina — intelektuālais duelis. Einšteins izdomāja arvien jaunus iebildumus pret kvantu fizikas statistisko interpretā­ciju. Nilss Bors un Kopenhāgenas kvintets tos vienmēr atspēkoja un garajā diskusiju maratonā palika uzvarētāji [201]. Kvantu mehānikas, kvantu elek- trodinamikas un statistiskās fizikas attīstības vēsture un lieliskie panākumi daudzu dabas procesu izskaidrošanā liecināja, ka šis modernās fizikas nozares nesatur iekšējas pretrunas. Statistiskie jeb stohastiskie principi, izrādījās, ir iekšēja dabas procesu sastāvdaļa un nav saistīti ar pētnieka nespēju tos aprak­stīt determinētu likumu ietvaros. Boram uzvaru šajā intelektuālajā duelī nodrošināja viņa intuitīvā ticība universālajam komplementaritātes principam, kas vienmēr kā vadmotīvs caurvija viņa domu gaitu.

Četrdesmitajos gados šī diskusija turpinājās Einšteina un kvantu fizikas statistiskās interpretācijas dedzīgākā aizstāvja Maksa Borna sarakstē [201]. Ar viņam piemītošo filozofisko ironiju Einšteins vienā no vēstulēm Bornam (1947. g.) rakstīja bieži citēto izteikumu: «Es neticu, ka Dievs rada dabas liku­mus ar spēļu kauliņu palīdzību.» [13]

Ari rakstā par teorētiskās fizikas pamatiem ([43], 220. lpp.) Einšteins rezumē, ka parādības dabā nevar līdzināties azartspēlēm, ruletei. Einšteina no­stādni, kā jau minējām, lielā mērā ietekmēja viņa ētiski filozofiskie uzskati. Viņš ticēja Dievišķai pasaules kārtībai un nolemtībai. Šajā aspektā Einšteinu dziļi iespaidoja ne vien Spinozas paustais deterministiskais panteisms, bet arī krievu rakstnieka Dostojevska reliģiski ētiskie uzskati. Einšteins uzskatīja Dostojevski par vienu no pasaules izcilākajiem reliģiskās domas paudējiem. Ne vienreiz vien Einšteins atzinis, ka Dostojevskis viņam devis vairāk nekā 19. gs. ģeniālais matemātiķis Gauss [97, 98]. Kā raksta pazīstamais einšteinologs B. Kuzņecovs, Einšteinu un Dostojevski saista nemitīga kaisla pievēršanās viskardinālākajām zinātnes un ētikas problēmām, neatlaidīgi harmonijas meklējumi pasaules uzbūvē un cilvēku attiecībās — harmonijas, kas vienam atklājās paradoksālos fizikālos, otram — paradoksālos psiholoģiskos eksperimentos [97].

Einšteins pasaules uzbūves harmoniju meklē neeiklīdiskajā telplaika vieno­tībā, ikdienišķam prātam paradoksālajā četrdimensiju telpā. Arī Dostojevska Ivans Karamazovs sarunā ar brāli Aļošu runā par «neeiklidisko esamību», viņam nepieņemama «eiklīdiskā» morāles harmonija, kas piepildās tikai ar citām kustas haotiski, kustība (ko­ordinātas un ātrumi) veido stohastisku stāvokļu virkni līdzīgi puteklīšiem saules staru kūlī vai sīkdaļiņām zem mikroskopa ūdens pilienā — to pir­mais novēroja Brauns, un tā pazīstama kā Brauna kustība ar praktiski neiero­bežotu brīvības pakāpju skaitu. Otra galējā situācija — visas daļiņas kustas koherenti, saskaņoti, ar noteiktām fā­zēm. Šajā gadījumā brīvības pakāpju skaits ir stingri ierobežots. Mēs varam teikt, ka šādu sistēmu uzvedība ir de­terminēta un tās var aprakstīt ar stin­gri formulētiem «nestatistiskiem» mate­mātiskiem vienādojumiem. Tā kohe- rentu gaismu, kurai ir noteikta frek­vence un svārstību fāzes stāvoklis, var aprakstīt ar vienkāršu viļņa vienādo­jumu.

Starp šiem galējiem stāvokļiem — koherento un haotisko — iespējami starpstāvokļi, pārejas no viena stā­vokļa uz otru.

Sinerģētikas veidošanās saistīta ar vācu fiziķa Hermana Hākena vārdu [61]. Viņš šo teoriju izveidoja, pētot pāreju no nekoherentas, haotiskas atomu kustības uz koherentu, sinfazu kustību lāzeru izlādes lampās. Līdz lāzerstaro- juma iestāšanās momentam visi atomi, piemēram, atomi hēlija izlādes caurulē, kustas haotiski ar daudzām iespējamām brīvības pakāpēm. Brīdī, kad strāva iz­lādes caurulē sasniedz kādu kritisku robežu, visi atomi sāk svārstīties kohe­renti, ar vienādām fāzēm, un rezultātā tiek ģenerēts koherents lāzera starojums. Šis process ir analogs fāzu pārejai no haotiska uz koherentu stāvokli (40. art.). Tas bija šķietami pretrunā ar vienu no

klasiskās termodinamikas pamattēzēm, proti, ka visās sistēmās dominē tendence pāriet no vairāk sakārtota uz mazāk sakārtotu, haosam tuvāku stāvokli.

Vispārinot lāzera ģenerācijas pētījumos iegūtos rezultātus, Hākens piecdes­mitajos gados radīja šo jauno zinātnes nozari — sinerģētiku.

Tieši sinerģētika dod atbildi uz gadsimtiem ilgo filozofisko jautājumu — vai pasaulē valda nepieciešamība vai gadījums? Hākena atbilde, kas ir viņa grā­matas «Sinerģētika» («Synergetics», [61]) pamatmotīvs, skan: «Chance and Necessity — Reality needs both (Gadījums un nepieciešamība — reālajai pasau­lei vajadzīgi abi).»

Tieši sinerģētika nevis vispārīga filozofiska postulāta veidā, bet stingri zinātniski parāda, ka nepieciešamība un gadījums ir jāuzskata par komplemen­tārām kategorijām, ka Pasaulē valda gan stingri determinēti, gan statistiski stohastiski likumi. Tie nevis izslēdz, bet papildina viens otru, pozitīvi atrisinot gadsimtu strīdu, kura no šīm kategorijām ir noteicošā. Tā reizē ir arī atbilde uz mums tik dziļi intīmo, tīri cilvēcisko jautājumu, vai mūsu dzīvi nosaka liktenis, vai tā ir nejaušību un neprognozējamu sakritību ķēde. Tas ir arī jautājums par cilvēka gribas uz izvēles brīvību ar tālu ejošām ētiskām konsekvencēm.

21. daŽi nozĪmĪgĀkie SINERĢĒTIKAS PAMATJĒDZIENI

Kā jau minējām, sinerģētika aplūko daudzkomponentu ansambļa koope­ratīvās «uzvedības» pamatproblēmas [61, 62].

Visnozīmīgākais process, ko tā aplūko, ir daudzkomponentu ansambļa pāreja no sākotnējā haotiskā uz koherentu, saskaņotu komponentu uzvedības stāvokli. Šādu pāreju pēc analoģijas ar fiziku pieņemts saukr par fazupāreju. Vispārīgā gadījumā tas nozīmē pāreju no sistēmas haotiskās fāzes, kurā valda stohastiskie gadījuma likumi, uz koherentas uzvedības fāzi, kas pakļaujas deterministiskām likumsakarībām.

Ansambļa haotisko fāzi raksturo ļoti liels brīvības pakāpju skaits. Tās apraksta ar mainīgajiem , q2 • > ■■■• turklāt šo mainīgo skaits n var līdzi­nāties komponentu skaitam daudzdaļiņu ansamblī. Šādā haosa stāvoklī katrai daļiņai ir sava brīvības pakāpe qn un tās nav pakļautas kopējai, visu ansambli raksturojošai uzvedības normai vai likumam.

Lai notiktu šāda fāzu pāreja, jāpanāk izteikti nelīdzsvarots daļiņu ansambļa stāvoklis. Sinerģētikā kā uzskatāmu piemēru parasti min plānu ūdens slānīti starp divām metāla plāksnēm [61, 62]. Ja abu plākšņu temperatūra ir vienāda, minētā sistēma ir līdzsvara stāvoklī un ūdens molekulām haotiskā kustībā ir neierobežoti liels brīvības pakāpju skaits. Stāvoklis radikāli mainās, ja starp plāksnēm rada temperatūras diferenci: AT = — 71. Pie noteiktas Atvērtī­bas ūdens molekulu haotiskā kustība pēkšņi kļūst virzīta, pārejot vienvirziena un vēlāk cirkulārā kustībā starp metāla plāksnēm. Šī tad arī ir fazu pāreja, kuru raksturo t. s. kontroles parametrs a. Apskatītajā piemērā kontroles parametrs a ir temperatūras diference (temperatūras gradients), t. i. a = AT. Fāzu pāreja notiek pie nosacījuma, ka parametrs a sasniedz noteiktu, minēto sistēmu rak­sturojošu vērtību. Tātad kontroles parametrs a raksturo sistēmas makroskopisko uzvedību.

Vēl uzskatāmāks piemērs ir lāzera starojuma ģenerācija gāzes caurulē ([62], 40. att. 90. lpp.). Šajā gadījumā kontroles parametra (x relativitāte saistīta ar strā­vas stiprumu izlādes caurulē. Zem strāvas kritiskās vērtības tās ierosinātie gāzes atomi izstaro haotiski, nesaskaņoti un izlādes caurule funkcionē kā parasta kvēl- lampa. Starojumam piemīt tipisks trokšņa spektrs (40. att. 90. lpp.). Tiklīdz strā­vas stiprums / pārsniedz kritisko kontroles parametra a vērtību, iestājas lāzera

starojuma ģenerācija. Šis starojums ir koherents, ar augstu sakārtotības pakāpi (40. att. 90. lpp.). Visi gā­zes atomi izstaro gaismu saskaņoti, kā diriģenta zižļa vadīts harmonisks ansamblis. Bet kam gan pieder diriģenta loma šādā saskaņotā, koherentā ansamblī?

Sinerģētikā šāda «diriģenta» lomu simbolizē t. s. sakārtotības parametrs (order parameter) Ł,, kas realizē šajā zinātnes nozarē tik nozīmīgo pakļautības principu {slaving principle).

Pakļautības principa īstenošana ar sakārtotības parametra starpniecību vizuāli atainota 41. attēlā. Viens (vai vairāki) sakārtotības parametrs ^ pakļauj («paverdzina») apakšsistēmas, kuras atbilstoši raksturo mainīgie q2 , …, qn> nosakot to koherento saskaņotību. Sinerģētikas teorijā tieši sakārtotības parametri ir noteicošais faktors, kas regulē komplek­su sistēmu makroskopisko uzvedību. Tā, piemēram, tikko aplūkotajā gāzes izlādes caurulē pirms fāzu pārejas, t. i., pirms lāzera starojuma ģenerācijas iestāšanās, mainīgo qn skaits līdzinās atomu skai­tam caurulē, t. i., ar kārtu 1018 cm~3 . Līdzko sis­tēma pārslēdzas uz koherento lāzera starojumu, bezgala daudzo brīvības pakāpju skaits q reducējas uz vienu vienīgo sakārtotības parametru kas nosaka lāzera starojuma dominējošo modu (40. att. 90. lpp.). Citiem vārdiem, sistēmas haotiskais inde- terminētais stāvoklis ir fāzu pārejā izvērties par strikti determinētu, koherentu stāvokli.

Sinerģētikas teorijā pakļautības princips tiek pierādīts kā matemātiska teorēma [62], Te jāuz­sver, ka tas darbojas tikai apstākļos, kad sistēma atrodas ļoti tuvu nestabilitātes punktam.

Loti nozīmīga ir arī kāda cita sinerģētisko sistēmu īpatnība. Izrādās, ka sakārtotības parametra realizē­tais pakļautības princips nebūt nav tikai vienvirziena, kā tas shematiski parādīts 41. attēlā. Pakļautās sistē­mas, ko raksturo mainīgie q]t q?) , ■■■, qn , atgrie­zeniski iedarbojas uz sakārtotības parametru to koriģējot un bieži vien pat ģenerējot. Šī atgrieze­niskā iedarbība uzskatāmi demonstrēta 42. attēlā. Apakšsistēmas nebūt pilnīgi nezaudē savas brīvības

41. att. Sinerģētikas pamat­principi. Zīmējumā shema­tiski parādīts sakārtotības parametra t, realizētais pakļautības («paverdzināša­nas») princips. Viens vai vairāki sakārtotības para­metri pakļauj apakšsis­tēmu qx . q2 , q-ļ,…, qn uzvedību.

qx q2 q5 … q

42. att. Sinerģētikas pamat­principi. Pakļautās apakš­sistēmas q-ļ, q2 , <73,…, qn iedarbojas atpakaļ uz sa­kārtotības parametru ^ (dažkārt pat to ģenerējot). Šādā atpaka|iedarbības shēmā tiek sasniegts con- sensus (consensus findinģ), kas ir pašorganizējošos sistēmu «demokrātijas» pamatā.

pakāpes, nekļūst par paverdzinātām lellēm sakārtotības parametra «rokās». Sinerģētikas terminoloģijā šāda sakārtotības parametra ^ un apakšsistēmu mainīgo parametru qq2 , 1ļ> •••> <Jn > savstarpējā mijiedarbība tika nosaukta par saprašanās nodrošināšanu (consensus findinģ). Ja dominētu tikai pakļautības (slavinģ) princips, sinerģētiskā sistēma būtu strikti determinēta, bez attīstības iespējām. Turpreti tipiskās sinerģētiskās sistēmās veidojas līdzsvars starp pakļautības principu un individuālo komponentu brīvības pakāpēm. Tātad sinerģētiskā sistēmā tās individuālās sastāvdaļas nosaka vai pat ģenerē sakārto­tības parametrus, kas savukārt pakļauj šos individuālos komponentus un regulē sistēmas kooperatīvo uzvedību [62]. Kā atzīst Hākens, pakļaušanas (enslave- ment) tendenci līdzsvaro consensus nodrošināšana, tās ir tipisko sinerģētisko sistēmu medaļas divas — mēs teiktu — komplementārās puses. Tikai šādās sistēmās, kurās nodrošināts noteikts līdzsvars, consensus starp ansambļa kooperatīvās uzvedības likumiem un tā individuālo komponentu «brīvībām», var brīvi realizēties nozīmīgais pašorganizešanāsprincips. Šis princips ir pats sva­rīgākais faktors komplicētu sinerģētisku sistēmu evolūcijā. Par šādām sistēmām visupirms jāuzskata bioloģiskie objekti, dzīvie organismi un to populācijas.

Consensus principā nav grūti saskatīt antropomorfas un socioloģiskas iezīmes [62], Tā demokrātiska sabiedrība var veidoties tikai uz consensus prin­cipa pamatiem, līdzsvaroti saskaņojot indivīda brīvību ar pakļautību valstisko struktūru izstrādātiem likumiem un sabiedrībā pieņemtām uzvedības nor­mām. Ja šis consensus nav nodrošināts, tad veidojas vai nu anarhistiska sabied­rība, vai totalitārs režīms. Arī cilvēka smadzeņu darbības sinerģētisks apraksts, kā parāda Hākens [62], balstās uz smadzeņu individuālo nervu šūnu (to skaits pārsniedz 1011 !) kooperatīvu mijiedarbību, ģenerējot sakārtotības parametrus, kuri tad arī koordinē un veido cilvēka uztveres un domāšanas procesu vie­noto, holistisko dabu. Pats nozīmīgākais — šie sinerģētikas pamatprincipi apstiprina pašorganizējošos, sakārtotu struktūru veidošanās iespējas haotiskās, nesakārtotās sistēmās.

22. LIKTENIS, GADĪJUMS, BRĪVA GRIBA

Dažādās pasaules reliģijas atšķirīgi un palaikam diezgan neskaidri risina šo cilvēkam tik kardinālo jautājumu. Kristiešu Svētajos Rakstos sastopams apgalvojums, ka bez Dieva ziņas cilvēkam ne mats nenokrīt no galvas. Taču Dievs jau pirmajam cilvēkam deva izvēles brīvību — noplūkt vai nenoplūkt augli no Labā un Laur, ā atziņas koka. Viņš gan pavēles formā brīdina: «No visiem dārza kokiem tu vari pēc patikas ēst, bet no Labā un Ļaunā atzīšanas koka tev nebūs ēst, jo tai dienā, kad tu ēdīsi no tā, tu mirdams mirsi.» ([11], I Mozus gr., 2:16,17.)

Bet čūska teica sievai: «Jūs nemirsit vis, bet Dievs zina, ka tanī dienā, kad jūs no tiem ēdīsit, jūsu acis atvērsies un jūs būsit kā Dievs, zinādami, kas labs un kas ļauns.» (I Mozus gr., 3:4,5.)

Sekojot čūskas padomam, Ieva un Ādams ēd augļus no aizliegtā koka un ar šo pirmo izvēles aktu kļūst patiesi brīvi, līdzīgi Dievam. To spiests atzīt arī pats Dievs: «Lūk, cilvēks ir kļuvis kā kāds no mums, zinādams, kas labs un (auns!» (I Mozus gr., 3:22.)

Bet vai tad turpat «Genesis» pirmajā nodaļā netika teikts — «Un Dievs radīja cilvēku pēc sava tēla un līdzības…» (I Mozus gr., 1:27)?

Viena no kristietības pamattēzēm ir cilvēka izvēles brīvība būt taisnam vai grēkor, nožēlot un izpirkt savus grēkus vai arī tikt sodītam. Soda neizbēga- mību un liktenīgo nolemtību visspilgtāk ilustrē dramatiskās un sirdi plosošās ainas Dantes «Dievišķajā komēdijā» — ieeju ellē rotā fatālais uzraksts: «Lasciate ogni speranza, voi ch'entrante (Pamet visas cerības, tu, kas šeit iegājis)!» [30] Dante sadala nabaga grēciniekus pa deviņiem elles lokiem, kuros atbilstoši grēku smagumam viņi tiek dedzināti ugunī, mērcēti mēslos vai mūžīgi iesal­dēti ledū. Dantes skatījumam radniecīga ir Mikelandželo apokaliptiskā glezna «Pastarā tiesa» Siksta kapelā Vatikānā. Kristus kā titānisks soģis nogremdē ellē raudošus un vaimanājošus grēciniekus un pacel debesīs taisnos un svētos. Cilvēka brīvā izvēle viņa īsajā dzīves laikā uz zemes to finālā nolemj mūžīgam Liktenim bez cerībām ko mainīt.

Arī senie grieķi pacēla Likteni augstāk par visu — viņu drāmas meistaru traģēdijas ir Likteņa traģēdijas. Un tā Edipam Liktenis lemj nogalināt tēvu un krist asinsgrēkā ar māti. Bet Edips saceļas pret šo nenovēršamību un, paša gribas vadīts, izdur sev acis un aiziet tuksnesī. Tā ir cilvēka brīvās gribas sacelšanās pret nenovēršamo Likteni. No sengrieķu filozofiem pret fatālismu visnoteiktāk iestājās Epikūrs. Vēstulē Menekejam viņš rakstīja: «Mūsu griba ir autonoma un neatkarīga, un tam mēs varam piekrist vai nepiekrist. Tāpēc, lai saglabātu mūsu brīvību, būtu labāk ticēt dieviem nekā kļūt par ver­giem fiziķiem fatālistiem.., kuri sludina nenovēršamu nepieciešamību.» ([150], 16. lpp.)

Iļja Prigožins grāmatā «Noteiktības gals» («The End of Certainty»), komen­tējot šo citātu, ar apbrīnu izsaucas: «Cik mūsdienīgi tas skan!» [150]

Budistu sūtrās viduslaiku kristietības fiziskā elle ir aizstāta ar paša cilvēka radīto psihisko elli: visās ciešanās ir vainojams vina paša neapgaismotais prāts, kas dzīvi pakļāvis ciešanām aiz skaudības, naida, mantkārības, saldkaisles, viltus ilūzijām un citām paša radītām mocībām. «Vēlēšanās iegūt un bailes pazaudēt dedzina sirdi kā ugunīs.» [186]

Budistu ticība reinkarnācijai, dvēseles atkārtotai atdzimšanai, izslēdz arī mūžīga soda nolemtību. Ja kāds vienas savas dzīves laikā darījis pāri citiem, tad tas viņam tiek atdarīts nākošajā dzīvē. Šādā pāratdzimšanas ķēdē cilvēks pakāpeniski attīrās no visa [aunā, kamēr sasniedz pilnīgu apgaismību, nonākot līdz nirvānas stāvoklim. Šajā dvēseles attīstības un apskaidrotības ceļā sav­starpēji mijiedarbojas Liktenis (karma) un cilvēka brīvā griba.

Kādā no senajām budistu sūtrām var atrast dziļu filozofisku analīzi, kurā iztirzāti kardināli jautājumi, kas skar Likteni, Dieva gribu un nejaušības («Avatamsakasūtra» [186], 45. lpp.): «Daži saka, ka cilvēka dzīvē visu nosaka Liktenis, citi — ka visu ir radījis Dievs un nosaka Viņa griba; trešie apgalvo, ka visu virza gadījumi, kuriem nav noteiktu cēloņu vai nosacījumu. Ja visu nosaka Liktenis, tad gan labie, gan ļaunie darbi ir predestinēti; viss notiek tā, kā tam jānotiek. Šajā gadījumā cilvēka griba un pūles ko izmainīt ir veltīgas un cilvēcei nav nekādu cerību.»

Tas pats attiecas arī uz diviem pārējiem viedokļiem. Ja viss ir nezināmā Dieva rokās, vai noteicošais ir akls gadījums? Uz ko gan var cerēt cilvēks, izņe­mot pakļautību? Nav brīnums ka cilvēki, kas pieņem šos uzskatus, zaudē cerības un atsakās no pūlēm darboties saprātīgi un izvairīties no ļauna.

Faktiski visas trīs minētās koncepcijas ir maldīgas. Viss pasaulē ir parādību secība, kuras īstenais avots ir «cēloņu un nosacījumu uzkrāšanās» (accumulation ofcauses and conditions). Ar patiesu apbrīnu varam secināt: šo seno Austrumu gudro izteiktās domas ir ļoti tuvas mūsdienu dabaszinātņu pamatuzskatiem. Nepieciešamību un nejaušību saspēle, to izraisīto cēloņu un nosacījumu akumulācija ir pasaules daudzveidīgo parādību pamatā!

23. NEPIECIEŠAMĪBAS UN GADĪJUMA KATEGORIJA MŪSDIENU ZINĀTNĒ

Un tā no budistu sūtrām varam atgriezties pie mūsdienu sinerģētikas. Sinerģētikas rokasgrāmatās visbiežāk figurē t. s. vispārinātais Fokera-Planka vienādojums, kas faktiski ietver sevī nepieciešamības un gadījuma komplemen­taritātes pamatideju [61].

Ja šo vienādojumu izmanto kādas daļiņas kustības aprakstam, tad rodas iespēja novērtēt šīs daļiņas viduvētās trajektorijas un ātruma izmaiņas laikā. Vienādojums satur vairākus locekļus, no kuriem daži apraksta determinētu daļiņas kustību laikā un telpā ārējo spēku (elektriskā, magnētiskā, berzes u. c.) ietekmē; tas dod iespēju novērtēt šīs daļiņas trajektorijas un ātruma izmaiņas laikā. Cits loceklis uzskaita t. s. stobastiskā lauka ietekmi, t. i., citu daļiņu hao­tisko termisko svārstību ietekmi. Tādā kārtā Fokera-Planka vienādojums paver iespēju novērtēt daļiņas viduvēto trajektoriju, ko determinē ārējie lauki un statistiskas novirzes no šīs trajektorijas termisko svārstību un difūzijas pro­cesu rezultātā. Fokera-Planka vienādojumam ir daudzi un dažādi specifiski lietojuma un risinājuma veidi, tam veltītas vairākas Špringera izdevniecībā publicētās sinerģētikas sērijas monogrāfijas. Kopš pirmās Hākena grāmatas iznākšanas septiņdesmitajos gados šajā sērijā jau publicētas vairāk nekā 60 monogrāfijas! Nesen iznākusi Hermana Hākena smadzeņu darbības sinerģē- tiskajiem principiem veltītā monogrāfija [62]. Pie šīs intriģējošās grāmatas mēs vēl atgriezīsimies turpmākajā izklāstā. Kaut arī pēc savas būtības Fokera— Planka vienādojums apraksta daļiņu kustību klasiskās fizikas interpretācijas ietvaros (to bieži sauc par kvaziklasisku), ir pierādīts, ka iespējami specifiski vienādojuma risinājumi, kuros ņemti vērā arī kvantu fizikas nosacījumi.

Modernajā fizikā ir arī citas vispārinātas teorijas un modeļi, kas ietver nepieciešamības un gadījuma komplementaritātes principus. Empīriskā pieredze liecina, ka elementārdaļiņu (elektronu, caurumu, eksitonu u. c.) kustība var realizēties divās radikāli atšķirīgās formās: kā koherents, delokalizēts vilnis vai arī kā difundējoša korpuskula (daļiņa). Šo divu kustības formu aprakstam izmantoja atbilstoši viļņu vienādojumus vai difūzijas vienādojumus. Abas pieejas šķita savstarpēji izslēdzošas un daudzus gadu desmitus bija atšķirīgu fizikas skolu strīdus objekts. Vēlāk izrādījās, ka atšķirīgo kustības formu parā­dīšanās un dominance atkarīga no laika un temperatūras. Ļoti īsos laika

intervālos un pie ļoti zemām tempe­ratūrām dominē koherentu, viļņveida kustības forma. Bet, ieilgstot laikam vai pieaugot temperatūrai, notiek vairāk vai mazāk strauja pāreja uz nekoherento — difūzijas tipa kustības formu. Pēdējos gadu desmitos jau radītas vispārinātas daļiņu pārneses teorijas, kas vienotā modelī ietver gan viļņu, gan difūzo daļiņu kustību, kā arī evolūciju pārejā no vienas kustības formas uz otru.

Viena no Šādām teorijām pazīs­tama kā Hākena-Štrobla-Rejnekera modelis. Tā nosaukta autoru — triju vācu fiziķu vārdā. Šī teorija balstās uz statistisko Šrēdingera vienādojuma risinājumu, kurā ņemti vērā stohas- tiskie lauki, daļiņai — vilnim saduro­ties ar citām daļiņām vielā.

Vēl plašāk pazīstama cita teorija, kas atvasināma no t. s. vispārināta­jiem kinētiskajiem vienādojumiem [generalized master equations). Šīs teori­jas izveidošanā daudz darījis indiešu izcelsmes amerikāņu fiziķis Kenkre un čehu fiziķis Čapeks [173J.

Koherento viļņveida daļiņas kustību var aprakstīt ar parciālu diferenciāl­vienādojumu, kas pazīstams kā viļņu vienādojums. Šajā vienādojumā parādās loceklis, kas ir kā otrais atvasinājums pēc laika. Var parādīt, ka daļiņas vidējā kvadrātiskā novirze (Ax)2 no sākotnējā stāvokļa pie t = 0 ir proporcionāla laika kvadrātam.

(Āx)2 ~t*.

P=l/2

43■ att. Fizikālā svārsta paradokss. Svārsts var atrasties stabilā līdzsvara stāvoklī (b), kā arī labilā nelīdzsvara stāvoklī (a). Ja svārstu izvirza no līdzsvara stāvokļa, tas dziestošās svārstībās no jauna atgriežas līdzsvara stāvoklī. So procesu var aprakstīt mehānikas ietvaros, tas ir determinēts. Ja turpretim svārsts nostādīts labilā (a) stā­voklī, tam ir vienlīdz liela iespēja (p ~ 1/2) krist vai nu pa labi, vai pa kreisi. Šīs norises vairs nav determinētas, un tās iespējams aprakstīt tikai ar statistiskās varbūtības likumiem, kas pēc savas dabas ir indeter- ministiski. Šis paradokss uzskatāmi parāda Ņūtona mehānikas ierobežotību.

Šajā sakarībā nevar atšķirt pagātni no nākotnes, jo novirze Ax nav atkarīga no laika t zīmes! Var teikt, ka koherentie viļņveida procesi ir laikā atgriezeniski, var iet no pagātnes uz nākotni vai otrādi. Svarīgākais, ka koherentā kustība ir strikti determinēta un mēs varam precīzi aprakstīt daļiņas kustības «vēsturi», noteikt, no kurienes tā nākusi, un prognozēt, kurp tā aizies. Tēlaini izsa­koties, da|iņai—vilnim piemīt īpašība, ko var nosaukt par «atmiņu» [173]. Tomēr daļiņa, izplatīdamās kā vilnis, nevar izbēgt no termisko svārstību

stohastiskā lauka. Šis iedarbības rezultātā, kura ar laiku summējas, vilnis zaudē savu koherenci, «defāzējas» un daļiņa pakāpeniski pāriet difūzā lēcien­veida kustībā.

Kenkres modeli šo pāreju raksturo ar t. s. atmiņas funkciju. Daļiņas «atmiņa» (0 ar laiku eksponenciāli dziest, t. i., CO — exp [-<**]. Ši dzišana ir jo ātrāka, jo augstāka temperatūra, t. i., jo augstāka vides svārstību intensitāte. (Interesanti, ka arī cilvēku atmiņa dziest līdzīgi — pēc eksponenciāla likuma.) Kad atmiņas funkcija tuvojas nullei {co —> 0), daļiņa ir pilnīgi zaudējusi savu koherenci, mēs varam precīzi noteikt tās atrašanās vietu vidē (piemēram, kristāliskā režģa mezglā), bet absolūti zaudējam iespēju noteikt, no kurienes tā «ielēkusi» šajā režģa mezglā, un prognozēt, kāds būs nākošais lēciens. Šādu daļiņas statistisku lēcienveida kustību sauc par Markova procesu. Tā kustas visas Brauna kustībā iesaistītās daļiņas (81. att. 224. lpp.): sadursme pēc sadur­smes, izkliede pēc izkliedes — visu nosaka vides termisko svārstību stohastika. Da|iņas kustību šādā difūzijas procesā var tēlaini salīdzināt ar piedzērušā strei- puļošanu, kad viņa atmiņa izslēgusies un viņš atduras pret katru šķērsli.

Difundējošās daļiņas kustību laikā var aprakstīt ar parciālu diferenciālvie­nādojumu, kas pazīstams kā dijuzijas vienādojums. Šajā vienādojumā parādās lo­ceklis, kas ir pirmais atvasinājums pēc laika. Šajā gadījumā atšķirībā no viļņveida kustības var parādīt, ka daļiņas vidējā kvadrātiskā novirze (Ax)2 no sākotnējā stā­vokļa ir lineāri proporcionāla laikam t, t. i., (Ax)2 ~ t. Šie procesi ir laikā neatgrie­zeniski\ tajos «laika bulta» vērsta tikai vienā virzienā— no pagātnes uz nākotni.

Dabā lielum lielais vairums procesu ir neatgriezeniski, tādi bez difūzijas ir siltumvadāmība, berze, mehāniskās vai elektriskās enerģijas pārvēršanās sil­tumenerģijā un citi. Tātad sinerģētiskā pieejā determinētās un stohastiskās (gadījuma) parādības nav savstarpēji izslēdzošas, bet viena otru papildinošas dabas daudzveidīgajās norisēs [173]. Te uzskatāmi parādās determinisma un indeterminisma kategoriju savstarpējā komplementaritāte.

Ņūtona mehānikas piekritēji, it īpaši Laplass, uzskatīja, ka dabā viss ir strikti determinēts un nepārprotams. Pēc Laplasa domām, ja zinām ķermeņa sākotnējos nosacījumus — koordinātas un impulsu un spēka lauku, kas uz to iedarbojas —, tad varam līdz vēlamajai precizitātei noteikt tā turpmāko tra- jektoriju un ātrumu līdz pat mūžībai. Pasaule jāuztver kā precīzi funkcionējošs pulksteņa mehānisms. Šī pieeja zināmās robežās ir attaisnojusi sevi tikai debe- Mi mehānikā, aprakstot planētu kustību ap zvaigznēm. Mikropasaulē šiem aprēķiniem nepieciešamie sākuma nosacījumi, t. i., koordinātas un impulss, •..iskaņa ar nenoteiktības relāciju principā nevar tikt vienlaicīgi uzdoti.

Ai i makropasaulē var atrast vienkāršus piemērus, kas pakļaujas nevis deter- ininēiiem mehānikas likumiem, bet gan stohastikai. Kā vienkāršāko piemēru var minči fizikālo svārstu. Tam ir divi īpašstāvokļi: stabils, kad svārsts karājas u/ leju, un labils, kad tas pacelts vertikāli uz augšu un nelīdzsvarots (43. att.).

Ja šo svārstu izvirza no līdzsvara stā­vokļa, tas periodiski dziestošās svār­stībās no jauna atgriezīsies līdzsvara stāvokli. Šo procesu var precīzi ap­rakstīt ar klasiskās mehānikas vienā­dojumiem, un tas ir stingri determi­nēts. Turpretī no labilā stāvokļa svārsts var krist gan pa labi, gan pa kreisi. Kā tas kritīs, to var aprakstīt tikai kā statistisku varbūtību, kas būs tuva 1/2. Svārsta izvirzīšanai no labilā stāvokļa nepieciešama tikai niecīga fluktuācija. Bet fluktuāciju parādīšanās ir stohastiska, to var no­vērtēt tikai ar statistiskām meto­dēm.

Tā jau pašas klasiskās mehānikas klēpi, kā norādījis franču fiziķis Lan- ževēns, atrodam parādības, kas nav apskatāmas pašas klasiskās mehāni­kas ietvaros.

44. att. Zīmējumā parādītā tērauda lodes krišana uz vertikāla asmens šķautnes ilustrē trajektorijas izteikti jutīgo, nelineāro atka­rību 110 sākuma nosacījumiem. Iespējamā lodes trajektorija ir prognozējama tikai sta­tistiski, tā nav cēloniski determinēta.

45- att. Galtona spēļu automāta shema­tisks attēls. Lodītei kritienā atduroties pret nagliņām, tās iespējamā trajektorija nav principā prognozējama. Sāda tipa nelineāras dinamiskās sistēmas ir daudzu spēļu automātu pamatā.

Var minēt vēl citus vienkāršus mehāniskos modeļus, kas ilustrē fizikālo procesu statistisko dabu. Tās ir principā nelineāras dinamis­kas sistēmas, kurām raksturīga aug­sta trajektorijas jutība pret nelielām novirzēm sākuma nosacījumos. Šā­dās sistēmās principā nav iespējams prognozēt trajektorijas tālāko vir­zību. Piemēram var minēt 44. attēlā (100. lpp.) parādīto metāla lodes kri­šanu uz vertikāla asmens šķautnes. Vismazākās lodes trajektorijas novir­zes, tai atsitoties uz asmens šķaut­nes, var lodi neprognozējami novir­zīt gan pa kreisi, gan pa labi. Šādu neprognozējamu lodītes trajektoriju visuzskatāmāk raksturo angļu zinātnieka, biostatistikas iedibinātāja Frānsisa Galtona vārdā nosauktā spē|u automāta shematisks modelis (45. att.). Tieši

lodītes neprognozējamās trajektorijas nosaka spēļu automātu statistisko dabu. 44. un 45. attēlā parādītie modeļi ir visvienkāršākās nelineārās dinamiskās makrosistēmas.

Lai gan aprakstītās nelineārās parādības bija labi pazīstamas jau 19. gad­simtā, t. i., pirms kvantu mehānikas un sinerģētikas rašanās, tomēr klasiskās fizikas ņūtoniskā determinisma piekritēji stūrgalvīgi turējās pie vecās, savu laiku jau pārdzīvojušās lineārās paradigmas. Tā bija tipiska inertā, dogmatiskā vienīgās patiesības aizstāvju domāšana.

24. INTELEKTUĀLIE MODELI,

DOMU EKSPERIMENTI UN TIEŠĀ PIEREDZE

Kā daudzos līdzīgos gadījumos, klasiskās paradigmas aizstāvji nevēlējās saskatīt šos «izņēmumus», uzskatot tos par kuriozu, par kuru nav pieklājīgi runāt. Arī pirmais Ņūtona likums, ko labi atceramies no skolas fizikas kursa, — katrs ķermenis paliek mierā vai kustas vienmērīgi un pa taisni, ja vien kādi spēki tam neliek izmainīt savu stāvokli, — ir vairāk nekā divdomīgs. Pieredzē mēs sastopamies ar pretējo. Iešūpots svārsts apstājas, bumba, ripojot pa zāli, nobremzējas, izmests šķēps noliecas pa ballistisku līniju uz zemi un tā jopro­jām. Pirmais Ņūtona likums izrādās esam idealizēts, abstrahēta prāta kon­struēts, iedomāts eksperiments. Atbilstoši pieredzei Ņūtona likumu varbūt vajadzētu formulēt šādi: gandrīz neviens ķermenis reālā pasaulē nekustas vien­mērīgi un pa taisni, jo vienmēr atrodas spēki, kas šo stāvokli izmaina.

Par heliocentriskās kosmoloģijas nesaskaņu ar Aristoteļa patiesības definī­ciju (patiesība nozīmē intelekta atbilstību realitātei) mēs jau runājām trešajā esejā. Kā norāda Martins Heidegers, Kopernika un Keplera postulētais helio- centrisms faktiski ignorēja empīrisko pieredzi [67, 126]. Būtībā šie zinātnieki lika pamatus vēlākajai Ņūtona fizikai un kosmoloģijai, kas balstījās uz prāta izveidotiem intelektuāliem modeļiem, bet nevis uz tiešo pieredzi [126],

Ņūtona dinamikas pirmo (inerces) likumu faktiski jau bija formulējis Galilejs savā 1638. gadā publicētajā darbā «Diskurss par divām jaunām zināt­nēm». Tajā teikts: «Es iedomājos savā prātā ķermeni, kas novietots uz hori­zontālas (līdzenas) virsmas, un katrs šķērslis ir novākts… Ķermeņa kustība uz šīs virsmas būs vienveidīga un nepārtraukta ar nosacījumu, ka virsma izplešas bezgalīgi.» ([126], 47. lpp.) Tas būtībā bija Ņūtona pirmā likuma formu­lējums un fizikā tik nozīmīgā inerces principa atklājums.

Šodien šis princips šķiet pašsaprotams, bet pirms Galileja un Ņūtona tas nebija pazīstams un būtu ticis uzskatīts par nenozīmīgu vai pat bezjēdzīgu, jo to nevarēja novērot tiešā pieredzē. Zīmīgi, ka Galileja formulējums sākas ar vārdiem «mente concipi», t. i., «es iedomājos savā prātā».

Kā apgalvoja Aristotelis (un tam bija pamats empīriskos novērojumos), smagi ķermeņi saskaņā ar savu dabu krīt uz leju, bet vieglie ķermeņi ceļas augšup. Tātad, jo smagāks ķermenis, jo ātrāk tas kritīs.

iii i

Diametrāli pretēju uzskatu mazliet vēlāk paudis romiešu dzejnieks un filozofs Lukrēcijs (to viņš, visticamāk, pārmantojis no Aristoteļa laikabiedra Epikūra). Proti, balstoties uz tīriem prāta apsvērumiem, viņš secina, ka tukšumā (vakuumā) visiem ķermeņiem jākrīt ar vienādu ātrumu. Bet dažāda smaguma ķermeņi gaisā vai ūdenī kritīs ar dažādu ātrumu sastaptās pretestības dēļ, kuru smagie ķermeņi pārvar vieglāk. So savam laikam ģeniālo domu Lukrēcijs pauž poētiskās vārsmās [39, 107]:

Tāpēc, ka visam, kas krīt vai nu ūdenim cauri vai gaisam, Vajag tam kritiena ātrumu iegūt, atbilstot svaram; Nespēj taču ūdens, ne gaisa būtība smalkā Ķermenim vienādā mērā kavēkļus kustībā radīt, Drīzāk gan piešķir smagākam priekšmetam brīvāku ceļu. Taču, par tukšumu runājot, nespēj tas vietā nekādā Ķermenim apakšā atrasties, kā tas it viegli ir redzams, Tāpēc, ka daba tam tāda, lai visam kam pašķirtu ceļu; Tāpēc, lūk, ķermeņiem visiem, kas mierīgā tukšumā kustas, Jāvirzās vienādiem ātrumiem, pat ja tiem dažādi svari.

([39], 11.-12. lpp.)

Aristoteļa paustais maldīgais viedoklis, ka smagākie priekšmeti principā krīt ātrāk par vieglākajiem, pateicoties viņa autoritātei, valdīja daudzus gad­simtus — līdz pat Galilejam. Arī Galilejs, balstoties tikai uz prāta slēdzieniem, nonāca pie apriori secinājuma, ka visiem ķermeņiem jākrīt vienādā ātrumā. Ir nostāsts par publisku eksperimentu, ko Galilejs izdarījis no Pizas greizā torņa. Pretēji Galileja iepriekšpieņemtajam postulātam priekšmeti ar atšķirīgām masām brīvā kritienā nenonāca līdz zemei vienlaicīgi. Balstoties uz mūsdienu zināšanām, tam tā arī bija jābūt. Tikai vakuumā ķermeņi ar atšķirīgām masām krīt ar vienādu ātrumu. Bet no Pizas torņa krītošiem ķermeņiem būs dažāda gaisa pretestība, tāpēc sagaidāms, ka smagie ķermeņi kritīs ātrāk.

Tātad Epikūra un Lukrēcija doma, kā rāda citētās vārsmas, bija dziļāka, jo viņi paredzēja, ka gaisā smagākie ķermeņi kritīs ātrāk nekā vieglākie. Ja Galilejs būtu lasījis Lukrēcija darbu «Par lietu dabu», viņš diezin vai būtu uzsā­cis kuriozo Pizas torņa eksperimentu!

Ignorējot «ietiepīgos faktus», Galilejs tomēr neatkāpās no saviem uzska­tiem. Viņa oponenti izskaidroja eksperimenta iznākumu par labu Aristoteļa teorijai, un opozīcija pret Galileju pieauga tik tālu, ka viņam nācās atstāt darbu universitātē un aizbraukt no Pizas ([126], 46. lpp.).

Heidegers uzsver, ka Galilejs un viņa pretinieki redzējuši vienus un tos pašus faktus, bet viņi tos interpretējuši atšķirīgi. Galilejs faktiski balstījās uz ii priori prāta slēdzienu, ka visu ķermeņu kustībai jābūt vienveidīgai [126]. Vēlāk daudzās fizikas grāmatās tiek nepamatoti apgalvots, ka Pizas torņa eksperiments apstiprināja Galileja teoriju! Uz šādām leģendām balstās daudzi stereotipi apgalvojumi.

Atšķirībā no Kopernika un Keplera Galileja liktenis bija patiešām traģisks. Viņš nepiekāpās pretiniekiem Pizas torņa eksperimenta interpretācijā un zau­dēja vietu universitātē. Bet mūža beigās viņš bija spiests inkvizīcijas tiesas priekšā atteikties no aizstāvētās «ķecerīgās» idejas par heliocentrisko pasaules uzbūvi.

Fizikas mācību grāmatās līdzīgas «dogmas» sastopamas arī par Einšteina rela­tivitātes teoriju. Parasti tiek apgalvots, ka Einšteins speciālo relativitātes teoriju izstrādājis, balstoties uz Maikelsona un Morlija eksperimenta rezultātiem par gaismas konstanto ātrumu. Kā stāsta amerikāņu fiziķis Daisons, Einšteins sarunā ar viņu apgalvojis, ka pie slēdziena par gaismas konstanto ātrumu viņš nonācis neatkarīgi no Maikelsona un Morlija eksperimenta un bijis priecīgs, ka viņa apriori postulētais slēdziens tiek apstiprināts eksperimentāli.

Kā izrādījās, Maikelsona un Morlija 1878.-1882. gadā veiktie eksperimenti, kas apliecināja gaismas konstanto ātrumu, nebūt nebija tik pārliecinoši. Tos kritizēja daudzi fiziķi, un tāpēc Maikelsonam un Morlijam vajadzēja eksperi­mentus atkārtot pat pēc vairāk nekā četrdesmit gadiem (1924.—1926. g.).

Tikai vēlāk, fizikas mācību grāmatās, Maikelsona un Morlija eksperiments tika retrospektīvi «uzkonstruēts» kā izšķirošais pierādījums relativitātes teori­jas pareizībai. Būtībā varam piekrist Daisonam, ka Einšteinu pārliecināja nevis eksperimenta rezultāti (kuriem daudzi tā arī neticēja), bet gan viņa ģeniāli intuitīvais iekšējais skatījums («insight»), postulējot gaismas ātrumu c kā universālu kosmisku konstanti. Kā norāda Deivids Mermins [119], relati­vitātes teorijas patiesuma apstiprinājumam nozīmīgi bija nevis mazpārlieci- nošie Maikelsona un Morlija mērījumi, bet gan relatīvistiskās kvantu mehāni­kas un kvantu elektrodinamikas izveidošana — tās korekti aprakstīja daudzus citus eksperimentālus faktus.

Arī citā kontekstā, kad slavenā astrofizika Edingtona ekspedīcija 1919. gadā novēroja gaismas stara noliekšanos Saules aptumsuma laikā, kas apstiprināja Einšteina 1915. gadā formulēto vispārīgo relativitātes teoriju par liekto telpu ap masīviem debesu ķermeņiem, Einšteins komentēja, ka šis novērojums viņu nepārsteidzot, jo citādi tas nemaz nevarētu būt!

Šai sakarībā jāpiebilst, ka Bora un Einšteina tagad jau leģendārajās diskusi­jās par nenoteiktības relāciju un kvantu mehānikas statistiskajiem principiem «domu eksperimenti» tika izmantoti nepārtraukti [201]. Tas vēlreiz apliecina Heidegera uzskatu, ka modernā zinātne pamatā balstās uz intelektuāliem modeļiem un aksiomātiskiem postulātiem, bet nevis uz ikdienas empīrisko pieredzi. Tas vienlaicīgi ir zinātnes triumfs un varbūt arī traģēdija, jo šī pieeja arvien vairāk attālina zinātni no vienkāršā cilvēka pasaules uztveres un izprat­nes un izraisa psihiski pamatotu atsvešināšanos no zinātnes un zināšanām vai pat naidīgumu pret tām.

25. DAUDZDAĻIŅU ANSAMBĻI- ENTROPIJA KĀ STATISTISKS HAOSA MĒRS

Stohastisko (gadījuma) spēku lomu sarežģītākos dabas procesos jau bija tēlaini iezīmējis romiešu dzejnieks un fdozofs Tits Lukrēcijs Kārs. Savā mūža darbā «Par lietu dabu» [107] viņš dzejiski apraksta grieķu filozofa atomista Epikūra domas par nejaušu noviržu lomu dabas procesos [39].

Daļiņas, kad tās uz leju taisni pa tukšumu virzās, Pašu smaguma dzītas, kaut kādā nejaušā vietā, Kaut kādā nejaušā brīdī nedaudz tās novirzās sānis, Tā, ka tik tikko par novirzi kustību šo varam nosaukt. Taču, ja taisni tie kristu, kā lietus pil smagajām lāsēm, Neklīstot nost no virziena, vērstā tieši uz leju, Nerastos sadursmes tad, ne triecieni daļiņu starpā, Nespētu daba nekad tad izveidot kaut ko no jauna.

([107], 51. lpp.)

Šī Lukrēcija paustā Epikūra koncepcija apstiprinājumu guvusi tikai mūs­dienu fizikā. To vidū, kuri asi kritizēja Epikūra atkāpšanos no kauzalitātes prin­cipa, bija arī Cicerons, kam piedēvēti vārdi «nevar lielāka kauna lieta gadīties fiziķim» [39]- Turpretim no mūsdienu fizikas viedokļa Epikūra un Lukrēcija koncepcija par nejaušību lomu dabas procesos būtu jāuzskata par vienu no ģeniālākajiem antīkās pasaules intuitīvajiem atklājumiem dabas filozofijā.

Iļja Prigožins nesen iznākušajā grāmatā «Noteiktības gals» {«The End of Certainty», [150]) raksta, ka Epikūra izvirzītā un Lukrēcija poētiski apdziedātā dilemma tika aizmirsta un Eiropas zinātne, determinisma apmāta, vairākus gadsimtus pilnīgi ignorēja gadījuma procesu klātbūtni un ar to saistītās attīstību virzošās haotiskās parādības dabas norisēs.

Kā jau minējām, Ņūtona mehānikas ierobežotību visspilgtāk saskatīja franču matemātiķis, fiziķis un filozofs Anrī Puankarē. Risinot triju ķermeņu kustības dinamikas problēmas, viņš pietuvojās haosa teorijas pamatievirzēm un k[uva par vienu no statistiskās fizikas pamatu izveidotājiem. Puankarē konstatēja, ka planētas kustības trajektorija starp divām zvaigznēm ir nevis deterministiska, bet haotiska (101. att. 253. lpp.). Ar to viņš nepārprotami parādīja, ka sarežģītās

makrosistēmās Ņūtona determinisms nav spēkā. (Puankarē atklājums jāierindo zinātnes vēstures kuriozos. Tajā laikā Zviedrijas karalis bija izsludinājis lielu naudas balvu zinātniekam, kas pirmais atrisinās šo tā saukto triju ķermeņu prob­lēmu, t. i., pa kādu trajektoriju kustas planēta starp divām zvaigznēm. Sev par lielu pārsteigumu, Puankarē atklāja, ka šajā gadījumā planētas trajektorija prin­cipā nav aprakstāma deterministiskas teorijas ietvaros. Šī trajektorija izrādījās neprognozējama, pilnīgi haotiska (101. att. 253. lpp.). Kaut gan Puankarē bija pierādījis tieši pretējo tam, par ko bija izsludināta minētā prēmija, viņš balvu tomēr saņēma. To viņš bija pelnījis kā jaunas paradigmas atklājējs.)

Tā Puankarē līdz ar Einšteinu un Planku kļuva par jauno 20. gs. paradigmu pamatlicēju. Turklāt viņš vienlaikus ar Einšteinu 1904. gadā darbā «Par elek­trona dinamiku» neatkarīgi formulēja speciālās relativitātes teorijas pamat­postulātus.

Pasaules fizikālo ainu radikāli izmainīja 19. gs. atklājumi gāzu kinētiskajā teorijā un molekulārajā fizikā. Zinātniekiem pirmo reizi bija jāsaskaras ar daudzdaliņu ansambļiem un neparastām parādībām tajos. Pārsteidzošs bija daļiņu — atomu un molekulu — skaits šajās sistēmās. Tā viena grammolekula gāzes, piemēram, 02 , izrādījās, satur 6 x 1023 daļiņas! (Šo skaitli nosauca tā atklājēja vārdā par Avogadro skaitli.) Šādās sistēmās nevarēja būt runa par iespēju noteikt atsevišķas daļiņas uzvedību — tās trajektoriju un ātrumu (impulsu). Varēja runāt tikai par tādu lielumu kā gāzes spiediens, temperatūra u. c. statistiski vidējāmvērtībām. Šo pētījumu rezultātā izveidojās jaunas fizikas nozares — termodinamika un pēc tam statistiskā fizika.

Aprakstot šīs sistēmas analītiski, atklājās jauna, neparasta termodinamiska funkcija, kuru nosauca par entropiju S. Šīs funkcijas raksturīgākā iezīme ir tā, ka termodinamiskos procesos tai parādās tendence pieaugt (AS> 0). Šo virzīto tendenci pirmsākumā formulēja kā likumu, un tā pazīstama kā otrais termo­dinamikas princips, kas apgalvo, ka noslēgtās termodinamiskās sistēmās entropija vienmēr pieaug (vai — izņēmuma kārtā — paliek konstanta).

Sākotnēji bija grūti izprast šīs formāli ieviestās termodinamiskās funkcijas fizikālo jēgu un racionālo saturu. Mazliet vēlāk austriešu fiziķis Ludvigs Bolc- mans, meklējot saikni starp klasisko termodinamiku, kas operēja galvenokārt ar vidējiem makroskopiskiem likumiem (spiedienu, tilpumu, temperatūru), un statistisko fiziku, kas ņēma vērā arī sistēmas mikroskopiskos aspektus, t. i., ka tā sastāv no miljardiem daļiņu, parādīja, ka entropijas pieaugumu ASvar interpretēt statistiski kā apskatāmās sistēmas pāreju no mazāk varbūtīga stā­vokļa Wj uz vairāk varbūtīgu stāvokli

A S = klnW2 /Wh (6)

Interesanti, ka entropijas pieaugums ASir proporcionāls logaritmam no šo varbūtību attiecības, reizinātam ar Bolcmana vārdā nosaukto konstanti k (k = 1,38 x 10~18 ergi uz grādu). Turklāt jāuzsver, ka konstante k raksturo atsevišķas daļiņas īpašības, nevis visu sistēmu kopumā (tā lielums 3/2 kT raksturo atsevišķas daļiņas vidējo kinētisko enerģiju; k ir svarīgākā universālā konstante mikrodaļiņu statistiskajā fizikā). Saskaņā ar formulas (6) dziļāko jēgu katra sistēma cenšas pāriet no mazāk varbūtīga stāvokļa uz varbūtīgāku, mazāk sarežģītu vai vispārīgi — no komplicētākas struktūras uz mazāk kompli­cētu, galarezultātā sasniedzot daļiņu vienmērīgu sadalījumu pa visu pieejamo tilpumu. Citiem vārdiem, jebkura sarežģīta struktūra entropijas pieauguma rezultātā neizbēgami tuvojas un beidzot sasniedz pilnīgi haotisku stāvokli, kas ir visvarbūtīgākais. Sajā procesā, piemēram, augstvērtīgākās enerģijas formas, kā mehāniskā vai elektriskā enerģija, pāriet viszemākajā — siltuma enerģijā, kuru tikai ar lieliem zudumiem var transformēt atpakaļ uz augstākām enerģijas formām. Svarīgākais vispārinājums Bolcmana teorijā bija secinājums, ka, ja entropijas pieaugums ir strikts likums, tad pasaules evolūcijai jābeidzas ar t. s. siltuma nāvi — pāreju uz visvarbūtīgāko Visuma stāvokli, t. i., uz kosmisko haosa stāvokli. Šīs statistiskās fizikas konsekvences bija dramatiski vēl apoka­liptiskākas nekā Mikelandželo «Pastarā tiesa».

Kaut arī Bolcmana entropijas pieauguma statistiskā interpretācija pavēra iespējas apiet «fatālo» Visuma siltuma nāves neizbēgamību, daudzie konser­vatīvo deterministiskā, mehānistiskā pasaules uzskata piekritēju asie uzbru­kumi noveda Bolcmanu līdz pašnāvībai. Tas notika 1906. gadā, kad jau iezī­mējās triumfālais 20. gs. paradigmas uzvaras gājiens.

Laikam neviena jauna paradigma neiekaro atzīšanu bez upuriem un mocek­ļiem. Kopernika heliocentriskās paradigmas aizstāvjus šaustīja «vienīgās svētās patiesības» apoloģēti — katoliskās inkvizīcijas tiesneši. Džordāno Bruno dzīvi beidza uz sārta, Galileo Galileju pazemoja un salauza psihiski. Jana Husa nāve uz sārta ir apliecinājums, cik bīstami bija sludināt atšķirīgu, nekonvencionālu paradigmu teoloģijā.

Ludvigu Bolcmanu gan vairs nevarēja sadedzināt uz sārta, taču to aizstāja līdzīgu «vienas vienīgās patiesības» fanātisko aizstāvju psihiskā šantāža. Arī Einšteinu neslēptā antisemītisma aizsegā vajāja gan konservatīvie Vācijas vecās paaudzes fiziķi, gan jaunās paaudzes nacisti. Šai kontekstā atcerēsimies arī Andreja Saharova likteni. Tie ir tikai daži pāmācoši piemēri, kāds liktenis var piemeklēt Lielo Patiesību meklētājus.

Pēc šā īsā ekskursa vēsturē atgriezīsimies pie entropijas «likteņiem». Kas tikai netika izdomāts, lai apietu entropijas pieauguma likumu! Tā, ja savieno divus traukus, kas satur dažādas gāzes, ar caurulīti, pēc samērā neilga laika gāzes vienmērīgi sajaucas. Bet, ja pie šīs caurulītes nosēdinātu dēmonu (ko nosauca par Maksvela dēmonu), kas ar aizvaru kontrolētu molekulu kustību un atļautu tām tikai «vienvirziena ceļu», tad tāda sajaukšanās varētu tikt novērsta. Tomēr precīzāka analīze parādīja, ka šā domu eksperimenta shēma ir fizikāli tikpat neiespējama kā perpetuum mobile (mūžīgais dzinējs), kura izveidošanu aizliedz gan pirmais — enerģijas nezūdamības likums, gan otrais — entropijas pieauguma likums. Klasiskās termodinamikas ietvaros «laika bulta» šķietami darbojas tikai vienā virzienā — no sarežģītākajām formām un struk­tūrām uz homogēnu haosu.

Ir vēl kāds ārkārtīgi nozīmīgs entropijas pieauguma likuma darbības aspekts. Ja mēs lokāli kādā vietā gribam kaut ko sakārtot, veidot jaunas struktū­ras — kaut ko celt, pārkārtot —, tad šīs lokālās sakārtotības pieaugums ir iespējams tikai uz entropijas pieauguma rēķina, t. i., uz haosa palielināšanas rēķina apkārtējā vidē. Šo globālo likumsakarību ģeniālā vispārinājumā atvei­dojis mums jau pazīstamais holandiešu grafiķis Eshers zīmējumā ar dziļi filo­zofisku nosaukumu «Kārtība un haoss» («Order and Chaos», 46. att. 2. piel.). Šis zīmējums pat neprasa īpašus komentārus. Lai izveidotu lielisko, regulāro augstas sakārtotības pakāpes objektu zīmējuma centrā, tiek nežēlīgi pie­sārņota apkārtējā vide ar visādām neiedomājamām drazām, lauskām un citiem atkritumiem. Šis patiesi ģeniālais zīmējums vizuāli atspoguļo pasaules entropijas pieauguma tendences vispārinājumu. Redzam, cik cieši globālais entropijas pieauguma likums saistīts ar ekoloģiskajām problēmām. Maldīgā idejiskā pārliecībā, ka tikai tehnikas progress un dabas pārveidošana un pakļaušana var nodrošināt cilvēces laimi, bezatbildīgi politiķi un tehnokrāti gan Rietumu zemēs, gan it īpaši bijušajās totalitārajās sociālistiskajās valstīs, dzenoties pēc iedomāta «progresa» elka, ir totāli piesārņojuši gaisu, ūdeņus un augsni, novezdami planētu Zemi līdz ekoloģiskai katastrofai. Par šīs situā­cijas izveidošanos liela dala vainas būtu jāuzņemas «mūžīgā» progresa ideolo­giem, kas, aizrāvušies ar šo savu «vienīgo objektīvo patiesību», aizmirsa, ka katrs progress ir cieši saistīts ar tā pretmetu — regresu, katra sakārtotība — ar to pavadošo haosu.

Cilvēkam nav jācenšas pārveidot vai pakļaut Dabu, bet jāsadzīvo ar to saprātīgā simbiozē, ievērojot tās likumus. Diemžēl daudzi tehnokrāti un it īpaši politiķi nesaprata vai ignorēja vienu no būtiskākajiem Dabas likumiem — entropijas pieauguma likumu, kas nosaka līdzsvaru starp sakārtotību un haosu. Par šā principiālā likuma neievērošanu, kas Pasauli novedusi pie smagas ekolo­ģiskas krīzes, būs dārgi jāsamaksā gan mums, gan nākošajām paaudzēm.

26. BIOLOĢISKĀ EVOLŪCIJA «UZSPRIDZINA» KLASISKO TERMODINAMIKU

Tomēr šie termodinamikas secinājumi bija acīmredzamā pretrunā ar Zemes ķīmiskās un bioloģiskās evolūcijas gaitu. Mēs esam liecinieki tam, ka dabā nepārtraukti no vienkāršām molekulām veidojas sarežģītākas, no vien­kāršākām dzīvības formām — komplicētākas. Visa bioevolūcijas gaita ir nepārtraukts izaicinājums otrajam termodinamikas likumam! Jautājums, vai ir kāds pamats to saukt par likumu, ja tas nedarbojas gandrīz visās biosfē- ras jomās.

Klasiskās termodinamikas ietvaros principā nevar izskaidrot ne dzīvības rašanos uz Zemes, ne arī dzīvo formu — pat elementārāko vienšūnu mikroor­ganismu — eksistenci un funkcionēšanu. Tā spēj izskaidrot tikai organismu nāvi un sairšanu pirmelementos. Šīs pretrunas atrisināšanai bija jāmeklē jauna paradigma, principiāli jauna pieeja, «izlecot» no klasiskās termodinamikas shēmām. Atkāpšanos no entropijas pieauguma «likuma» zinātnieki arvien biežāk fiksēja arī nedzīvajā dabā.

Vistuvāk ideālam haosa stāvoklim ir gāze noslēgtā tilpumā, piemēram, saspiestais gaiss basketbola bumbā. Tur molekulas haotiski kustas visos iespē­jamos virzienos, to brīvības pakāpju skaits ir maksimāls, un rezultātā spiediens bumbas iekšienē ir vienāds visos virzienos. Teorētiski var mēģināt novērtēt varbūtību, ka molekulas bumbas iekšienē pēkšņi sāk kustēties vienā virzienā, teiksim, virzienā uz augšu, un bumba ne no šā, ne no tā pati palecas. Neviens gan šādu parādību nav novērojis. Un nav nekāds brīnums, jo varbūtība ir tik maza, ka tā varētu realizēties labi ja reizi miljardos gadu.

Jāņem vērā, ka klasiskās termodinamikas pamatvienādojumi ir iegūti sistēmās, kas ir stabila līdzsvara stāvoklī vai tuvu tam. Situācija radikāli mainās sistēmās, kas ir stipri izvirzītas no līdzsvara stāvokļa. Tas notiek apstākļos, kad sistēma tiek pakļauta lieliem temperatūras, elektriskā, magnētiskā vai kāda cita lauka gradientiem. Atgriezīsimies vēlreiz pie iepriekš aplūkotā piemēra par plānu ūdens slānīti, kas ievietots starp divām metāla plāksnēm. Ja starp šīm plāksnēm rada temperatūras starpību A T = 7"2 - 71, t. i., temperatūras gra- dientu, tad pie noteiktas šā gradienta ATkritiskās vērtības haotiskā ūdens molekulu kustība pārvēršas virzītā kustībā starp plāksnēm. Citiem vārdiem, krasi samazinās ūdens molekulu brīvības pakāpe, un tās iegūst impulsu kustībai noteiktā virzienā. Rezultātā sistēmas entropija nevis pieaug, bet samazinās. Mēs esam realizējuši pāreju no haotiskas molekulu kustības uz virzītu, «strukturētu» kustību. Līdzīgu efektu ir novērojusi ikviena mājsaim­niece, vārot pienu: pie noteikta temperatūras gradienta visas šķidruma mole­kulas pāriet no haotiskas kustības uz virzītu — uz augšu un pāri katliņa malām!

Analogu procesu novēro pie lāzera starojuma ģenerācijas, kuru jau minējām kā pirmo piemēru sinerģētikas kā zinātnes tapšanas gaitā (40. att. 90. lpp.). Tur, kā redzējām, kritisks ir elektriskās strāvas lielums, kas plūst caur gāzu izlādes cauruli. Šajā kritiskajā elektriskajā laukā atomu haotiskā kustība pāriet sinhronās svārstībās, kuru rezultātā iegūstam koherentu gaismas starojumu. Cits piemērs — feromagnētiku magnetizēšanās, kurā molekulu elektronu spini orientējas noteiktā ārējā magnētiskā lauka virzienā, kā arī organisko molekulu orientēšanās šķidro kristālu indikatoros elektrostatiskā laukā.

Sinerģētikas literatūrā aprakstīti daudzi visdažādāko telpā un laikā mainīgu struktūru veidošanās procesu piemēri. Arī specifiskās ķīmiskās reakcijās vien­kāršas difūzijas vietā var veidoties sarežģītas periodiskas struktūras.

Visspilgtāk jaunu struktūru veidošanās izpaužas bioloģiskajos procesos. Jebkurš dzīvs organisms no mikroba līdz cilvēkam spēj no biopolimēru «ķieģe­līšiem» — aminoskābēm un nukleotīdiem — sintezēt sarežģītas proteīnu un nukleīnskābju makromolekulas. Augu zaļo lapu hloroplastos, izmantojot Sau­les enerģiju, ar augstu efektivitāti no visvienkāršākajiem savienojumiem — ūdens un ogļskābās gāzes (C02 ) — tiek sintezētas cukuru, cietes, celoluzes un citas par izejvielām daudz komplicētākas molekulas. Un paša dzīvības pamat­elementa — šūnas un tās komponentu (dažādu organellu: mitohondriju, ribo- somu, hloroplastu u. c.) — veidošanās un funkcijas ir nepārtraukta cīņa pret entropijas pieaugumu, to var nosaukt par struktūru veidošanos haotiskā vidē.

Zemes ķīmiskās un bioloģiskās evolūcijas scenāriju sīkāk aplūkosim 40. esejā.

27. NELĪDZSVAROTO SISTĒMU TERMODINAMIKA.

PRIGOŽINS UN BRISELES SKOLA

Visi šie strukturēšanās procesi notiek termodinamiski atklātās, nelīdz­svarotās sistēmās, kuru nelīdzsvaroto stāvokli rada un uztur kādi ārēji enerģijas avoti. Ar šādu sistēmu pētīšanu nodarbojas visjaunākā termodinamikas nozare, ko parasti atšķirībā no klasiskās termodinamikas sauc par nelīdzsvarotu sistēmu termodinamiku. Kā jaunu zinātnes nozari to pamatā izveidojis beļģu fiziķis lija Prigožins un viņa iedibinātā Briseles skola. Šīs jaunās zinātnes radīšana jau 1977. gadā atnesa Prigožinam Nobela balvu.

Prigožins apraksta t. s. disipatīvās sistēmas, kurās pretēji globālajai entropijas pieauguma tendencei (bet nevis likumam) notiek entropijas samazināšanās. Šī arī ir viena no mūsu gadsimta jaunajām paradigmām. Tās pamatā ir koncepcija par struktūru veidošanos haosā. Tieši šādu trāpīgu nosaukumu Prigožins kopā ar savu līdzstrādnieci franču filozofi Izabellu Stendžersu devis populārajai grāmatai — «Order out of Chaos» ([152], ari [151]). Tajā izklāstīti jaunās termodinamikas pamati. Prigožina nelīdzsvaroto procesu termodinamikai tuvu radniecīga (varam teikt — komplementāra) ir sinerģētika. Tā pēta šos procesus nedaudz citā aspektā, akcentējot galvenokārt daļiņu kooperatīvo mijiedarbību daudz- da|iņu sistēmās un nosacījumus, pie kuriem veidojas koherenta šo daļiņu «uz­vedība» (piemēram, lāzera starojuma ģeneratoros vai bioloģiskajā morfoģenēzē).

Jāuzsver, ka nelīdzsvarotās sistēmās procesi parasti ir izteikti nelineāri. Lai to paskaidrotu, vēlreiz atgriezīsimies pie vienkāršā piemēra — fizikālā svārsta (43. att. 98. lpp.). Svārsta izvirzīšanai no līdzsvara stāvokļa nepieciešams spēks. Spēka/lielums atkarīgs no svārsta masas m. Šo atkarību vispārīgi apraksta otrais Ņūtona likums, kas līdzīgi visiem svarīgākajiem dabas likumiem — salīdzinām formulas (1-6) — ir aprakstāms ar ļoti vienkāršu izteiksmi:

/= am. (7)

Jo lielāka svārsta masa, jo lielāks spēks nepieciešams tā izvirzīšanai no līdz­svara stāvokļa. Ņūtona formula raksturo lineāru sakarību starp spēku un masu. Ja izvirzītam svārstam (aujam brīvi atgriezties līdzsvara stāvokli, tas to izdarīs dziestošu periodisku svārstību veidā. Šie procesi ir stingri determinēti un analītiski aprakstāmi.

Radikāli atšķirīga ir situācija, kad svārsts atrodas labilā, t. i., nelīdzsvarotā stāvoklī uz augšu no atbalsta punkta. Šajā gadījumā nepieciešama loti niecīga iedarbība, neliela plūstošā gaisa fluktuācija, un svārsts kritīs vai nu pa kreisi, vai pa labi uz savu līdzsvara stāvokli. Tas ir tipiski nelineārs process, kas ab­solūti neseko otrajam Ņūtona likumam (7). Ar pavisam niecīgu spēku mēs varam iekustināt lielu masu. Bez nelinearitātes iim procesam, kā jau minējām, ir arī izteikti stohastisks raksturs. Ar līdzīgu varbūtību (W~ 1/2) svārsts var krist gan pa kreisi, gan pa labi. Šo abu īpašību — nelinearitātes un stohas- tiskuma — pēc aplūkotais process nav determinēts, to nevar aprakstīt ar deterministiskiem dinamiskiem likumiem, un šāda procesa virzība var tikt prognozēta tikai varbūtības teorijas ietvaros.

Dabā šādas situācijas, kad savijas determinētās un stohastiskās norises, ir ievērojamā vairākumā. Var apgalvot, ka jebkurā komplicētā sistēmā saspēlējas abas šīs komplementārās norišu formas.

28. TAURIŅA EFEKTS. LAVĪNAS, ORKĀNI,

ATOMBUMBA

īpaši liela loma stohastiskiem, sīku fluktuāciju izraisītiem nelineāriem pro­cesiem ir izteikti nelīdzsvarotās sistēmās. Raksturīgs piemērs — sniega lavīnas kalnos. Ja sniega pakojums stāvās nogāzēs ir tuvu kritiskajam lenkim, tad visniecīgākais cēlonis var izraisīt nobrukumu. Tas var būt nejauši krītošs akmens, putns, kas nolaižas uz sniegotas nogāzes, vai pat cilvēka kliedziens. To labi zina pieredzējuši alpīnisti un kalnu tūristi, kas bīstamās lavīnu zonās sarunājas tikai čukstus. Nelīdzsvarotu ģeoloģisku slāņojumu dinamika izraisa citus — vēl briesmīgākus stohastiskas dabas procesus: zemestrīces un vulkānu izvirdumus.

Ar līdzīgiem grūti prognozējamiem dabas procesiem sastopamies meteoro­loģijā. Ja atmosfērā veidojas lieli spiediena gradienti, tad visniecīgākie cēloņi var izraisīt orkāna veidošanos. Pēc aprakstiem, tieši orkāna epicentrā sākotnēji ir draudīgs miers un bezvēja klusums. Un, kā tēlaini teikts nelīdzsvaroto pro­cesu dinamikas traktātos, šādā saspriegti nelīdzsvarotā sistēmā pietiek ar tau­riņa spārnu vēdām, lai izraisītu stihisku katastrofu. To zinātnieki arī nosaukuši pat «tauriņa efektu» {«butterfly ejfect»).

Visnotaļ trāpīgo «tauriņa efekta» metaforu, kuru šobrīd itin bieži izmanto nelīdzsvaroto sistēmu dinamikas un haosa teorijas traktātos, ir kaldinājis un apgrozībā laidis modernās meteoroloģijas iedibinātājs Edvards Lorencs. Refe­rātam, ko viņš nolasīja Amerikas zinātnes veicināšanas biedrībā Vašingtonā 1979. gada decembrī, bija dots neparasts, intriģējošs nosaukums — «Pareģo­šana: vai tauriņa spārnu vēdas Brazīlijā izraisa tornado Teksasā?» («Predictabi- lity: Does the flap of butterfly's wings in Brazil set of d tornado in Texas?»). Šā šķietami paradoksālā referāta pamattēze, kas līdzinās dzenbudistu koanai, slēpj sevī atbildi: tornado rašanos nav iespējams pareģot!

Edvards Lorencs viens no pirmajiem sāka meteoroloģijā lietot modernās haosa teorijas principus. Viņš atklāja Lorenča atraktoru, kas haosa teorijas ietvaros apraksta meteoroloģiskos procesus dabā, ciklonu un anticiklonu veido­šanos (102. att. 256. lpp.).

«Tauriņa efektu» var lietot kā viegli uztveramu metaforu abstraktākajam fluktuācijas jēdzienam. Turklāt tas arī visprecīzāk raksturo nelineāro sistēmu dinamiku — visniecīgākais cēlonis spēj izraisīt gigantisku seku ķēdi, kuru jauda miljardiem reižu var pārsniegt izraisītāja impulsa jaudu. Pats cilvēks ir radījis baismīgāko mākslīgas nelīdzsvarotas sistēmas prototipu — atombumbu. Lai izraisītu atomsprādzienu, jāsavieno divi urāna 235 (U92 ) fragmenti tā, lai to summa pārsniegtu t. s. kritisko masu. Tad nejauši tajā ieklīdis neitrons būs tauriņa spārnu vēda, kas izraisa ķēdes reakciju un tāda enerģijas daudzuma izdalīšanos, kas var nolīdzināt ar zemi miljonu pilsētu.

«Tauriņa efekta» analogu varam atrast arī psiholoģijā. Emocionāli nelīdz­svarotu cilvēku kāds neapdomīgi pateikts vārds, pat žests vai skatiens var novest lidz nekontrolējamai dusmu lēkmei, neapvaldītai agresijai vai asarainai histērijai. Līdzcilvēkiem šādi «uzskrūvēti» indivīdi var būt ne mazāk bīstami kā sniega lavīnas kalnos.

Tūlīt jāpiebilst, ka nelineārām parādībām nelīdzsvarotās sistēmās ne vien­mēr ir tikai graujoša loma. Būtībā ķīmisko un bioloģisko evolūciju norisēs, kā to uzskatāmi parādījusi gan Hākena, gan Prigožina skola, galvenais'dzinēj­spēks, kas darbojas pretī entropijas pieauguma tendencei, ir saistīts ar šādiem nelineāriem procesiem. Lai izdzīvotu un attīstītos, ikvienai bioloģiskai sistē­mai ir jāatrodas nelīdzsvarotā stāvokli. Un tās ir atkal «butterfly» tipa fluktuā­cijas, kas pārnes šo sistēmu uz jaunu līdzsvara stāvokli ar augstāku organizāci­jas pakāpi, ar sarežģītāku struktūru. Tā ikviens attīstības process, kurā no mazāk sarežģītām struktūrām spēj veidoties sarežģītākas, iet caur determinētu un stohastisku norišu ķēdi. Abi šīs virzības komponenti ir komplementāri, un to koeksistence dod iespēju veidoties struktūrām haosā. Tā ir viena neatlaidīga cīņa pret entropijas pieaugumu.

29. INTEGRĀLO ZINĀTŅU PARADIGMAS. KIBERNĒTIKA UN INFORMĀCIJAS TEORIJA

Ja 19. gs. zinātnē dominēja zinātnes diferenciācija, jaunu, šauru un speci­fisku zinātnes nozaru rašanās, tad mūsu gadsimtam raksturīga pretēja ten­dence — apvienojošu, integrālu, sinkrētu zinātņu veidošanās, kuras aptver vairāku zinātnes nozaru interešu sfēras vai arī veidojas šo zinātņu robežjoslās. Mēs jau apskatījām divas no šādām integrālām 20. gadsimta jaunajām zināt­nēm: sinerģētiku un nelīdzsvaroto sistēmu termodinamiku, kuru apvienotajā interešu sfērā un pētījumu lokā ietilpst gan nedzīvā, gan dzīvā daba no atomiem un molekulām līdz cilvēkam, no mikrodaļiņu ansambļiem līdz organismu popu­lācijām un cilvēku sabiedrībai. Turklāt, kā redzējām, šo integrālo zinātņu pieejai raksturīga vispārināta pētījumu metodoloģija un kopēji intelektuālie modeli.

Pēc kara, četrdesmito gadu beigās, izveidojās vēl divas jaunas integrālās zinātnes: kibernētika un informācijas teorija-, tās abas lieliski iekļāvās mūsu gad­simta jauno paradigmu saimē.

Kibernētikas «dzimšana» saistīta ar slavenā amerikāņu matemātika Nor­berta Vīnera 1949. gadā izdoto grāmatu «Kibernētika» («Cybernetics», [202]). Grāmatas apakšvirsraksts «Vadības un komunikāciju principi mašīnās un dzī­vos organismos» («Control and Communication in the Animal and Machine») būtībā definē jaunās zinātnes izvērsto interešu sfēru. Tātad kibernētika ir zinātne, kas pēta vadības sistēmas un to informācijas pārraides vispārīgos aspektus. Kibernētikas principu un metodoloģijas izmantošanai socioloģijā veltīta otra populārākā Norberta Vīnera grāmata «Kibernētika un sabiedrība» («Cybernetics and Society», [203]).

Vienlaicīgi ar kibernētiku izveidojās otra — ar to cieši saistīta — integrālā zinātne: informācijas teorija. Šīs teorijas zinātniski noformētos pirmsākumus parasti saista ar Bella laboratoriju komunikāciju speciālista Šenona kopā ar Vīveru 1949. gadā publicēto monogrāfiju «Komunikāciju matemātiskā teorija» («The Mathematical Theory of Communication», [169]).

Informācijas teorija (informātika) faktiski ir uzskatāma par matemātiskās kibernētikas nozari, kas pēta informācijas rašanās, mērīšanas, pārraides, pār­strādes un uzkrāšanas likumus. Informācijas jēdziena ieviešanu zinātniskās domas apritē var uzskatīt par vienu no radikālākajām modernās zinātnes para­digmu maiņām.

Informācijas teorija parādīja, ka informācija nav mērāma ne enerģijas, ne masas vienībās. Tā ir tikpat fundamentāla zinātniska kategorija kā viela vai enerģija. Vismazākā informācijas daudzuma mērvienība ir bits (no angļu vai.: binary digit— binārs cipars). Tā ir konkrēta atbilde uz alternatīvu izvēli — «jā» vai «nē» (binārā valodā — «1» vai «0»). Datu apstrādes tehnikā lieto arī lielāku informācijas daudzuma mērvienību — baitu (no angļu vai.: byte), kas vienlīdzīgs 8 bitu kopai.

Mūsdienu informātikas evolūcija ir atgriezeniski saistīta ar modernās datoru tehnikas un komunikāciju sistēmu attīstību. Šai kontekstā interesanti atzīmēt, ka tieši datoru zinātne radījusi divas jaunas vispārinātas pretmetu kategorijas — jēdzienus «hardware» un «softivare». Tie ir loti trāpīgi, bet grūti tulkojami angļu valodas termini. «Hardivare» burtiski nozīmē «dzelži», t. i., paši datori un to mehāniskās palīgierīces. Ar vārdu «sofiware» apzīmē dator­programmas vai matemātisko nodrošinājumu.

Šiem pretmetiem ir dziļa filozofiska jēga. Hardivare ir kaut kas materiāls, «ciets» un tātad determinēts. Turpretim softivare ir kaut kas apgarots, intelek­tuāls, ar «mīkstu», mainīgu iedabu. Tās ir loti skaistas un dziļi saturīgas meta­foras, komplementārs pretmetu pāris. Šos pretmetus izmanto arī cilvēka intelektuālās darbības raksturojumam. Ilardiuare šajā gadījumā ir smadzeņu nervu šūnu kopums, bet sofiioare— sevi apzinošais saprāts [148]. Šīs nostād­nes visizteiksmīgāk raksturo Karla Popera un Džona Eklsa epohālās mono­grāfijas nosaukums «Pats un tā smadzenes» («The Self andIts Brain»).

Grūti par augstu novērtēt informācijas teorijas izcilo nozīmi tādu šķietami attālu zinātņu nozaru attīstībā kā lingvistika, ģenētika un imūnbioloģija. Tā, piemēram, ģenētiskā koda atšifrēšanu sešdesmitajos gados var uzskatīt par informācijas teorijas triumfu.

Modernās informācijas tehnoloģijas iespiešanās it visās cilvēka dzīves sfērās ir radījusi to, ko amerikāņu filozofs un futurologs Alvins Toflers nosaucis par civilizācijas trešo vilni [190]. Pēc viņa domām, pirmo vilni veidoja agrārās un amatnieku civilizācijas no vissenākajiem laikiem Ēģiptē, Babilonijā un Ķīnā līdz pat industriālajai revolūcijai 17. gadsimtā. Otrais—industriālais civilizā­cijas vilnis ietver laika posmu no 17. gs. līdz mūsu gadsimta piecdesmitajiem gadiem, kad industriālā civilizācija pāraug postindustriālā— uz modernās informācijas tehnoloģijas bāzētā trešā viļņa civilizācijā, ko raksturo fiziskā vai mehāniskā darba aizstāšana ar dominējošu intelektuālo, smadzeņu darbu.

Ja par izvērstu metaforisku agrāri amatnieciskās civilizācijas simbolu var kalpot arkls vai mūrnieka ķelle, par industriālās civilizācijas metaforu — kon­veijers, tad postindustriālās civilizācijas metafora varētu būt personālais dators vai interneta un multimediju sistēmas. Šeit vietā piebilst, ka trešā viļņa civi­lizācija prasa pilnīgi jauna veida domāšanu un pieeju kā ekonomiskām, tā politiskām un sociālām problēmām. Šai kontekstā Alvins Toflers apzīmē industriālās jeb «otrā viļņa» sabiedrības pāreju uz postindustriālā «treša viļņa» sabiedrību kā fāzu pāreju, civilizācijas «bifurkāciju», kuras rezultātā veidojas daudz diferencētākas un augstākas kompleksitātes pakāpes «disipatīvas struk­tūras» sabiedrībā. Izmantojot šo trāpīgo analoģiju, varam runāt par lēcienu no ņūtoniskās paradigmas uz prigožinisko.

Blakus visam pozitīvajam un lietderīgajam, ko cilvēcei dod civilizācijas trešā viļņa informācijas bums, nāk līdzi arī daudz kas negatīvs. Tas ir mūžīgais pretmetu likums: progress nav sasniedzams, nedodot atbilstošas nodevas tā pretmetam — regresam. Šai kontekstā vēlreiz ieskatīsimies Eshera vizuālajā ale­gorijā (46. att. 2. piel.). Ja pasaulē kaut kur kaut ko sakārto, veidojot jaunas — sarežģītākas struktūras, tad apkārtnē pieaug nesakārtotība, haoss. Šī piesār­ņošana, kā jau redzējām, saistīta ar universālo entropijas pieauguma tendenci. Industriālās otrā viļņa civilizācijas progress jau radījis gandrīz fatālu pasaules ekoloģisko katastrofu, grūti restaurējamu augsnes, ūdens un atmosfēras pie­sārņojumu. Līdzīgas briesmas draud arī no postindustriālās trešā viļņa civilizāci­jas progresa un tā radītā informatīvā buma. Tikai te jārunā par cita veida, citas kvalitātes piesārņotības problēmām, jo bīstami piesārņotas tiek cilvēka sma­dzenes. To var nosaukt par draudošu garīgās pasaules ekoloģisko katastrofu. Poļu rakstnieks un futurologs Staņislavs Lems šo problēmu hiperbolizē, runājot par mūsdienu informācijas megabitu bumbu, kas cilvēcei var kļūt ne mazāk draudoša par ūdeņraža megatonnu bumbu. Nepārtrauktā, neaptveramā infor­mācijas plūsma, kurai ik dienas pakļauts mūsdienu cilvēks, — radio, televīzija, telefons, runātais un rakstītais vārds, reklāma, ielu trokšņi, mašīnu dārdoņa, piesārņotā atmosfēra utt. — tā pārslogo uztveres kanālus, ka tie notrulinās un adaptējas bremzējošam režīmam. Uzskata, ka viens no «moderno» slimību izcelšanās cēloņiem var būt lielā informācijas plūsma, ko saņem gan caur maņu orgāniem, gan ar ķīmisku aģentu starpniecību caur barības traktu vai elpošanas ceļiem. Tas noved pie mūsdienās plaši izplatītajām organisma aler­ģiskajām reakcijām, nervozitātes, vispārējā noguruma un apātijas.

Cilvēkam no milzīgās faktu plūsmas nozīmīga ir smadzeņu asimilētā, pastāvīgā atmiņā ierakstītā informācija. Tā it kā raksturo informācijas uztveres lietderības koeficientu. Bet ceļš uz pastāvīgo atmiņu iet caur operatīvo atmiņu. Pastāv uzskats, ka operatīvā atmiņa darbojas nervu šūnu līmenī; informācija uz neilgu laiku saglabājas cirkulāru plūsmu veidā. Pastāvīgo atmiņu turpretim saista ar informācijas ierakstīšanu molekulārās struktūrās (RNS vai olbaltuma molekulās). Bet šim procesam nepieciešams laiks «atmiņas molekulu» sintēzei un pavairošanai.

Bet, ja informācijas straume veļas nepārtraukti, operatīvā atmiņa tiek pār­blīvēta, iepriekšējie operatīvie ieraksti izdzēšas un pastāvīgajā atmiņā asimilētā informācija katastrofāli krīt. Cilvēks kļūst it kā par informācijas plūsmas sūkni, kas nervu enerģiju galvenā kārtā patērē informācijas pārsūknēšanai, gūstot minimālu labumu. Viens no raksturīgākajiem smadzeņu «skalošanas» paveidiem ir televīzijas klipi, kaleidoskopisku «ātrgaitas» ainu nepārtraukts, palaikam haotisks savirknējums. Skatītāja doma nevar atrast kādu stabilu pieturas punktu, iztēli rosinošu situāciju, tie ir informācijas plūdi, kas aizskalo sev līdzi visu, neatstājot neko paliekošu. Bet cilvēka erudīciju, individualitāti, radošās domas fondus veido galvenā kārtā pastāvīgā atmiņā fiksētā informā­cija, kas sastāda, runājot informācijas teorijas žargonā, cilvēka tezauru, viņa garīgo dārglietu krātuvi. Tātad informācijas plūsma cilvēka apziņā būtu jāie­vada selektīvi, dozēti, nodrošinot tās noturību, pārvēršot smadzenes no infor­mācijas sūkņa, kurā uzkrājas tikai nogulsnes, par trauku, garīgo dārglietu krātuvi, tezauru.

30. ENTROPIJAS UN INFORMĀCIJAS PRETMETI

Austriešu fiziķis Ervīns Šrēdingers, viens no modernās kvantu fizikas pamatlicējiem, līdzīgi saviem dižajiem laikabiedriem Boram, Einšteinam, Heizenbergam, Pauli, Bornam un Dirakam (sk. 1. tabulu 31. lpp), daudz paveicis ari no modernās fizikas izrietošo filozofisko problēmu risināšanā. 1945. gadā negaidīti parādījās Šrēdingera grāmata «Kas ir dzīvība?» («What is Life?», [168]). Tajā zinātnieks mēģinājis rast atbildi uz kardinālo klasiskās ter­modinamikas ietvaros neatbildēto jautājumu, kā no fizikas viedokļa izskaidrot dzīvības rašanos un eksistenci uz Zemes. Tas bija zinātnisko iztēli rosinošs darbs, kas nāca klajā vairāk nekā desmit gadus pirms Hākena sinerģētikas un Prigožina nelīdzsvaroto sistēmu termodinamikas rašanās.

Vispirms jāatzīmē, ka Šrēdingera darbs stimulēja daudzu fiziķu pievēršanos bioloģijas problēmām un veidoja idejisko bāzi vēl vienai modernai, pašreiz populārai integrālai zinātnei — molekulārajai bioloģijai. Bet mūsu skatījumā nozīmīgāks ir kas cits. Ervīns Šrēdingers pirmais ieviesa t. s. negentropijas jēdzienu, t. i., entropijas pieaugumu ar pretēju zīmi:

M=-AS = -klnW2 /Wy (8)

Citiem vārdiem, negentropijas pieaugums nozīmē entropijas samazināšanos, t. i., sistēmas pāreju no varbūtīgāka (W2 ) uz mazāk varbūtīgu (stāvokli. Šādā pārejā pieaug sistēmu raksturojošā informācija, tās informācijas daudzums. Viegli redzēt, ka negentropijas pieaugums ir ekvivalents informācijas pieaugumam, t. i., negentropija faktiski ir identiska informācijai. Šo informācijas teorijas termodi­namisko interpretāciju visizsmeļošāk iztirzājis viens no tās radītājiem, franču zinātnieks Leons Briljēns, ar francūžiem piemītošo eleganci sarakstītajā monogrā­fijā «Zinātne un informācijas teorija» («Science and Information Theory», [15]).

Te nu mēs sastopamies ar jaunu vispārinātu fizikālo kategoriju komplemen­tāru pāri: entropiju un informāciju, kuras arīdzan papildina viena otru. Infor­mācijas materiālie nesēji ir dažādās struktūras vielas vai enerģijas (starojuma) sadalījumā. Tātad, ja viela un enerģija ir komplementārais pāris, kas veido reālās pasaules pamata substrātu, tad entropija un informācija savukārt ir pāris, kas raksturo vielas vai enerģijas sakārtotības pakāpi. Citiem vārdiem, pirmais pāris veido saturu, otrais — tā veidolu (pattern), bet tos abus atkal var uzskatīt par saistītu komplementāru kategoriju pāri.

Un, beidzot, plašākā filozofiskā kontekstā mēs varam runāt par haosa un struktūru pretmetu komplementaritāti.

31. informĀcijas AKUMULĀCIJA DZĪVAJĀ DABĀ

Negentropijas pieaugums vai — atbilstoši — entropijas samazināšanās dzīvajās sistēmās būtībā nozīmē sakārtotības palielināšanos nesakārtotā vidē. Prigožina skolas terminoloģijā tas nozīmē disipatīvu struktūru veidošanos haosā [152].

Gan visā Zemes ķīmiskajā un bioloģiskajā evolūcijā (sk. 40. eseju), gan ikvienas dzīvas būtnes eksistences laikā pretēji globālai entropijas pieauguma tendencei no vienkāršākām molekulām nepārtraukti sintezējas arvien sarežģītākas, no vienkāršākām struktūrām un formām veidojas arvien kom­plicētākas. Augu valstī sarežģītos fotosintēzes procesos [40J, izmantojot Saules starojuma enerģiju, no visvienkāršākajām dabā sastopamajām molekulām H2 0 (ūdens) un CC>2 (ogļskābā gāze) tiek sintezēti sarežģīti organiskie savienojumi — cukuri, taukvielas, olbaltumi. Dzīvnieku organismos, savieno­jot barības trakta fermentu saskaldītos makromolekulu būvkieģelīšus — aminoskābes un nukleotīdus —, tiek šūnā mērķtiecīgi sintezēti sarežģīti noteiktas struktūras biopolimēri — proteīni un nukleīnskābes: dezoksi- ribonukleīnskābe (DNS) un ribonuldeīnskābe (RNS).

Šūnā, sintezējot no vienkāršākām molekulām sarežģītākas, uz apkārtējās vides entropijas pieauguma rēķina lokāli samazinās entropija un atbilstoši pieaug negentropija. Tā DNS un proteīna molekulās salīdzinājumā ar tās vei­dojošajiem nukleotīdiem un aminoskābēm negentropija ir palielinājusies.

Negentropijas pieaugumu un tam atbilstošo entropijas samazināšanos var mērīt statistiskās mērvienībās, piemēram, džoulos (/) vai kalorijās uz tem­peratūras vienību, t. i., grādu (piemēram, J/°K). Šis lielums statistiski rak­sturo sakārtotības pakāpi, sistēmas pāreju no varbūtīgāka uz mazāk varbū- tīgu stāvokli.

Vienādojums (8) paver iespēju pāriet no šīm negentropijas statistiskajām mērvienībām (J/°K) uz informācijas daudzuma mērvienībām, t. i., uz bitiem. Šādā veidā var novērtēt, piemēram, biopolimēros DNS vai proteīna molekulas struktūrā «akumulēto» informācijas daudzumu [165]. Tā, piemēram, proteīna makromolekula, kas sastāv no 1000 aminoskābēm, satur apmēram 4 x 103 in­formācijas bitus. Līdzīgi DNS makromolekula, kas sastāv no 4000 nukleīdu bāzēm, satur apmēram 8 x 10"' informācijas bitus. Šīs informācijas daudzums aptuveni atbilst iespiesta teksta lappusei, kas vidēji satur apmēram 10' bitus.

Jau sešdesmitajos gados tika aptuveni novērtēts informācijas daudzums, ko satur visvienkāršākā bakteriālā šūna— tāda kā E. coli baktērija [165], turklāt vērtēts tika ar divām neatkarīgām pieejām: tika noteikts vidējais negentropijas daudzums bakteriālā šūnā — ASun, izmantojot vienādojumu (8), novērtēts at­bilstošais informācijas daudzums AH - AS/k ln2, kur H ir t. s. entalpija, un tika veikts novērtējums informācijas teorijas ietvaros, ņemot vērā šūnas mikrouzbūvi no atomiem un molekulām. Abu neatkarīgo vērtējumu rezultāti sakrita — E. coli baktērija satur apmēram K)'~ informācijas bitus. Šis ir patiešām astro­nomisks skaitlis — miljonreiz miljons bitu. To varam ilustrēt, salīdzinot ar iespiesta teksta lappusēm. Tā kā viena lappuse satur aptuveni 104 informācijas bitus, tad 101 " biti var būt ietverti 10K iespiesta teksta lappusēs vai apmēram vienā miljonā (106 ) simt lappušu grāmatu! Tātad E. coli baktērija satur tādu pašu informācijas daudzumu kā pasaules lielāko bibliotēku grāmatu fonds!

Šis piemērs uzskatāmi liecina, ka pat visprimitīvākās dzīvo organismu for­mas evolūcijas gaitā ir uzkrājušas vairāk informācijas nekā cilvēces garīgās attīstības gaitā radītie un grāmatu krātuvēs saglabātie darbi.

Ja zinātniekiem rastos fantastiska ideja mākslīgi no pirmelementiem sinte­zēt E. coli tipa bakteriālu šūnu, tam būtu nepieciešams zināšanu kopums, kas ietverts apmēram miljonā grāmatu! Un kur nu vēl ar šādu sintēzi saistītās kolosālās biotehnoloģiskās problēmas, milzum lieli zinātnieku kolektīvi, labo­ratorijas un dolāru miljardi…

Pēdējā desmitgadē pasaules vadošajās molekulārās bioloģijas laboratorijās strādājošie zinātnieki veic pieticīgāku, bet ne mazāk ambiciozu uzdevumu — noteikt cilvēka genoma struktūru. Tas nozīmē noteikt ģenētiskās informācijas nesēju — DNS makromolekulu veidojošo nukleotīdu bāzu secību. Šī secība kodē hromosomu gēnos ierakstīto ģenētisko informāciju, kas nosaka gan pro­teīna molekulu sintēzi (61. att. 154. lpp.) un citas bioķīmiskās reakcijas, gan «instrukcijas» cilvēka embrionālās attīstības morfoģenēzei. Šo grandiozo projektu ierosināja viens no molekulārās bioloģijas celmlaužiem, DNS makro- molekulārās dubultspirāles struktūras atminētājs [198] Nobela prēmijas laureāts Džeimss Votsons. Lai novērtētu projekta apjomus un sarežģītības pakāpi, atzīmēsim, ka cilvēka genomu, kas glabājas katrā cilvēka šūnas kodolā, t. s. hromosomās, veido aptuveni 3x10^ nukleotīdu bāzu pāri. Tā kā DNS koda «alfabētu» veido četras bāzes resp. četri «burti», tad vienas konkrētas bāzes noteikšanai nepieciešami divi informācijas biti (2" = 4). Tātad cilvēka genoma «teksts» satur aptuveni 6x10^ informācijas bitu. Ja to pārvērtīsim iespiestu lappušu skaitā, iznāks 6x10^ lappuses teksta. Tātad cilvēka genoma atšifrēšanā jānosaka bāzu «burtu» secība turpat vai miljons lappušu tekstam.

Pašreiz Cilvēka genoma projektu (Human Genome Project) ASV vada izcilais molekulārās bioloģijas speciālists Frānsiss Kolinss [6a]. Lai gan līdz 1997. gada beigām bija identificēta tikai ap 6 miljoniem DNS bāzu pāru secība, t. i., apmēram 2% no kopējā 3x10'' bāzu pāru skaita, plāno, ka projektu varēs pabeigt lidz 2005. gadam. Projekts tiešām epohāls, un tas neapšaubāmi būs viens no lielā­kajiem 21. gs. sākuma zinātnes sasniegumiem ar ne tikai fundamentālu, bet ari praktisku nozīmi iedzimto ģenētisko defektu un to izraisīto slimību novēršanā.

Visvienkāršāko mikroorganismu, piemēram, fāgu genomu veido tikai viena vienīga DNS molekulas ķēde, t. i., tikai viens gēns, kas satur 1800 bāzu pārus (15. att. 49. lpp.). Ari cilvēka viena gēna teksts vidēji satur ap 1000 bāzu pārus. Bet galvenā atšķirība ir gēnu kopskaits. Tā cilvēka genomu, kā jau minējām, veido ap 3xl0) bāzu pāri. Tā kā katrs gēns satur ap 1000 bāzu pārus, tas nozīmē, ka ikvienas cilvēka šūnas kodola 46 hromosomās ir ap miljonu specifisku gēnu. Tas ir patiesi fantastisks ģenētiskās informācijas daudzums!

Esejiskā apcerē par grandiozā genoma atšifrēšanas vadītāju Tims Bērdslijs rakstā «Kur zinātne un reliģija satiekas» {«Where Science and Religion Meet», [6a]) uzsver, ka Frānsisa Kolinsa personībā simbiozē (mēs teiktu — komple­mentāri) sadzīvo zinātne un reliģija. Kolinss tic Dievam un uzskata par savas dzīves uzdevumu atšifrēt dievišķo «Sākotnējo vārdu» (sk. Jāņa evaņģēliju 1:1 [11]), kas iekodēts cilvēka genomā. Kolinss ari uzskata, ka cilvēka sirdsapziņa — viņa morāles «kodekss» — arī ir jau ģenētiski iekodēta genomā un nav vienkārši evolūcijas blakusprodukts. Te viņa pārliecība saskan ar Kanta apbrīnu par «zvaigžņotajām debesīm virs manis un morāles likumu mani». Runājot par informācijas ierakstu blīvumu, jāpiebilst, ka Gūtenberga 15. gs. iedibināto grā­matu iespiešanas tehniku mūsdienās aizstājusi modernās informācijas tehno­loģija ar daudz ietilpīgākiem un kompaktākiem informatīvo datu nesējiem.

Mūsdienās visplašāk izplatītie informatīvo datu nesēji ir magnētiskās lentes, cietie magnētiskie diski un optisko ierakstu kompaktdiski [CD-ROM). Magnētiskās kasetes lentes datu ietilpību mēra megabaitos (miljons baitu), bet magnētisko disku un optisko kompaktdisku ietilpība mērāma gigabaitos (tūk­stoš miljonu baitu). Šo modernās tehnoloģijas datu nesēju ierakstu blīvums tomēr tālu atpaliek no biosistēmām. Tā, piemēram, cilvēka genoma datu blīvums pārsniedz 102() bitu vienā kubikcentimetrā! Lielums, kas pārsniedz pat prognozējamās mūsdienu informācijas tehnoloģijas iespēju robežas.

Cits nozīmīgs parametrs ir informācijas daudzuma pārneses ātrums, ko mēra bitos laika vienībā (biti/s). Bakteriālā šūna vielu maiņas un augšanas pro­cesos no kopējā informācijas masīva 10 biti izmanto 109 bitus sekundē [165]. Interesanti šos datus salīdzināt ar cilvēka maņu orgānu datu uztveres ātrumu.

Cilvēka dzirde uztver vidēji 50 bitus sekundē. Daudz efektīvāka ir redzes uztvere. Acs tīklene spēj uztvert 7x10 bitus sekundē, no tiem smadzeņu redzes centrus sasniedz apmēram 5x10 biti sekundē. Tomēr cilvēka apzināti uztvertā informācija ir daudz mazāka: 25-50 biti sekundē. Te interesanti salīdzināt — ja ar dzirdi uztvertā informācija gandrīz visa sasniedz mūsu apziņu, tad no tik bagātīgās vizuālās informācijas mēs spējam apzināties tikai niecīgu daļiņu. Tas nepārprotami liecina, ka vizuālā pasaules uztvere nes nesalīdzināmi bagātāku informācijas klāstu nekā sadzirdamā. Relatīvi mazais informācijas daudzums, kuru mēs apzināmies, vēlreiz apliecina, ka cilvēka apziņa ir tikai niecīga saliņa plašajā smadzeņu bezapziņas okeānā, milzīga aisberga nelielā smailīte. Smadzeņu ārpusapziņas norišu informācijas dau­dzuma masīvs varētu tikt mērīts gigabaitos (ĪO'' biti sekundē), no tās apziņā nonāk labi ja kāda simtmiijonā dala! Cilvēka smadzeņu bezapziņas procesu lielo nozīmību atklāja tikai mūsu gadsimta viedīgie dzīļu psihologi — psiho­analītiķi Freids, Ādlers un Jungs. Līdz tam gan filozofi racionālisti, gan psiho­logi uzskatīja, ka viss smadzenēs noritošais atspoguļojas apziņā. Informācijas teorija deva iespēju kvantitatīvi apstiprināt psihoanalītiķu hipotēzi par bez­apziņas lomu cilvēka psihes norisēs.

Cilvēka apziņu alegoriski var iztēloties kā eļļas gaismekli de Latūra filo­zofiskajā gleznā «Marija Magdalēna» (20. att. 1. piel.). Trauslā gaismiņa izklīst apkārtējās tumsas dziļumos, uzskatāmi attēlojot gaismas un tumsas, apziņas un bezapziņas, racionālā un iracionālā daoiskos pretmetus.

Tajā pašā laikā citi informācijas teorijas aspekti liecina par plašām cilvēka racionālā prāta spriestspēju robežām. To uzskatāmi parāda septiņdesmitajos gados populārais britu BBC atjautības konkurss, kas saucās «Divdesmit jautā­jumu» («Twenty Questions»). Raidījuma vadītājs iedomājas kādu konkrētu lietu, jēdzienu vai personu, un konkursa dalībniekiem, mērķtiecīgi uzdodot vienu pēc otra 15-20 jautājumus, arvien sašaurinot meklējamā objekta pie­derības ietvarus, jāuzmin, ko viņš iedomājies. 20 alternatīvas izvēles jautājumi līdzinās 20 informācijas bitiem. Tas nozīmē, ka teorētiski meklējamais objekts jāatrod no 220 = 1 048 576 alternatīvām, t. i., no vairāk nekā miljona iespē­jamo atbilžu.

Līdzīgi var parādīt, ka fermentiem, kas darbojas dzīvos organismos (enzīmiem), nepieciešama 15 līdz 17 bitu informācija, lai nepārprotami iden­tificētu substrātu, kura molekulārā struktūra ir tam komplementāra kā atslēga slēdzenei. Tikai šajā gadījumā ferments veido ar substrātu kompleksu, kas ir starpstadija katalizējamai reakcijai. Šajā gadījumā fermentam ir 2 15 (vai 217 ) alternatīvas izvēles iespējas. Tā kā 215 = 32 768, tas nozīmē, ka 15 bitu gadījumā ferments spēj identificēt substrātu starp vairāk nekā 32 000 alter­natīviem savienojumiem. Līdzīgi darbojas arī ožas receptori dzīvniekiem, piemēram, suņiem ar augsti attīstītām ožas spējām. Tā suns spēj saost pēdas meklējamam ļaundarim starp tūkstošiem citu cilvēku īpatnējām smaržām. Lai identificētu speficisku smaržu starp 1000 cilvēkiem, sunim nepieciešami 10 biti informācijas (2»0 = 1024).

Informācijas teorija spēj veiksmīgi izgaismot dzīvajā dabā grūti izprotamas parādības, kas tā sauktajam «veselajam saprātam» šķiet paradoksālas un neiespējamas.

32. HAOSS, KOSMISKAIS TUKŠUMS UN FIZIKĀLAIS VAKUUMS

Daudzu tautu mitoloģijas un pasaules reliģijās viena no centrālajām prob­lēmām ir Pasaules radīšanas (vai rašanās) akts. Dominē divi šķietami pretrunīgi priekšstati: Pasaule ir radīta (vai radusies) no pirmatnējā haosa; Pasaule ir radīta no pirmatnējā Lielā Tukšuma jeb Vakuuma (Great void).

Pasaules rašanās no pirmatnējā haosa it kā būtu saskaņā ar mūsdienu sinerģētikas un Prigožina nelīdzsvarotās termodinamikas priekšstatiem. Jebkurā haotiskā sistēmā nelīdzsvarotā stāvoklī var veidoties sarežģītas struk­tūras. Varam pieņemt, ka sākotnēji eksistēja haotiski nesakārtotu substanču kopa, kas nonāca nelīdzsvarotā stāvoklī. Gadījuma fluktuācijas (vai Radītāja griba?) tajā izraisīja kēdveida reakcijas, un radās jaunas, sarežģītas strukturālas formas. Tas ir process, kas nemitīgi, bet mazākā mērogā nepārtraukti norit pasaulē ap mums.

Gan fizikāli, gan filozofiski daudz grūtāk iedomāties struktūras veidošanos tukšumā. «Veselais saprāts» mums saka: «No nekā nekas nevar rasties!» Ja tas ir tā, tad nav spēkā ne vielas, ne enerģijas nezūdamības likums.

Bet vai vakuums patiešām ir «nekas»?

Jau senkīniešu gudrais Gans Cai ir rakstījis: «Ja mēs zinām, ka Lielais Tuk­šums ir pilns ar či, tad arī saprotam, ka nav tādas lietas kā neka s.» {« When one knows that the Great Void is full of ch 'i, one realizes that there is no such thing as n o t h i n gn e s s.»,[\27], 33. lpp.)

Līdzīga doma izskan arī senindiešu Rigvēdas dziedājumā, kas apraksta Pasaules radīšanu ([94], 70. lpp.):

Pašā sākumā sedza tumsa tumsu.

Bija itin viss — atvars neaptverams.

Tukšumā bija ieslegts tas, kas radās..

Kā senkīniešu, tā senindiešu mitoloģijā Visums savā sākotnējā stāvoklī līdzinājās grandiozam kosmiskam atvaram, mūsdienu kosmoloģijas «melna­jam caurumam» (55. att. 2. piel.). Bet šis Tukšums nav nāvējošs, neauglīgs, jo «Tukšumā bija ieslēgts tas, kas radās». Senķīniešiem tas bija či, ar ko viņi izprata Tukšumā ieslēgto «vitālo enerģiju» ([20], 120. lpp.).

Starp citu, senķīniešu či asociējas ar vācu filozofa Šopenhauera grāmatā «Pasaule kā griba un priekšstats» («Die Welt als Wille und Vorstellung») pausto ideju par Kosmisko Gribu kā visa pirmsākumu. Pretstatā citiem vācu klasiskā ideālisma racionālistiem (Fihte, Hēgelis u. c.) Šopenhauers manāmi tuvinājās Austrumu iracionālismam un misticismam.

Kas tad būtu mūsdienu izpratnē šis mistiskais či, kas Austrumu gudro iztēlē aizpilda Lielo Tukšumu?

Saskaņā ar moderno kvantu lauka teoriju (kvantu elektrodinamiku) un Einšteina gravitācijas lauka (vispārīgo relativitātes) teoriju fizikālais vakuums nebūt nav tukšs. Šīs teorijas parāda, ka daļiņas nevar tikt atdalītas no telpas, kas ir ap tām. Gan mikrodaļiņas, gan debesu ķermeņi nosaka telpas struktūru. Tie nevar tikt aplūkoti izolēti no apkārtējās telpas, kā uzskatīja sengrieķu atomisti un vēlāk tika postulēts Ņūtona mehānikā, saskaņā ar kuru ķermeņi kustas un mijiedarbojas absolūti tukšā, homogēnā, Eiklīda ģeometrijas iet­varos aprakstāmā telpā.

Vēlāk elektromagnētisko viļņu izplatīšanās aprakstam fiziķi ieviesa diezgan mistiskas substances — ētera — jēdzienu: ēters tad arī aizpildot vakuumu, un tajā izplatoties gaisma un citi elektromagnētiskie starojumi. Bet ētera pastāvēšana izrādījās fikcija — to pierādīja, kā jau minējām, Maikelsona un Morlija eksperimenti un speciālās relativitātes pamatpostulāts par gaismas kon­stanto ātrumu. Un atkal vakuums šķietami palika tukšs. Bet tikai šķietami.

Izrādās, ka telpa resp. vakuums neeksistē izolēti, bet ir nedalāmi saistīta ar fizikāliem laukiem: gravitācijas, elektromagnētisko un kodolspēku lauku. Telpa nebūt nav homogēna un bezgalīga, kā to apraksta Eiklīda ģeometrija, tai piemīt visai sarežģīta struktūra. Ap ķermeņiem ar lielu masu un atbilstoši lielu gravitācijas lauku telpa ir liekta, un tās aprakstam jālieto t. s. neeiklīdiskā Rīmana ģeometrija (72. att. 199. lpp.).

Vēl daudz sarežģītāka kļūst telpas struktūra mikropasaulē — kodolspēku laukos. Tur tā veido savdabīgas vibrējošas stīgas un citas sarežģītas konfigurā­cijas (54. att. 137. lpp.). Šī komplicētā telpas struktūra tad arī veido fizikālo «vakuumu» jeb tā saukto kvantu vakuumu.

Saskaņā ar kvantu lauka teoriju fizikālā telpa ir visu materiālo parādību pa­mats. Tās laukos vielas daļiņas rodas un pazūd, spontāni iznirst no vakuuma un atkal pazūd tajā. Šo procesu aprakstam lieto t. s. operatoru pierakstu, un šos matemātiskos operatorus sauc par daļiņas rašanās un anihilācijas operatoriem.

Moderno kvantu lauka jeb kvantu elektrodinamikas teoriju izstrādājuši japāņu teorētiķis Tomonaga Siničiro un amerikāņu zinātnieki Džūlians Švingers un Ričards Feinmens. Par šo izcilo teorētiskās domas sasniegumu viņi 1965. gadā kolektīvi saņēma Nobela prēmiju.

Klasiskās fizikas ietvaros daļiņas tiek absolutizētas: tās nemainīgi eksistē eiklīdiskā telpā un distancēti mijiedarbojas ar pievilkšanās vai atgrūšanās

spēkiem. Kvantu lauka teorijai ir svešs antropomorfizētais mehāniskā «spēka» jēdziens un priekšstati par absolūti tukšo telpu un vielas daļiņu nemainību. Kvantu lauka teorijā daļiņas mijiedar­bojas ar citu daļiņu starpniecību, kuras veido lauku, saglabājot kvantu mehā­nikai raksturīgo daļiņas un viļņa pret­metu duālismu. Šīs virtuālās daļiņas, kā jau minējām, iznirst un atkal pazūd vakuumā. Tā elektromagnētiskā mij­iedarbībā starp lādētām daļiņām, pie­mēram, elektroniem, kā apmaiņas daļi­ņas darbojas fotoni. Vizuāli šos mijiedar­bības procesus kvantu lauka teorijā attēlo ar t. s. Feinmena diagrammām. 47.a at­tēlā parādīta Feinmena diagramma, kas attēlo divu kustošos elektronu savstar­pējo atgrūšanos, kura realizējas nevis klasiskā kuloniskā atgrūšanās spēka iet­varos, bet gan ar fotona apmaiņu starp mijiedarbībā esošām daļiņām. Šajā mij­iedarbības procesā punktā A pirmais elektrons e^ emitē fotonu y. y sabrūk punktā B, kad to absorbē elektrons er Šīs mijiedarbības rezultātā, kas īsteno­jas ar fotonu lauka starpniecību, abi elektroni maina kustības virzienu. Kā redzams, būtiska kvantu teorijas iezīme ir šādu virtuālu daļiņu dinamiskie dzim­šanas un anihilācijas (sabrukšanas) pro­cesi. Tie ir iespējami vienīgi relativitātes teorijas ietvaros, kura vielas daļiņas ne­uzskata par «nemainīgiem», «nesagrau­jamiem» objektiem, bet, ņemot vērā vielas un enerģijas ekvivalences prin­cipu (sk. (6) vienādojumu), var veidot dinamiskas vielas un enerģijas struk­tūras (patterns).

B

47. att. Feinmena vizuālās diagrammas. Attēlā a parādīta Feinmena diagramma, kas attēlo divu kustošos elektronu ^fun ^savstarpējo atgrūšanos. Tā reali­zējas nevis ar klasisko kulonisko atgrū­šanos, bet gan ar fotona y apmaiņu starp mijiedarbībā esošajām daļiņām. Attēlā b parādīta Feinmena t. s. vakuuma dia­gramma. Šī diagramma attēlo elektrona un tā antidaļiņas — pozitrona — ani­hilāciju. Anihilācijas rezultātā veidojas y radiācijas kvants, kas savukārt var vei­dot jaunu elektrona un pozitrona pāri.

Visuzskatāmāk fizikālā vakuuma būtību attēlo t. s. vakuuma diagrammas (47. b att.). Šī Feinmena diagramma parāda elektrona un tā antidaļiņas — pozitrona savstarpējo anihilāciju. Anihilācijas rezultātā veidojas hv— radiācijas

kvants, kas atkal savukārt var veidot jaunu elektrona un pozitrona pāri. Šī vakuuma diagramma attēlo savdabīgu noslēgtu mijiedarbību «cilpas», kuras Hofsteters nosaucis par «dīvainajām cilpām» (strange loops) [72], Šādām paš- saskanotām dīvainām cilpām ir būtiska loma gan fizikālā vakuuma, gan ele­mentārdaļiņu teorijā. To analogi ir dzenbudistu paradoksālās koanas, Baha kanoni mūzikā un Eshera dīvainās cilpas vizuālā metafora grafikā «Zīmējošās rokas» («Draiving Hands», 48. att. 2. piel.). «Dīvaino cilpu» šķietami paradok­sālais princips ir ar tikpat dziji filozofisku zemtekstu kā kvantu fizikas neno­teiktības relācija un komplementaritātes princips.

Tātad «vakuums» nebūt nav tukšs, tas satur savā klēpī neierobežotu skaitu daļiņu, kas pēkšņi spontāni parādās un tāpat pazūd. Šādu uzskatu jau pauda viens no pirmajiem fizikālā vakuuma pētniekiem angļu fiziķis Pols Diraks, tāpēc fizikālo vakuumu ar visām tajā slēptajām potencēm bieži vien metafo- riski dēvē par «Diraka jūru». Te redzamas ciešākas paralēles starp Tukšuma jēdzienu Austrumu mistiku traktātos un mūsdienu kvantu elektrodinamikas teorijās. Līdzīgi orientālajam Tukšumam (Void) fizikālais vakuums, kā to sauc kvantu lauka teorijā, nav tīra «ne-esamība», tas potenciāli satur visu daudzvei­dīgo elementārdaļiņu pasauli. Šīs daļiņas nav neatkarīgas fizikālas substances, tās ir pārejošas, mainīgas Lielā Tukšuma izpausmes formas. Un te būtu vietā citēt Austrumu mistiku intuitīvajā viedīgumā formulētās domas par tukšumu un formu (lietu) komplementaritāti, kas tik pārsteidzoši saskan ar modernās zinātnes atziņām ([100], 223. lpp.): «Tukšuma un formu attiecības nav jāuz­tver kā savstarpēji izslēdzošos pretstatu stāvoklis, bet gan kā vienas un tās pašas realitātes divi aspekti, kas pastāv līdzās un ir nepārtrauktā mijiedarbībā.»

Vēl precīzāk pasaules pamatu būtība ir izteikta mūsdienās bieži citētajā budistu «Prajna-paramita-hridajasūtras» filozofiskajā traktātā: «Forma ir tukšums, un tukšums patiesi ir forma. Tukšums nav atšķirīgs no formas un forma — no tukšuma. Kas ir forma, tas ir tukšums, un, kas ir tukšums, tas ir forma.» ([20], 238. lpp.) Š is šķietami paradoksālais apgalvojums būtībā izsaka divu filozofisko kategoriju komplementaritāti, kā to izprot mūsdienu kvantu teorija par fizikālā vakuuma būtību.

Šajā kontekstā atceros kādu brīnišķīgu piedzīvojumu Japānā. 1996. gada pavasarī sakuras (ķiršu) ziedu laikā viesojos senajā Japānas galvaspilsētā Kioto. Mans labs draugs, Kioto universitātes teorētiskās ķīmijas profesors Jamabe, uzaicināja mani trijatā — kopā ar viņa paziņu, japāņu izcelsmes amerikāņu teorētiskās fizikas profesoru, speciālistu elementārdaļiņu fizikā, doktoru Išikavu apmeklēt kādu ļoti senu, 1282. gadā celtu sakrālo budistu templi, sauktu Šoden-dzi, Kinugusa kalna pakājē. Ieeju svētnīcā greznoja kaligrāfisks uzraksts hieroglifos, kura estētiskais valdzinājums un līniju saspēle atgādināja abstraktu gleznojumu (49. att. 2. piel.). Abi mani ceļabiedri ar japāņiem rak­sturīgo pietāti klusējot brīdi pastāvēja pie cnigmatiskā uzraksta, tad profesors

Jamabe teica: «Tā ir sena filozofiska budistu prātula, kura, kā mēs labi zinām, ir radusi apstiprinājumu mūsdienu kvantu elektrodinamikā un elementār­daļiņu teorijā. Tas ir rakstīts vecajos, šodien ne visiem saprotamajos hierogli­fos. Tulkojums skan: «Visa pirmsākums ir Lielais Tukšums.»»

Brītiņu vēlāk trijatā sēdējām uz tempļa palieveņa austrumnieciskajā lotosa pozā un, ievērojot seno tējas ceremonijas tradīciju, malkojām za|o tēju no vecām Edo perioda tasītēm, nododamies klusinātām filozofiski meditatīvām pārdomām — it īpaši par Austrumu filozofu introverti intuitīvo skatījumu, kas viņiem lāva izprast pasaules norišu būtiskākos pamatus. Šo meditatīvo gaisotni stimulēja svētnīcas miniatūrais ainavas dārzs, kurā uz balto smilšu fona kontrastēja trīs košumkrūmu puduri, sakārtoti grupās pa trim, pieciem un septiņiem. ŠI kontrastainā ainava ar skaitļu 3, 5 un 7 slēpto simboliku rosināt rosina filozofiskām meditācijām par pasaules būtību un jēgu.

Saikne starp vakuumu un no tā iznirstošajām virtuālajām elementārdaļi­ņām (47. att. 126. lpp.) ir būtiski dinamiska sakarība. Šai aspektā vakuums ir patiesi «dzīvīgs», neskaitāmos daļiņu radīšanas un anihilācijas ritmos pulsējošs tukšums. Fizikālā vakuuma dinamiskās dabas skaidrojums tiek uzskatīts par vienu no modernās fizikas lielākajiem atklājumiem.

Vakuums no pasīvas fizikālo norišu skatuves ir kļuvis par dinamisku līdz- spēlētāju. Te gribas vēlreiz piemetināt, ka šis vakuuma dinamiskās īpašības, kas secinātas no kvantu elektrodinamikas sarežģītajiem matemātiskajiem modeļiem un to vizuālajām diagrammām (47. att. 126. lpp.), pirms vairāk nekās diviem tūkstošiem gadu tīri intuitīvi bija paredzējuši Austrumu prāt­nieki. Pie šīs tēmas mēs vēl atgriezīsimies, apcerot mūsdienu jaunākos atzinu­mus par to, ka deduktīvi analītiskā pasaules izziņas metode nebūt nav vienīgā un efektīvākā iespēja ieskatīties pasaules norišu dziļākajā būtībā.

Šai sakarībā vēlreiz atcerēsimies senkīniešu prātnieka Čana Cai viedīgos vārdus ([127], 33. lpp.): «Ja mēs zinām, ka Lielais Tukšums ir pilns ar či, tad ari saprotam, ka nav tādas lietas kā nekas.» Tālāk seko Cana Cai skaidrojums: «Kad či kondensējas, tas kļūst vizuāli tverams, pieņemot individuālo lietu for­mas. Kad či atkal izkliedējas tukšumā, tas vairs nav vizuāli tverams un formas pazūd. Ja či kondensācijas laikā nav jāsaka, ka formas eksistē tikai uz laiku, vai tad, kad tas atkal ir pazudis tukšumā, būtu vietā teikt, ka tas eksistē? Tātad či, Pasaules «vitālā enerģija», ritmiski te parādās formu veidā, te atkal pazūd Lielajā Tukšumā. [..] Lielais Tukšums nevar nesastāvēt no či. Bet či nevar nekondensēties visu lietu formās, un šīs lietas nevar atkal no jauna neiz- kliedēties un nepazust Lielajā Tukšumā.» ([20], 236. lpp.)

Interesanti, ka šādi aprakstītās fizikālā vakuuma dinamiskās īpašības izriet ari no nenoteiktības relācijas (5).

Pēc klasiskās fizikas pamatdefinīcijas, vakuums nesatur ne vielu, ne ener­ģiju. Bet nulles enerģija ir precīzs lielums, to nepieļauj kvantu fizikas nenoteiktības

24. att. I'. Pikaso "zili rozā" periodu reālistiski simboliskā glezna "Akrobāte uz bumbas" Ermitāžā Sanktneterburttā. Gleznu nosacīti vardu nosaukt ari ■ "Vīrietis un Sieviete".

31. att. Japānu Heianas perioda kaligrāfijas paraugs.

>'.,'. att. leonardo da Vinči glezna "Jānis Kristītājs" Luvrā Parīzē.

36. att. M. Eshera " Trīs lodes II" (1946). Si grafika simboliski ataino Indras tikla "pērliSu" savstarpējās atstarošanās filozofisko ideju.

■IK att. M. Ksliera grafika "Zīmējošas rokas" (1948). Zīmējums uzskatāms par paradoksu loģikas "dīvaino

«linu» ■ ■Ir.iiAlii maitnfnmi lT)l

46. att. M. Eshera grafika "Kārtība un Haoss" (1950). Sis patiesi ģeniālais zīmējums vizuāli un filozofiski vispārināti atspoguļo entropijas pieauguma tendenci. Ja kaut kur kaut ko sakārtojam, to var izdarīt tikai uz haosa pieauguma rēķina apkārtējā vidē.

4l ). att. Hieroglifos rakstīts filozofisks dzenbudistu aforisms 13. gs. svēt-

vIofA VvlunrM tomnli k'inliv i nlniKīiliinK ir I ii'lnk TnkSnms "

55. att. Kosmiskā melnā cauruma shematisks attēls. Melnā cauruma gigantiskais gravitācijas lauks totāli deformē telpas-laika struktūru.

princips. Modernajā — kvantu lauka teorijas aprakstītajā fizikālajā vakuumā ir jābūt galīga lieluma enerģijas fluktuācijām, kuru eksistenci nosaka Heizen- berga-Bora relācija. Šādu fluktuāciju klātbūtne tad arī izraisa virtuālo daļiņu parādīšanos. Tā šo fluktuāciju rezultātā no vakuuma dzīlēm var iznirt vielas un antivielas virtuālo daļiņu pāris, piemēram, elektrons un pozitrons, lai pēc ultra- īsa laika — intervālā, ko nosaka nenoteiktības relācija (5), — atkal pazustu vakuumā [207]. Jo enerģētiskāks ir radito daļiņu pāris, jo īsāks to pastāvēšanas laiks. Einšteina enerģijas un vielas ekvivalences formula E=mc'2 (3) savukārt nosaka iespēju vakuumā slēptajai enerģijai pārvērsties vielā. Šādā kontekstā senkīniešu prātnieku traktēto Lielā Tukšuma enerģiju či varam patiesi identi­ficēt ar kvantu fizikālā vakuuma nulles enerģiju. Tā ir līdzīgu paradigmu sasaukšanās cauri gadu tūkstošiem. Bet, ja vakuumā eksistē gadījuma fluktuāci­jas, tas nozīmē, ka vakuums sevī satur haosa elementus. Abas šķietami pretru­nīgās idejas par Pasaules izcelšanos no Tukšuma vai no Haosa mūsdienu izpratnē ir identiskas — tās ir divas viena otru papildinošas komplementāro Lielo Patiesību puses. Šīs diskusijas rezultātā varam secināt, ka vispārīgiem fizikālo kategoriju pāriem daļiņa — vilnis un viela — enerģija varam vēl pievie­not specifisku pāri: kvantu jizikālais lauks — virtuālās elementārdaļiņas.

33. ELEMENTĀRDAĻIŅU «SPIETS» UN ŠIVAS KOSMISKĀ DEJA

Vielas elementārdaļiņu «dzimšanu» un anihilāciju zinātnieki eksperimentāli novēro īpašos elementārdaļiņu paātrinātājos, kuros daļiņu ātrums ultraspēcīgos elektriskos un magnētiskos laukos sāk tuvoties gaismas ātrumam. Šādām augsti enerģētiskām daļiņām liek savstarpēji sadurties, un izraisītajā reakcijā rodas jaunu daļiņu plūsma. Daļiņu trajektorijas reģistrē īpašās t. s. burbuļu kamerās (bubble chambers), un pēc šo trajektoriju formas ārējos laukos un sazarojumiem mēģina identificēt jaunradušās daļiņas, nosakot to masu un pastāvēšanas laiku. Šāds elementārdaļiņu «spiets» redzams Bērklijas universitātes Lorensa radiācijas laboratorijā iegūtajos attēlos (50. att.). Ieskats elementārdaļiņu mikropasaulē ir

50. att. Elementārdaļiņu rašanās un anihilācijas procesu fotogrāfijas, kas iegūtas t. s. burbuļu ka­merās (bubble chamber) Lorensa radiācijas labo­ratorija Herklijas universitātē Kalifornijā.

patiesi iespaidīgs. Daļiņas veido līk­loču zigzagus, sazarojumus, piruetes, tad pēkšņi pazūd, kā nebijušas. Pār­steidzošā, neparastā aina vedina uz vizuālam analoģijām. Tā austriešu atomfizikis Fritjofs Kapra grāmatā «Fizikas Dao» («The Tao ofPhysics», [20]) elementārdaļiņu dzimšanas un anihilācijas «dokumentālās» bildes (50. att. 130. lpp.) metaforiski salī­dzina ar indiešu dieva Šivas kosmisko deju. 51. attēlā vizuāli savietota 12. gs. Austrumu mākslinieka attēlotā Šivas kosmiskā deja un 20. gs. Rietumu fiziķu elementārdaļiņu eksperimentos iegūtā aina [20]. Angļu rakstnieks Oldess Hakslijs romāna «Sala» («Is- land», latviski izdots 1993. gadā, [74]), vāku ilustrējis tieši ar dejojošā Šivas attēlu (52. att. 2. piel.). Tā nav nejaušība, jo šā filozofiskā romāna pamattēma ir Rietumu un Austrumu kultūru pretmetu saskarsme. Šivas kosmiskā deja veido fonu visai romāna darbībai. Dejas filozofiski ietonētais apraksts veido it kā asi, ap kuru griežas romāna varoņi un notikumi.

Tādā kārtā Šivas kosmiskā deja var veidot — protams, simboliskā ska­tījumā— gan elementārdaļiņu «spietu» (Kapra), gan cilvēku likteņus (Hak­slijs). Romānā «Sala» Hakslijs aprakstījis Šivas deju ([74], «Šiva Nātarādža, Dejas Dievs, kas dejo laikā un ārpus laika, dejo mūžīgi un mūžības mirkli. Dejo vienlaicīgi visās pasaulēs. Un pirmām kārtām materiālajā pasaulē. To apvij oreols ar uguns simboliem, kurā dievs dejo. Tā ir dabas, vides un ener­ģijas pasaule. Siva Nātarādža dejo mūžīgas atnākšanas un aiziešanas deju. Tā ir Viņa lila, kosmiskā spēle. Viņš spēlējas spēlēšanās dēļ — kā bērns. Bet šis bērns ir Lietu Kārtība. Viņa rotaļlietas ir galaktikas, viņa rotallaukums— bez­galīgā telpa, un attālums starp viņa pirkstiem ir tūkstoš miljoni gaismas gadu. Šiva Nātarādža aizpilda Visumu, Viņš ir Visums. Nātarādža dejo starp zvaigznēm un atomos. Un arī ikvienā dzīvā, jūtīgā būtnē, ikvienā bērnā, vīrietī un sievietē. Spēlējas spēlēšanās dēļ. Bet nu spē(u laukums ir saprātīgas būtnes, dejas grīda ir spējīga ciest. Mums šī bezmērķa spēle šķietas apvaino­jums. Mēs gribētu Dievu, kas nekad neiznīcina to, ko pats radījis.»

51. att. 12. gs. Austrumu mākslinieka attē- '

lotā Šivas kosmiskā deja, vizuālā simbolā savietota ar 20. gs. Rietumu fiziku reģistrē­tajām elementārdaļiņu «spieta» kosmiskajām

«dejām» [20].

Bet Šiva ir vienlaicīgi radītājs un iznīcinātājs, labais un ļaunais, dzīvība un nāve (sk. 44. eseju).

34. KVANTU HROMODINAMIKA. KRĀSAINIE KVARKI UN BALTIE NUKLONI

Lasītājam var rasties jautājums: kas tad modernās atomfizikas izpratnē ir elementārdaļiņa? Pēc definīcijas, vielas elementārdaļiņa ir daļiņa, kuru nevar tālāk sadalīt sastāvdaļās. Līdz mūsu gadsimta sākumam par elementārdaļiņu, sekojot sengrieķu atomistu tradīcijām, uzskatīja atomu. Tas jau izrietēja no paša nosaukuma «atoms», kas grieķu valodā nozīmē — «nedalāms». Atomu parasti iedomājas kā mazu, apaļu, bezgalīgi cietu, tātad arī nedalāmu lodīti.

Šis atomistu uzskats izrādījās maldīgs. Angļu fiziķis Rezerfords, pētot Cč-daļiņu izkliedi, konstatēja, ka atomi sastāv no ļoti maza, salīdzinot ar atoma izmēriem, kodola, ap kuru riņķo elektroni. Uz šo datu bāzes tapa 1911. gadā Rezerforda, bet 1913. gadā kvantizētais Bora atommodelis (sk. 18. eseju un 37. att. 81. lpp.). Salīdzinājumam atgādināsim, ka, piemēram, atoma lielums ir apmēram 10"8 cm, t. i., simtmiljonā dala no cm, bet tā kodola lielums — ap 10"'^ cm, t. i., tas ir desmit miljonu reižu mazāks par pašu atomu!

Kādu laiku uzskatīja, ka vismaz atoma kodols ir nedalāms. Bet arī šī hipotēze izrādījās maldīga, Atklājās, ka elementu atoma kodoli sastāv no vēl mazākām daļiņām, t. s. nukloniem: pozitīvi lādētā protona un neitrālā neitrona. Tā galu galā tika formulēts vispārpieņemtais uzskats, ka īstās un tālāk vairs nedalāmās elementārdaļiņas ir pozitīvi lādētais protons, neitrālais neitrons un negatīvi lādētais elektrons (tā masa ir apmēram 1800 reižu mazāka nekā pro­tona un neitrona masa).

Bet Lielo Patiesību meklējumu ceļi ir tik grūti prognozējami! Vai, kā nedaudz ironiski mēdza teikt Alberts Einšteins, «Dievs nav ļauns, bet viltīgs»! Šo mikropasaules uzbūvē slēpto Dieva «viltību» sešdesmitajos gados izdevās atminēt vienam no izcilākajiem mūsdienu zinātnes teorētiķiem amerikāņu fiziķim Marejam Gellam—Mannam.

Te nepieciešama neliela atkāpe, lai raksturotu pašu kvarku atklājēju. Gellam—Mannam, tāpat kā Boram, piemīt ļoti bagāta iztēle un ģeniāla intu­īcija. Viņam raksturīga izteikti vizuāla domāšana un spriedumu veidošana uz analoģiju pamata, izmantojot nevis strikti formālus jēdzienus un definīcijas, bet dzejiskas metaforas. Gells-Manns ir zinātnieks ar ļoti plašu interešu spek­tru. Būdams pasaules vadošais speciālists vielas elementārdaļiņu teorijā, viņš vienlaicīgi dzīvi interesējas par citiem teorētiskās fizikas virzieniem, arī par

bioloģiju, lingvistiku, dabaszinātņu filozofiju, literatūru, mākslu un citām hu­manitāro zinātņu nozarēm, ir lielisks zinātnes popularizētājs. Gellam-Mannam īpaši mī|a ir lingvistika. Kad jaunatklātajai elementārdaļiņai bija jāatrod trā­pīgs nosaukums, viņš, pāršķirstot Džeimsa Džoisa pēdējo grāmatu «Finegana nomods» («Finnegan's Wake») uzdūrās frāzei: «Three quarks for Muster Mark.»

Džoisa kaislība bija fonētiski skanīgu jaunvārdu darināšana, tā bagātinot leksiski pārbagāto angļu valodu. Ja jau «Ulisā» figurē daudz jaunvārdu, tad «Finegana nomods», kā stāsta zinātāji, mudžot no šādiem jaundarinājumiem, padarot grāmatu interesantu un pieejamu tikai nedaudziem lingvistikas «fein- šmekeriem». Gells—Manns acīmredzot tāds bija, viņam vārds «quark» iepati­kās — tas fonētiski atgādināja kaijas kliedzienu —, un tā jaunā elementār­daļiņa tika nokristīta par kvarku [52],

Gells-Manns parādīja, ka gan protonu, gan neitronu veido trīs savstarpēji atšķirīgi kvarki. Pēc kādas pazīmes tos atšķirt? Te nu Gells-Manns izmanto loti skaistu vizuālu metaforu, piedēvēdams kvarkiem trīs spektra pamatkrāsas. Tā nuklonu (protonu vai neitronu) veido trīs baltās gaismas spektra pamatkrāsu kvarki: «sarkanais», «zaļais» un «zilais» kvarks. Šādas kombinācijas rezultātā nuk- loni vienmēr ir «balti». Tie ir no krāsainām elementārdaļiņām veidotas saliktas daļiņas. Krāsainie kvarki nav tieši eksperimentāli novērojami, dabā sastopamas to kompozīciju veidotās daļiņas — «baltie» protoni un neitroni. Kvarkus nuklonos «salīmē» kopā citas īpašas daļiņas — krāsainie gluoni (53. att. 133. lpp.). GIu- oniem stiprās mijiedarbības kodolspēku veidošanā ir tāda pati loma kā fotoniem elektromagnētiskā mijiedarbībā starp elektroniem (47. a att. 126. lpp.).

53-att. Krāsaino kvarku shematisks modelis. Attēlā parādits, kā tris krāsainie kvarki veido «balto» daļiņu — protonu

(ūdeņraža atoma kodolu).

Kā redzams 53. attēlā, gluoni ir divkrāsaini. Tā «sarkano» UR un «zaļo» U( . kvarku «salīmē» divkrāsainais «sarkanzaļais» gluons. Ar gluonu starpniecību realizējās t. s. stiprā kodolu mijiedarbība, kas spēj atoma kodolā pārvarēt līdzīga lādiņa kvarku kulonisko atgrūšanos.

Gells-Manns kvarkiem piedēvē vēl citu interesantu metaforisku īpašību, proti, «smaržu» (flavour•). Pēc «smaržas» atšķiras t. s. u (up) kvarki, kuriem ir daļskaitļa elektrona lādiņš 2/3 un d(down) kvarki ar lādiņu —1/3. «Smarža» ir tā īpašība, kura nosaka, vai kvarku trijotne veidos protonu ar lādiņu +1 vai neitronu ar nulles lādiņu.

Daļiņu elektromagnētisko mijiedarbību nosaka to lādiņš, bet kodolspēku veidošanos — kvarku «krāsa». Trīs dažādu «krāsu» kvarku kopa vienmēr veido stabilu «balto» daļiņu — protonu vai neitronu. 53. attēlā parādīts, kā divi krāsainie u (up) kvarki (katrs ar elektrisko lādiņu 2/3) un viens krāsainais d(doion) kvarks (ar lādiņu —1/3) veido pozitīvi lādētu (+1) «balto» protonu. u un (^kvarkiem atšķiras ne vien lādiņš, bet arī «smarža». Tā kā trīs kvarki atkarībā no to «smaržas» veido vai nu protonu, vai neitronu, to masas praktiski līdzinās atbilstoši 1/3 no protona vai neitrona masas.

Ap 1972. gadu tika teorētiski formulēta kvarku un gluonu kvantu lauka teorija. Gells-Manns to nosauca par kvantu hromodinamiku, izmantojot grieķu valodas vārda sakni chromo, kas nozīmē krāsu.

Kvantu hromodinamikai (angliski cļuantum chromodynamics, saīsināti QCD) kodolspēku aprakstā ir tāda pati loma kā agrāk izveidotajai kvantu elek- trodinamikai (angliski — quantum electrodynamics, saīsināti QED) elektro­magnētisko mijiedarbību aprakstā.

Par kodolspēku kvarku modeļa izveidi Gells-Manns 1969. gadā saņēma Nobela prēmiju fizikā. Kvarku modelis ir tipisks intelektuālā modeļa piemērs. Kā jau minējām, tiešā veidā «krāsainos» kvarkus novērot nevar, tie vienmēr ir saķerti un ar gluoniem cieši saķēdēti «baltajā» nuklonā. Protona kvarkveida struktūru izdevās apstiprināt netiešā eksperimentā, «iztaustot» protona iekšieni ar augstas enerģijas elektroniem, līdzīgi kā elektronu mikroskopijā. Šā lieliskā eksperimenta autori Teilors, Kendals un Frīdmens par savu atklājumu arīdzan saņēma Nobela balvu. Ar to tika apstiprināta «krāsaino» kvarku eksis­tence. u un d «krāsaini smaržīgie» kvarki ir stabilas vismazākās elementār­daļiņas, atomu kodolu būvķieģeļi. Jau septiņdesmitajos gados elementārdaļiņu paātrinātājos atklāja nestabilu kvarku pāri ar fantastiski īsu dzīves laiku. Pirmo — ar masu 0,5 — nosauca par dīvaino (strange) kvarku, otro — ar nedaudz lielāku masu (1,5) — par šarmanto (charm) kvarku [105]. Kvarku modelis paredzēja, ka pavisam iespējami seši atšķirīgi kvarki. 1977. gadā atklāja piekto kvarka tipu — nestabilo, t. s. «apakšējo» (bottom) kvarku ar masu 4,5. Pēc šā atklājuma prognozēja, ka jāeksistē vēl vienam «kvarku ģimenes» loceklim, ko nosauca par «augšējo» {top) kvarku — ar vēl lielāku masu. Topkvarka eksis­tenci eksperimentāli pierādīja tikai pēc 18 gadu intensīviem pētījumiem 1995. gadā Fermi Nacionālajā elementārdaļiņu paātrinātāju laboratorijā Batavijā llinoisas štatā ASV. Šajā grandiozajā gadsimta pētnieciskajā darbā piedalījās vairāk nekā tūkstoš zinātnieku liels kolektīvs! [105] Topkvarks izrādījās ar kolosāli lielu masu, kas līdzinās 175 protonu masām un ir ļoti tuva zelta atoma masai. Tā novērtētais dzīves laiks ir neiedomājami īss — tikai 10"2 '* sekundes!

Tādā kārtā šie un citi unikālie eksperimenti apstiprināja Gella-Manna sākotnējo kvarku hipotēzi, tagad tā ir vispārpieņemta un tiek dēvēta par elementārdaļiņu standarta modeli [105]. Tā kā Gells-Manns ir zinātnieks ar daudzām intelektuālām kaislībām, pēc fantastiskajiem sasniegumiem elemen­tārdaļiņu teorijā sešdesmitajos un septiņdesmitajos gados viņš 1984. gadā nodibināja tagad jau pasaulslaveno Santafē institūtu Kalifornijā. Institūta pamatuzdevums — pētīt kompleksas adaptīvas sistēmas nedzīvajā un dzīvajā dabā. Institūtā tiek pieaicināti pasaulslaveni zinātnieki no visas pasaules, lai teorētiski risinātu sarežģītas problēmas no kvantu lauka teorijām un kvantu kosmoloģijas līdz cilvēka imūnbiologijai, valodas evolūcijai, globālai ekono­mikai un ekoloģijai, aplūkojot tās kā kompleksi veidotas sistēmas. Šajā inte­grālajā pieejā redzama ciešā radniecība ar Hākena skolas sinerģētiku un Prigo- žina nelīdzsvaroto sistēmu termodinamiku. Varam teikt, ka šīs dažādās pieejas kompleksu problēmu integrālajā risināšanā ir savstarpēji komplementāras.

Pavisam nesen — 1994. gadā — parādījās fascinējoša Gella—Manna grā­mata «Kvarks un jaguārs» (« The Quark and the Jaguar», [52]). Tā ir aizraujoša, dziļi personiska, filozofiski tendēta eseja par «Piedzīvojumiem vienkāršajā un sarežģītajā» («Adventures in the Simple and the Complex»). Arī šajā gadījumā, palikdams uzticīgs metaforiskām analoģijām, Gells-Manns izvēlas trāpīgas metaforas: vienkāršajam — elementārdaļiņu kvarku, bet sarežģītajam —jaguāru, graciozo un adaptīvo džungļu iemītnieku.

Mareju Gellu-Mannu var uzskatīt par vistiešāko Nilsa Bora tradīciju turpi­nātāju. Līdzīgi Boram viņā dominē intuitīvi metaforiskā pieeja pasaulei, kas nodrošinājusi izcilus panākumus sarežģīto dabas procesu izpratnē. Tieši uz Gellu— Mannu var attiecināt Nilsa Bora viedīgos vārdus: «Kad runājam par atomiem, to aprakstam jāizmanto valoda, kas līdzīga poēzijai. Arī dzejnieks ir vairāk ieinteresēts radīt tēlus nekā tikai aprakstīt faktus.» Gella-Manna «krā­saino» kvarku metafora ir lieliskākais apstiprinājums Nilsa Bora proponētajai mikropasaules apraksta metodei.

Par tēlainās domāšanas un metaforu loģikas īpašo lomu pasaules būtiskāko norišu izzināšanā runāsim 88. esejā.

35. MIKROPASAULES «STĪGU ORĶESTRIS»

Alberta Einšteina mūža sapnis bija radīt vienotu lauka teoriju, kas aprakstītu itin visas dabā sastopamās parādības, elektromagnētisko, gravitācijas un kodolspēku laukus. Lai gan pie vienotā lauka teorijas radīšanas viņš nostrādāja vairāk nekā trīsdesmit gadus, šis sapnis cieta fiasko. Kā norāda Gells-Manns [52], šīs fatālās neveiksmes galvenais cēlonis bija Einšteina tiepīgā atteikšanās izmantot vienotajā lauka teorijā kvantu fizikas statistiskos principus. Faktiski Einšteins atteicās no «bērna», ko pats bija radījis. Par šīs spītīgās noraides ētiski reliģiskajiem aspektiem mēs jau runājām. Būtībā tā bija komplementāro Lielo Patiesību otrās — papildinošās puses noliegšana. Einšteina dzīves laikā nebija vēl izveidota arī kodolspēku lauka teorija — to Gells-Manns radīja sešdesmitajos un septiņdesmitajos gados, jau pēc Einšteina nāves 1955. gadā. Tagad šis fiziku lolotais sapnis ir piepildījies. Ar pasaules izcilāko zinātnieku spēkiem ir radīta jauna tipa teorija, kas pazīstama kā superstīgu (superstring) teorija [52, 199, 66, 124], Tā ir apvienotā lauka teorija, ko angļu valodā mēdz dēvēt par Theory of Everthing, saīsināti TOE ( Gells-Manns gan norāda, ka šāds apzīmējums ir nedaudz pārspīlēts, jo teorija apraksta tikai mums pazīstamos fizikālos laukus — elektromagnētisko, gravitācijas un kodolspēku — un ar tiem saistītās elementārdaļiņu mijiedarbības [52].)

Šai sakarībā pats interesantākais ir tas, ka elementārdaļiņu superstīgu mode­lis balstās uz paradoksālu, īsteni dzenbudisku principu, ko pazīst kā zābak- saišu (bootstrap) analoģiju. Tā, protams, atkal ir metafora, kas ataino racionā­lam prātam nepieņemamu notikumu, proti, ka cilvēks, satvēris savu zābaku saites, spēj pacelt sevi gaisā!

Bet tieši kaut kas līdzīgs notiek elementārdaļiņu pasaulē. Daļiņas rada spēka lauku, kas tās saista kopā, savukārt spēka lauks rada pašas daļiņas. Šādā pašsaskaņotā daļiņu un lauka sistēmā veidojas noslēgta dīvainā cilpa (līdzīgi Hofstetera aprakstītajām «dīvainajām cilpām» [72]). Šādā pašsaskaņotā daļiņu sistēmā daļiņas rada pašas sevi [52]!

Tā ir racionālam prātam grūti izprotamā iracionālā mikropasaules sastāv­daļa. «Bootstrap» modeli elementārdaļiņu fizikā viens no pirmajiem proponēja amerikāņu teorētiķis Džefrijs Čjū. Kā norāda Fritjofs Kapra [20], par «boot­strap» principa vistiešāko prototipu var uzskatīt Indras tīkla metaforu. Kā redzējām, Indras tīklā mehāniskā cēloņu un seku ķēde tiek aizstāta ar paš- saskaņotu tīkla «pērlīšu» savstarpēju mijiedarbību. Tieši šis dinamiski paš-

saskaņotais mijiedarbības princips ir «bootstrap» modeļa būtiskākā sastāvdaļa. Un atkal jāpiebilst, ka Indras tīkla metafora, ko Austrumu viedīgie filozofi mistiķi ieviesa jau pirms kādiem 2500 gadiem, lai uzskatāmi atainotu pasaules norišu dziļāko būtību, var tikt uzskatīta par pirmo «bootstrap» modeļa analogu — tik nozīmīgu mūsdienu elementārdaļiņu teorijā ([20], 328. lpp.).

Šo paradoksālo principu, kā jau minējām, ģeniāli attēlojis Eshers grafikā «ZīmējoSās rokas» (48. att. 2. piel.). Viena no rokām zīmē otru un pati savu­kārt tiek zīmēta ar otru roku!

Pašsaskaņotās, sevī noslēgtās dīvainās cilpas, ko plaši apskatījis amerikāņu matemātiķis Duglass Hofsteters [72], kā tikko redzējām, veido arī mikropa- saules pamatus. Bet, kā parāda Hofsteters, tās sastopamas gan loģiskos para­doksos, gan polifoniskā mūzikā — Baha kanonos un fūgās —, gan dzenbu- distu koanās. Šai kontekstā atcerēsimies Nilsa Bora credo «Bez paradoksa nav progresa» {No progress ivithoutparadoxes)\ Jo tieši daļiņas un viļņa pretmetu paradoksa atminējums noveda Boru pie Lielo Patiesību komplementaritātes atklājuma. Vai, kā teiktu dzenbudisti, pie satori (apskaidrības).

Bet kas tad ir šīs mikropasaules kvantu superstīgas? Saskaņā ar superstīgu kvantu teoriju elementārdaļiņas tiek priekšstatītas kā bezgala mazi viendimen- sionāli objekti, kas vizuāli atgādina stīgas (54.a att.). Šo mikrostīgu garums ir

54. att. a — Kvantu superstīgu modelis. Šo superstīgu cilpu garums līdzinās apmēram 10*33 cm; tas atbilst t. s. Planka garuma konstantei, kas ir viena no kosmosa fundamentā­lajām konstantēm. Saskaņā ar kvantu mehānikas viļņa/daļiņas duālismu superstīgu svārstību stāvviļņi veido elementārdaļiņas — elektronus, kvarkus un fotonus, b — Elementārdaļiņu duālās simetrijas modelis. Šis vizuālais modelis demonstrē, kā vienkārša elementārdaļiņa — krāsainais kvarks — var pārvērsties saliktā daļiņā, ko sauc par monopolu.

ar kārtu 10" cm. Tas atbilst t. s. Planka garuma konstantei — elementārajam telpas kvantam. Planka garuma konstanti nosaka triju kosmisko konstantu attiecība: (Gh/c3 ),/2 = 10"33 cm, kur Gir gravitācijas konstante, h— Planka konstante un c— gaismas ātrums vakuumā.

Mikrostīgas var atrasties dažādos svārstību modu stāvokļos (54. att. 137. lpp.), un katram noteiktam svārstību modam atbilst noteikta daļiņa — elektrons, protons, neitrons vai kvarks. Jo augstāka ir svārstību frekvence, jo lielāka ir atbilstošās daļiņas masa. Šī aina visā pilnībā atbilst kvantu mehānikas komple- mentaritātes principam, ka vilnis var vienlaicīgi parādīties kā daļiņa.

Superstīgu teorijas ietvaros var dot kvantu lauka aprakstu arī gravitācijas daļiņām — tā sauktajiem gravitoniem, kas atbilst noteiktam stīgu svārstību modam un tādējādi var tikt uzskatīti par gravitācijas lauka kvantiem. Rezul­tātā stīgu teorija apvieno kvantu lauka un gravitācijas lauka aprakstus un izskaidro gravitācijas būtību.

Runājot metaforu valodā, stīgu teorijas modeli var pielīdzināt kosmiskam orķestrim. Katra elementārdaļiņa atbilst noteiktā toņkārtā vibrējošai stīgai, un to «kopskanējums» veido Visuma daudzšķautņaino polifonisko mozaīku.

Superstīgu teoriju tās sākotnējā formā proponēja Džons Švarcs un Andrē Nevo 1971. gadā. Pēc vairāk nekā 15 gadu pētījumiem četri Prinstonas teorētiķi, kurus bieži dēvē par «Prinstonas stīgu kvartetu», izveidoja superstīgu teorijas galīgo variantu, ko nosauca par heterotisko superstīgu teoriju («heterotic super- string theotj»). Šis teorētiskais modelis spēj aprakstīt visu tipu elementārdaļiņas, ieskaitot gravitācijas kvantus — gravitonus [52], Nozīmīgākais ir tas, ka izveidotā superstīgu teorija balstās uz jau minēto «bootstrap» principu, un tās būtību, kā jau minējām, vislabāk attēlo Eshera «Zīmējošo roku» metafora.

Pēdējos gados superstīgu teorija tiek papildināta ar jauna tipa simetriju, ko sauc par duālo simetriju. Par diviem modeļiem vai teorijām saka, ka tās ir duālas, ja, būdamas šķietami atšķirīgas, tās apraksta vienu un to pašu parā­dību. Šis dualitātes princips faktiski ir universālā komplementaritātes principa paveids elementārdaļiņu teorijā [124].

Saskaņā ar dualitātes principu fundamentālās elementārdaļiņas var mainī­ties un kļūt par saliktām daļiņām — un otrādi. Tā, piemēram, «sarkanais» kvarks var pārvērsties par «divkrāsainu zilisarkanu» saliktu daļiņu, sauktu par monopolu, un pēc tam pārvērsties atpakaļ par «vienkrāsainu» kvarku. Šajā pārvērtību procesā realizējas vienkāršā un saliktā kategoriju komplementaritāte. Sai kontekstā nevaram runāt par vienkāršu elementārdaļiņu, jo tā vienmēr ir saistīta ar savu komplementāro pāri — saliktu da|iņu (54. 6 att. 137. lpp.).

No duālās simetrijas viedokļa arī mikrostīgu viļņi un to veidotās daļiņas nedalāmi saaužas vienā veselā kā kvantu fizikas viļņa un daļiņas komplemen­tārie pāri [124], Jautājumu, vai pasaule sastāv no vienkāršā\ai saliktā, Imanuels Kauts uzskatīja par tīram prātam neatrisināmu antinomiju ([84], 98. lpp.). Kā redzam, modernā fizika šo problēmu ir atrisinājusi Lielo Patiesību komple- mentaritātes ietvaros. Tās abas ir Lielās Patiesības, kas viena otru papildina.

Amerikāņu elementārdaļiņu fiziķis, superstīgu teorijas guru Edvards Vitens 1995. gadā apvienoja piecus eksistējošos stigu teorijas modeļus un radīja jaunu vispārinātu teoriju, kas pazīstama kā M-teorija (M-THEORY) [36a]. Šajā teorijā blakus kvaziviendimensionālām stīgām parādās arī divdimensionālas telplaika «folijas», ko nosauca par membrānām. Šai kontekstā Vitens asprātīgi piezīmē, ka M-teorijā «M» varot nozīmēt — atkarībā no gaumes — gan membrānu, gan maģiju (magic), gan mistēriju (mystery).

Tātad membrānas ir divdimensionāli telplaika veidojumi, kas spēj «samī­lēties» (līdzīgi tepikim), veidojot cilindriskas struktūras. Ja šāda cilindra diametrs kļūst bezgala mazs, tad «caurulīte» (tube) veido kvaziviendimensionālu stigu. Ja superstīgu teorija operēja ar desmitdimensionālu telplaiku, tad M-teorija ievieš vēl vienu papildu dimensiju un Visumu aplūko vienpadsmit- dimensionālā telplaika. Četras atvērtās dimensijas veido mums jau pazīstamais einšteiniskais telplaiks, bet septiņas ir cikliski savērptas membrānu veidotajās noslēgtajās struktūrās. Vai te atkal neparādās pitagoriska skaitļu mistika? Atvēr­tās telplaika dimensijas atbilst sakrālajam skaitlim četri, noslēgtās dimensijas — pirmskaitlim septiņi, bet to summa — pirmskaitlim vienpadsmit.

Telplaika membrānu veidotajām struktūrām (dažādu diametru «caurulī­tēm») svārstību modu skaits ir lielāks nekā superstīgām, un katram no šiem kvantizētajiem modiem atbilst noteikta elementārdaļiņa ar noteiktu masu.

Loti nozīmīgs ir M-teorijas atklājums, ka visi četri fundamentālie mijiedar­bības spēki — stiprā un vājā kodola mijiedarbība, elektromagnētiskā un^gravi- tācijas mijiedarbība — konvergē vienā punktā pie enerģijas vērtības 10 ' giga- elektronvolti. Tas nozīmē, ka Lielā Sprādziena sākumā, kad enerģija pārsnie­dza šo vērtību, fundamentālie mijiedarbības spēki nebija atdalīti un tādējādi nedarbojās mums pazīstamie fizikas likumi.

Pašlaik M-teoriju uzskata par visvairāk vispārināto vienotā lauka teoriju, ko apzīmē ar TOE, t. i., Theory of Everthing. Šī kompleksā vispārinātā teorija, metaforiski runājot, apvieno vienotā mikropasaules «orķestrī» gan stigu «instru­mentus» gan membrānu veidotās «caurules», un to kopatskaņojums veido keplerisko Musica Mundana (Pasaules mūziku).

36. MELNIE CAURUMI UN KVANTU KOSMOLOĢIJA

Saskaņā ar Einšteina vispārīgo relativitātes teoriju telpa ap masīviem ķermeņiem, piemēram, ap Sauli, ir liekta. Gaisma, virzoties liektā telpā, arī noliecas. Šādu gaismas noliekšanos eksperimentāli novēroja 1919. gadā pilnīga Saules aptumsuma laikā angļu astrofizika Edingtona organizētā ekspedīcija. Mērījumu rezultāti kvantitatīvi sakrita ar teorijas prognozēm. Tas bija spožs Einšteina 1915- gadā formulētās vispārīgās relativitātes teorijas apstiprinā­jums. Vispārīgā relativitātes teorija deva arī citus tālejošus secinājumus astrofizikā. Lielu masu tuvumā gravitācijas lauks un tam atbilstošais telpas liekums var būt tik liels, ka gaisma no šīs sistēmas vispār var neizkļūt. Tā veidojas astrofizikā pazīstamie melnie caurumi (black holes).

Modernā melno caurumu teorija balstās uz Einšteina gravitācijas vienādo­jumiem. Kā zinātnisks kuriozs minams fakts, ka 1939. gadā Einšteins mēģi­nāja uz šo vienādojumu bāzes pierādīt, ka melnie caurumi fizikāli nevar ek­sistēt, ka tie ir tikai matemātiska fikcija. Tajā pašā 1939. gadā jaunais, talantī­gais amerikāņu fiziķis, vēlākais atombumbas radītājs Roberts Openheimers pierādīja, ka melno caurumu eksistence nepārprotami izriet tieši no Einšteina vienādojumiem [10]. (Nosaukumu «melnais caurums» šiem dīvainajiem astrofizikas objektiem gan deva vēlāk — 1967. gadā — amerikāņu fiziķis Džons Vīlers.)

Kā jau minējām, patiesi dīvainas ir Einšteina likteņgaitas. Kā ietiepīgs tēvs, kas stūrgalvīgi atsakās no saviem «ārlaulības bērniem», Einšteins dzīves otrajā pusē kategoriski atteicās atzīt gan savu «pirmdzimto» — kvantu fiziku, gan melnos caurumus, kuru eksistence izrietēja tieši no viņa formulētās relativi­tātes teorijas. Vienu no cilvēces ģeniālākajiem dižgariem vajāja arī tikai ģēni­jiem piedodamas kļūdas un neveiksmes.

Modernās astrofizikas sensacionālie atklājumi burvīgi aprakstīti slavenā angļu astrofizika Stīvena Hokinga par bestselleriem kļuvušajās grāmatās «īsi par laika vēsturi» («A Brief Historj of Time», [64], 1997. gadā tulkota latviski) un «Melnie caurumi un mazulītis Universs» («Black Holes andBaby Universe», [65]). Hokings savos pētījumos mēģina saistīt vienotā teorijā kvantu lauka un vispārīgo relativitātes teoriju. Rezultātā loti interesantus secinājumus dod nenoteiktības relācijas principa izmantojums melno caurumu aprakstam. Kā parāda Hokings, melnie caurumi nebūt nav pilnīgi «melni». Saskaņā ar neno­teiktības principu gan nelielai daļai gaismas kvantu, gan elementārdaļiņām tomēr ir iespēja izlauzties no gigantiskā gravitācijas lauka, un tādējādi melnais caurums kļūst nedaudz «caurspīdīgs». Šī gaismas un tumsas robeža veido it kā mijkrēsli, chiaroscuro.

Mākslinieciski stilizēts melnais caurums un gravitācijas lauka telpa ap to parādīta 55. attēlā (2. piel.) Šis attēls rotāja žurnāla «Scientific American» 1996. gada jūlija numura vāku. Melnajā caurumā tiek ierautas zvaigznes un ieslēgta to gaisma. Tomēr pēc Hokinga formulētā kosmiskā nenoteiktības prin­cipa arī melnais caurums ir nedaudz «caurspīdīgs», to apvij gaismēnas oreols. Šis atklājums vēlreiz parāda nenoteiktības principa fundamentālo lomu Visuma uzbūvē un procesos gan mikropasaulē, gan makropasaulē. Pat vēl vairāk. Faktiskais kvantu astrofizikas iedibinātājs Stīvens Hokings uzskata, ka Heizenberga-Bora kvantu nenoteiktības principa izmantošana astrofizikā ievērojami paplašina šā principa darbības jomu, padarot to par visnozīmīgāko Visuma likumu [66]. Tas apstiprina mikropasaules un makropasaules kom­plementāro dabu — bezgalīgi mazais un bezgalīgi lielais papildina viens otru.

Abi izcilie astrofiziki un matemātiķi — Stīvens Hokings un Rodžers Pen- rouzs — 1994. gadā nolasīja Kembridžas universitātē publisku lekciju ciklu par kvantu astrofizikas un vispārīgās relativitātes teorijas mūsdienu problē­mām. 1996. gadā šis interesantais lekciju cikls apkopots grāmatā «Telpas un laika iedaba» («The Nature ofSpace and Time»), ko publicējusi izdevniecība «Princeton University Press». Grāmatas fragmenti savukārt publicēti žurnāla «Scientific American» 1996. gada jūlija numurā [66].

Šis lekciju cikls veidots kā divu pasaules izcilāko teorētiķu, divu atšķirīgu personību draudzīga diskusija. Tajā Hokings vairāk pārstāv astrofizikas, bet Penrouzs — vispārīgās relativitātes teorijas viedokļus. Bet atšķirībā no Bora un Einšteina diskusijas, kurā abi partneri pārstāvēja šķietami nesavienojamus uzskatus, Hokinga un Penrouza lekciju formā ietvertā diskusija bija komple­mentāra, jo mūsdienu apvienotā lauka teorija sevī ietver gan kvantu lauka, gan gravitācijas lauka teoriju kā savstarpēji papildinošas. Atšķirības parādās tikai detaļās un interpretāciju niansēs, kā arī salīdzinājumos, kura no teorijām ir precīzāka. Tā Rodžers Penrouzs piekrīt, ka kvantu lauka teoriju var uzskatīt par vienu no precīzākajām teorijām, kāda jebkad eksistējusi: tās precizitāte sasniedz fantastisku vērtību — 1 /1011 !

Tomēr vispārīgā relativitātes teorija var tikt novērtēta ar precizitāti līdz pat 1/101 un arī tad to ierobežo vienīgi uz Zemes pieejamo pulksteņu precizitāte. Abi zinātnieki ir vienisprātis, ka gan mūsdienu kvantu teorija, gan vispārīgā relativitātes teorija ir cilvēces radošās zinātniskās domas augstākais sasniegums.

Vēl viens interesants relativitātes teorijas secinājums ir fakts, ka laiks nav neatkarīgs lielums, tas cieši saistīts ar telpu un ķermeņu kustību tajā. Laiks ir telpas ceturtā dimensija un veido vienotu četrdimensionālu «telplaiku» (space-time). Tā redzam, cik fundamentāli kvantu un relativitātes teorija, šie cilvēciskās domas 20. gadsimta brīnumbērni, mainīja ierastos uzskatus par Pasauli, Telpu un Laiku.

Filozofiskā aspektā visnozīmīgākais ir secinājums, ka ne laiks, ne telpa nav bezgalīgs. Pasaulei ir sākums gan laikā, gan telpā, tā ir nevis bezgalīga, bet galīga.

37. LIELA SPRĀDZIENĀ (big bang) modelis

Modernajā astrofizikā par standarta modeli pieņemtā Lielā Sprādziena (Big Banģ) teorija it kā apstiprina pasaules reliģijās un tautu mitoloģijas domi­nējošās leģendas par Pasaules radīšanu. Un atkal kārtējo reizi seno laiku priekšstati gūst apstiprinājumu mūsdienu zinātnes teorijās! Viena no mate­riālistiskā pasaules uzskata pamattēzēm no seno grieķu laikiem ir bijusi stingrā ticība laika un telpas bezgalībai. Pasaule ir eksistējusi mūžīgi un mūžīgi arī eksistēs. Laikam nav ne gala, ne sākuma.

Man šāda pasaules uztvere vienmēr likusies vēl daudz mistiskāka un iracionālāka nekā Pasaules radīšanas akts ar sākumu un galu laikā un telpā. Jo pats bezgalības jēdziens ir prātam neaptverams un iracionāls savā būtībā.

Bezgalības zinātnei un filozofijai veltītās grāmatas «Bezgalība un prāts» («Infinity and the Mind», [160]) ievadā amerikāņu matemātiķis Rudijs Rakers raksta, ka cilvēkam bezgalība parasti izraisa gan godbijību, gan niecību un bailes. Šai sakarībā viņš citē franču filozofa, fizika un matemātika Blēža Paskāla domas par bezgalību: «Kad es apsveru, cik niecīgu laika sprīdi aizņem mana dzīve bezgalīgā laikā un cik mazu vietu aizņem tā telpa, kurai es pieskaros un kuru redzu, salīdzinot ar bezgalīgi lielo pasaules telpu, kuru es nepazīstu un kura nepazīst mani, es esmu baiļu un izbrīna pilns, ka esmu šeit un nevis kaut kur citur.., ka es esmu tagad un nevis citā laikā.» [160]

Ateistu un panteistu pārliecība par pasaules telpas un laika bezgalību, tāpat kā teistu sludinātais galīgā laikā fiksētais Pasaules radīšanas akts un Debesu sfēru ierobežotā Pasaules telpa, kādu iedomājās Ptolemajs un Dante, līdz pat mūsu gadsimtam bija un palika tikai akla ticība savai «vienīgajai Patiesībai». Un par to, cik liktenīga var būt pievēršanās vienai ticībai citas valdošas ticības piekritēju vidū, liecina itāļu filozofa panteista Džordāno Bruno traģiskais liktenis. Par pārliecības paušanu, ka pasaule ir bezgalīga, 1600. gadā viņu sadedzināja uz sārta kā ķeceri un brīvdomātāju Romas Ziedu laukumā. Tur kā pārmetums katoliskās Romas neiecietībai pret citādi domājošiem paceļas vien­tuļš bronzā atliets tēls — filozofs, kuru inkvizīcija tiesāja kā neticīgo, lai gan viņš svēti ticēja Pasaules Dvēselei — Anima Mundi—, kas caurstrāvo visas lietas un būtnes.

Visaptverošāk racionālā prāta ierobežotību analizējis Imanuels Kants darbā «Tīrā prāta kritika» [84, 85]. Ar «tīrā» prāta loģiku, ar deduktīvajiem slēdzieniem nevar pierādīt ne laika un telpas bezgalīgumu, ne arī galīgumu. Kanta tīrā prāta kritika pierādīja (vai, pareizāk sakot, parādīja) loģiskās domāšanas ierobežotās iespējas, deduktīvi konstruēto loģisko sistēmu nepilnību. Bet dramatiskākais trieciens deduktīvās domāšanas varenībai nāca vēlāk — mūsu gadsimta trīsdesmitajos gados — reizē ar kvantu fizikā formulēto nenoteik­tības relācijas principu. Tas saistīts ar matemātiski tik nozīmīgo Gēdela teorēmu, pie kuras pakavēsimies vēlāk.

Vispārinātie priekšstati par telpu un laiku līdz pat mūsu gadsimta sāku­mam bija galvenokārt filozofu kompetencē, absolutizētie telpas un laika jēdzieni savukārt tika aksiomātiski, bez īpašas dziļākas analīzes izmantoti gan Eiklīda ģeometrijā, gan Ņūtona mehānikā. Tikai 20. gs. laiks un telpa kļuva par dabaszinātņu izpētes objektu. Pirmkārt, Einšteina speciālā relativitātes teorija parādīja, ka laiks ir relatīvs, atkarīgs no novērotāja kustības telpā. Tālāk, vispārīgā relativitātes teorija parādīja, ka telpa var būt liekta, jo ir tieši saistīta ar debesu ķermeņu gravitācijas laukiem. Tātad eiklīdiskās skolas ģeometrija bija jāaizstāj ar sarežģītāku — Rīmana liekto telpu ģeometriju. Visbūtiskākais vispārinātās relativitātes teorijas secinājums bija, ka kosmiskajai telpai vajadzētu būt galīgai. Pats Einšteins gan iedomājās, ka šis noslēgtais Visums ir stacio­nārs. Tas ir galīgs, bet bez robežām. Gluži tāpat, kā zemeslode ir galīga, bet varam pa tās virsmu pārvietoties, neatrodot robežu. No šāda Visuma gaisma neiziet un, veidojot noslēgtu loku, principā var atgriezties savā izejas punktā. Kā ar humoru teicis ievērojamais angļu astrofizikis Edingtons, ja mēs pietie­kami ilgi skatīsimies uz priekšu, tad pēc laika varēsim ieraudzīt savu pakausi.

Galīgo, noslēgto telpu ģeniālā metaforā vizualizējis Mauritss Eshers grafikā «Mēbiusa lente II» (Moebius strip II, 1963, 56. att. 3. piel.) Tā ir galīga un reizē bezgalīga, nebeidzama (endless). Rāpojošās skudras ir uz bezgalīga, nebei­dzama ceļa, tās nekad nesasniegs kādu galīgu Mēbiusa pasaules robežu. Rak­sturīgi, ka Eshera «Mēbiusa lente II» veido sagrieztu matemātiskās bezgalības simbolu Šo horizontālo astotnieku kā bezgalības simbolu pirmais esot lietojis Džons Valliss 1656. gadā traktātā «Bezgalības aritmētika» («Arithmetica Infinitorium», [160]).

Eshera «Mēbiusa lentei II» ir arī dziļš filozofisks zemteksts. Tā vispārinātā simbolā apvieno galīgā un bezgalīgā kategoriju pretmetu vienību un, manu­prāt, ir ar tikpat dziļu vispārinātu nozīmību kā daoiskais iņ un jan simbols (1. att. 14. lpp.).

Un beidzot, ka jau minējām, šī noslēgtā telpa ietver sevī kā ceturto dimen­siju arī noslēgto laiku, veidojot saistītu četrdimensionālu telplaika kosmosu.

Telpai savukārt, kā redzējām no īsā stīgu teorijas apskata, piemīt sarežģīta mikrostruktūra, ko veido stīgu vibrācijas. Telpa ir sarežģīts stīgu audekls ar savdabīgiem mikrorakstiem, nevis vienveidīgs, viengabalains, monotons tukšums. Pasaules telpa ir daudzdimensionāla, «polifoniska» pēc savas dabas.

Krievu astrofiziķis Aleksandrs Frīdmans 1922. gadā teorētiski parādīja, ka Einšteina Universs ir nestabils, tas vai nu izplešas, vai saraujas. Un tiešām, pēc dažiem gadiem — 1929. gadā — astronoms Edvins Habls eksperimentāli apstiprināja, ka Visums tiešām izplešas. To varēja konstatēt pēc t. s. sarkanās nobīdes tālu galaktiku spektros. Šo spektrālo nobīdi izraisa fizikā pazīstamais Doplera efekts. Ja gaismas avots mums tuvojas, tad spektrālo līniju viļņu garums samazinās un notiek nobīde uz spektra zilo galu, un otrādi: ja gaismas avots attālinās, viļņu garums pieaug un spektrā novērojama sarkanā nobīde. Saskaņā ar Habla atklāto likumu tālāko galaktiku attālināšanās ātrumu resp. Visuma izplešanās ātrumu var noteikt, pareizinot galaktikas attālumu ar t. s. Habla konstanti.

Tātad no apstiprinātā fakta, ka Visums izplešas, ir jāsecina: kādreiz tas bijis koncentrēts nelielā telpā ar ārkārtīgi augstu vielas blīvumu un temperatūru. Par izplešanās sākumu uzskatāms laika moments, kuru angļu kosmologs Freds Hoils ļoti trāpīgi nosaucis par Lielo Sprādzienu (Big Banģ). Habla likums dod iespēju novērtēt Visuma «vecumu». Lielais Sprādziens, ko gribētos identificēt ar Pasaules radīšanas aktu, noticis pirms apmēram 15 miljardiem gadu.

Ka Lielais Sprādziens tik tiešām ir noticis, to vēlāk apstiprināja t. s. kosmiskā fona radiācijas mērījumi. Tos mūsu gadsimta sešdesmitajos gados Bella laboratorijās izdarīja zinātnieki Arno Alans Penziass un Roberts Vudrovs Vilsons. Mērījumiem izmantoja uz sakaru satelītiem Echo-l un Telstar novie­totu augstas jutības mikroviļņu radiometru. Vēlāk mērījumus atkārtoja uz speciāli būvētā kosmiskās fona radiācijas pētījumu satelīta (Cosmic Background Explorer (COBE) satellite), kā arī iekārtās uz Zemes un astrofizikālos balonos. Šie atkārtotie daudzveidīgie augstas precizitātes mērījumi apstiprināja, ka fona radiācija ir praktiski vienāda visos virzienos un vienmērīgi aizpilda pasaules telpu. Tas lieliski saskan ar Lielā Sprādziena teoriju. Arī šā starojuma enerģija atbilda uz šo teoriju balstītajiem aprēķiniem. Kosmiskā fona radiācija — tā sauktais reliktstarojums — tātad ir kosmiskā «pēcspīdēšana», pirms apmēram 15 miljardiem gadu notikušā Lielā Sprādziena lieciniece.

Par šo tik nozīmīgo gadsimta atklājumu Penziass un Vilsons 1978. gadā saņēma augstāko apbalvojumu zinātnē — Nobela prēmiju.

Pašreiz Lielajam Sprādzienam sekojošās Visuma evolūcijas scenārijs izstrādāts visās detaļās. Tas pazīstams kā standarta kosmoloģiskais modelis vai Lielā Sprādziena kosmoloģija.

38. LIELĀ SPRĀDZIENA (big bang) scenĀrijs [65, 199, 188]

Pēc Lielā Sprādziena notikušās Visuma evolūcijas scenāriju, kas izstrādāts t. s. standarta kosmoloģiskā modeļa ietvaros, saistoši populārā veidā aprakstījis gan izcilais amerikāņu teorētiķis — elementārdaļiņu fizikas un kosmoloģijas speciālists, 1979. gada Nobela balvas laureāts Stīvens Veinbergs un Prinstonas universitātes astrofizikis Džeimss Pībls ar līdzautoriem žurnāla «Scientific American» speciālizdevumā «Life and Universe» 1994. gada oktobra numurā [199], gan angļu kosmologs Stīvens Hokings [65], gan vjetnamiešu izcelsmes amerikāņu astrofizikis Trinhs Huans Thuans [188].

Racionālam prātam pirmie mistiskie mirkli pēc Lielā Sprādziena nav aptve­rami. Sākotnēji Visuma iedīglis kā punktiņš, kas daudz mazāks par atoma kodolu, parādās kādā superenerģizētā singulārā Tukšuma punktā. Pirms- sprādziena laiks tiek uzskatīts par imagināru, to var sākt skaitīt tikai no vis­mazākā laika «kvanta» — no 10 t3 sekundēm (prātam neiedomājami īss mirklis, decimālskaitlis ar 42 nullēm pēc komata). Šo vismazāko laika vienību pieņemts saukt par Planka «laika kvantu» vai hrononu. Kas notika pirms tam, šajā imaginārajā laikā, neviens nezina un laikam arī neuzzinās. Var tikai vērtēt, ka punktveida Visuma sākotnējā temperatūra bijusi apmēram 1032 grādi (pēc Kelvina) un tai atbilstošais vielas un enerģijas blīvums neizmērojami liels. Nākamajos ultraīsajos laika momentos — no 10"35 līdz 10"32 sekundēm — procesos, kurus apraksta amerikāņu fiziķa Alana Gūta izvirzītais hipotētis­kais inflācijas modelis, punktveida Visums izplešas līdz galda tenisa bumbi­ņas izmēriem.

Kādi fizikas likumi, kādi spēki darbojušies šajā primordiālajā Visuma iedīglī, to var tikai minēt. Zināms vien, ka tie nevarēja būt vēlāk Universā dar­bojošies četri fundamentālie mijiedarbības spēki un ar tiem saistītie fizikas likumi. Saskaņā ar Alana Gūta inflācijas modeli šajā Visuma evolūcijas fāzē, kuru bieži dēvē par Planka ēru, gravitācija ir darbojusies ar pretēju zīmi, tātad nevis kā pievilkšanās, bet gan kā atgrūšanās spēks. Šo Visuma primordiālo vei­dojumu var uzskatīt par Universa aizmetni vai «Baby Universe», kā to nosaucis Hokings [65]. Tālākajā inflācijas ēras stadijā, kas ilgst apmēram 10"'" sekundes jeb vienu pikosekundi (t. i., triljono dalu no sekundes), pingponga bumbiņas lieluma Universs loti strauji izplešas un sāk atdzist (57. att. 3. piel.). Kad temperatūra ir nokritusies līdz apmēram 1015 grādiem (100 miljonu reižu augstāka nekā Saules centrā), tikai tad sāk darboties mums pazīstamie dabas likumi un četri fundamentālie mijiedarbības spēki. Enerģijas jūrā peld, dzimst un anihilējas mazākās elementārdaļiņas — kvarki un antikvarki, kā arī elektroni un antielektroni (pozitroni). Ja daļiņu un antidaļiņu, t. i., vielas un antivielas, daudzums būtu stingri ekvivalents, tad tālākajā Universa evolūcijā anihilācijas procesi sāktu dominēt pār daļiņu dzimšanas ātrumu un tālākā evolūcija apstātos. Viens no pamatnosacījumiem, lai evolūcijas process turpi­nātos un izveidotos mūsu Visums, kurā dominē viela (nevis antiviela), sākot­nēji elektroniem un kvarkiem vajadzētu būt nelielā pārsvarā pār antielektro- niem un antikvarkiem. Tātad attīstībai nepieciešams nosacījums ir asimetrija. Var pierādīt, ka šai asimetrijai pietiek būt ar vērtību 1 /101 t. i., jābūt visnie­cīgākajam vielas pārsvaram pār antivielu! Kā šāda asimetrija radās, nav zināms, arī tas ir viens no lielajiem Dabas Noslēpumiem. Zināms tikai, ka tas, iespē­jams, ir noticis jau 10 sekundē pēc Lielā Sprādziena.

Izrādās, ka asimetrijai bijusi ārkārtīgi liela nozīme arī bioloģiskajā evolūcijā gan DNS un proteīna molekulu struktūrās, gan makroorganismu uzbūvē un funkcijās. Pie šīs ļoti nozīmīgās asimetrijas problēmas mēs atgriezīsimies 86.7. esejā .

Tā nu, pateicoties minētajai asimetrijai, jau 10"5 sekundē (t. i., simttūk- stošdaļā sekundes pēc Lielā Sprādziena) sāk veidoties vielas (bet ne antivielas) smagās elementārdaļiņas — nukloni, saukti par hadroniem (atomu kodolu sastāvdaļas), — proti, protoni un neitroni. Līdz ar to izzūd kvarki — smagāko daļiņu būvkiegeli. (Faktiski, kā redzējām, kvarki ir tās elementārdaļiņas, kuras vairs tālāk nav sadalāmas.)

Tagad jaunais Universs ir paplašinājies līdz mūsu Saules sistēmas izmēriem. Laikā no vienas līdz pusotrām minūtēm Universa apmēri paplašinās vēl apmēram tūkstoš reizes un beidzas kodolu sintēze — protoniem un neitro­niem saliedējoties, veidojas vieglo elementu — deiterija un hēlija — kodoli. Temperatūra vēl joprojām ir tik augsta, ka atomu kodoli nevar piesaistīt elek­tronus un veidot neitrālus atomus.

Visums joprojām ir «necaurspīdīgs», tas veido enerģijas (radiācijas) jūru, kurā kā plazmā peld elektriski lādētas elementārdaļiņas un atomu kodoli. Tikai pēc apmēram 300 000 gadiem gaisma atdalās no tumsas un Visums kļūst caurspīdīgs (57. att. 3. piel.). Tātad šie trīssimt tūkstoši gadu atbilst Pirmajā Mozus grāmatā, sauktā «Genesis», aprakstītās Pasaules radīšanas pirmajai dienai, kad Dievs atdala gaismu no tumsas. Pirmā bībeliskā radīšanas diena ļoti iespaidīgi attēlota Mikelandželo Siksta kapelas griestu zīmējumā (19. att. 1. piel.).

Šajā Visuma veidošanās fāzē, kad tas ir vēl apmēram 1000 reižu mazāks par pašreizējo Universu, neitrālie atomi sāk veidot gāzu mākoņus, kas gravitācijas ietekmē kondensējas pirmajos debess ķermeņos — zvaigznēs. Kad Visums jau izpleties līdz 1/5 no pašreizējā apjoma, zvaigznēm apvienojoties, veidojas pirmās galaktikas. Tas notiek pēc apmēram viena miljarda gadu. Tad jaunais Universs ir sasniedzis pubertāti.

Kad Visums jau tuvojās pusei no pašreizējiem apmēriem (apm. 1000 miljonu gaismas gadu rādiusā), zvaigznēs termiskās kodolreakcijās veidojas smagie elementi — it īpaši vēlāk dzīvības evolūcijai nepieciešamie elementi: ogleklis, slāpeklis, skābeklis.

Mūsu Saules sistēma ir samērā jauna, tās vecums — apmēram 5 miljardi gadu. Tas nozīmē, ka Saules sistēma veidojusies Visuma tapšanas pēdējā treš­daļā. Tas atbilst otrajai bībeliskajai radīšanas dienai (19. att. 1. piel.).

Modernajā Visuma kosmoloģijā organiski sakļaujas elementārdaļiņu teorija (mikrokosms) un kosmiskā astrofizika (makrokosms). Pētnieki uzskata, ka Visuma «embrijā» eksistences pirmajās sekundēs pilnībā atspoguļojas tā vēlākā makrostruktūra, pat kosmosa galaktiku sadalījums. Visa Universa evolūcijas gaita un galīgā struktūra ir it kā ieprogrammēta tās «olšūnā» — sākotnējā nelielajā «embrionālās» attīstības lodītē. Šos uzskatus apstiprina cobe pētījumu ietvaros novērotās temperatūras fluktuācijas kosmiskā fona radiācijas relikt- starojumā [188], Tātad jau pirmajās Visuma eksistences sekundēs iezīmējas visa tālākā Universa morfogenēze. Te saskarama analoģija ar dzīvo organismu morfoģenēzi. Arī šajā gadījumā jau sīkajā olšūnā ieprogrammēta komplicēta daudzšūnu organisma veidošanās gaita un galaiznākums.

Mūsdienu kosmoloģiskā teorija uzskata, ka Visums turpinās izplesties līdz noteiktai robežai telpā un laikā. Pēc tam varētu sekot kontrakcijas (saraušanās cikls). Rodas jautājums, vai Visuma saraušanās būs atgriezeniska un vai tas atgriezīsies sākumstāvoklī — pingponga bumbiņas lielumā.

Tas ir jautājums par laika simetriju Visuma izplešanās un saraušanās fāzēs. Ja saglabātos laika simetrija, tad, Visumam saraujoties, laiks tecētu pretējā virzienā — no nākotnes uz pagātni — un viss noritētu kā kinofilmā, kuru pārtin atpaka|. Vadošie kosmologi, it īpaši Rodžers Penrouzs, uzskata, ka Visuma saraušanās ciklā laikam jābūt asimetriskam. Šo asimetriju veido entro- piskā «laika bulta» evolūcijas procesā. Šie secinājumi balstās arī uz tā sauktā Veila tenzora īpašībām, kas parāda, ka telpa var būt ar dažādu liekumu arī bez masu klātbūtnes [66], Tāpēc ir izteikta hipotēze, ka Visuma saraušanās fāzē telpas un laika liekums (curvature) ir lielāks nekā izplešanās fāzē.

Rezumējot jāuzsver, ka Lielā Sprādziena modeli apstiprina trīs dažādi neatkarīgi pierādījumi: a) tālo galaktiku spektra sarkanā nobīde, kas apstiprina Visuma izplešanos Habla teorijas ietvaros; b) kosmiskā fona (reliktstarojuma) radiācijas mērījumi mikroviļņu diapazonā; c) vieglo elementu (hēlija, litija, deiterija) relatīvais blīvums kosmosā, kas sakrīt ar aprēķiniem Lielā Sprādziena mode|a ietvaros. Beidzot, Lielā Sprādziena modelis teorētiski balstās uz pašlaik vissolīdākajām teorētiskajām koncepcijām — Einšteina vispārīgās relativitā­tes teoriju, kvantu lauka teoriju un elementārdaļiņu teoriju. Šis modelis ir vispāratzīts un ieguvis standarta kosmoloģiskā mode|a nosaukumu [199].

39. VISUMA ARHITEKTONIKA UN

DIMENSIJAS

Dosimies vizuāli ilustrētā ceļojumā Visuma dzīlēs. Sāksim no Zemes — mūsu mājvietas.

Satelīta fotouzņēmums (58. att. 3. piel.) ļauj paskatīties uz mūsu burvīgo planētu — redzēt, kā tā peld uz Visuma telpas tumšā fona. Attēlā redzama Zemes rietumu puslode ar mūžam zilajiem okeāniem un jūrām, ciklonu savērptām balto mākoņu gubām, dzelteniem Āfrikas un Āzijas tuksnešiem, zaļās, mežiem klātās zonas Eiropā un Āfrikā. Tieši zaļā josla Āfrikas ekvato­riālajā zonā, kā domā antropologi, ir homo sapieris primordiālais šūpulis, no kurienes pirmatnējais cilvēks vēlāk izplatījies pa visiem Zemes kontinentiem.

Šis attēls mums atgādina, cik unikāla un trausla ir mūsu planēta Zeme. Tā ir unikāla ar zilajiem okeāna ūdeņiem, kurus — kā dzīvības priekšnosacījumu — neatrodam ne uz vienas no Saules sistēmas planētām. Un trausla tāpēc, ka pēdējā gadsimta laikā cilvēks ir, iespējams, neatgriezeniski izjaucis ekoloģisko līdzsvaru.

Tālāk, 59.a attēlā (3. piel.), shematiski atainota Saules sistēma. Tās astro­nomiskie izmēri līdzinās 10,4 gaismas stundām, t. i., gaisma, kas kustas ar ātrumu 300 000 km/s, Saules sistēmu var šķērsot 10,4 stundās.

Zilā planēta Zeme riņķo trešajā orbītā ap Sauli starp spožo Venēru un sarkanīgo Marsu — optimāli izdevīgā attālumā no Saules, lai uz Zemes varētu attīstīties un eksistēt dzīvība. Gada laikā riņķojot ap Sauli, Zeme kustas ar ātrumu 30 km/s. Tomēr, kā jau minējām, šī Kopernika atklātā heliocentriskā sistēma ir uztverama tikai intelektuālā līmenī. Fenomenoloģiskā realitāte, mūsu dzīves pieredze ir atšķirīga: mēs Zemi uztveram kā kaut ko stabilu un nekustīgu — gan kā Saules sistēmas, gan kā Visuma centru, jo kā Saule, tā planētas mūsu uztverē rotē ap Zemi. Mēs sakām: «Saule lec, un Saule noriet.»

Mūsu Galaktika, kuras sastāvdaļa ir Saules sistēma, shematiski parādīta 59.b attēlā (3. piel.). Kā redzams, tā nebūt neieņem izcilu vietu rotējošajā spirālē, bet izvietota patālu no Galaktikas centra vienā no spirāles atzariem. Saule ar planētām kopā ar šo atzaru rotē ap Galaktikas centru ar iespaidīgu ātrumu — 230 km/s. Galaktiku, pie kuras mēs piederam, zvaigžņotās debesīs var redzēt kā gaišu joslu uz citu zvaigznāju fona — kā tā saukto Piena ceļu.

Piena ceļa vārdu mūsu Galaktika mantojusi no grieķu mitoloģijas teikām [9]. Olimpa varenākajam dievam, Zibens un Pērkona pārvaldītājam Zevam, vienmēr bijusi iekāre uz mirstīgām sievietēm. Tā kādā no šīm dēkām Zevs pielavījies Mikēnu karaļa Perseja un Andromedas pēcnācējai Alkmēnei, pie­ņemdams viņas vīra izskatu. Šo grēcīgo sakaru iznākumā Alkmēne dzemdējusi dižāko no grieķu varoņiem Hēraklu. Lai Hēraklam būtu spēks, Zevs to iemānījis zīdīšanai savai greizsirdīgajai un nešpetnajai sievai Hērai. Hēra sākusi zīdīt mazuli, bet tad atklājusi viltību un atgrūdusi to no savas krūts. Varenā piena strūkla izšļakstījusies pār debesīm, un radies Piena ceļš.

Vai nav dziļi simboliski, ka grieķu astronomiskajos mītos mūsu Galaktika kondensējusies tieši no piena — zīdītāju dzīvības eliksīra? Šo notikumu burvīgā, kolorītā audeklā atainojis izcilais renesanses meistars Tintoreto.

Mūsu Galaktika nav viena, tās tuvākais kaimiņš ir cita galaktika, kurai dots nosaukums Andromeda. Arī šis vārds nāk no grieķu astromitoloģijas. Kā jau minējām, Andromeda bija Mikēnu karaļa Perseja sieva, kuru viņš ieguva, paglābjot no jūras dieva Poseidona atriebības. Arī šī mitoloģiskā tēma brīniš­ķīgi attēlota cita renesanses meistara — Pjero di Kozimo — gleznā. Tādā kārtā abas tuvākās galaktikas — mūsējā un Andromeda — ir simboliski «saradotas».

Abas galaktikas atainotas 59.c attēlā (3. piel.). Tās iekļaujas lokālās galak­tiku grupas sastāvā, kuras izmēri ir ap 10 miljardiem gaismas gadu. Arī šajā lokālajā grupā ir sava relatīvo kustību shēma — mūsu Galaktika kustas ar ātrumu 90 km/s. kaimiņienes Andromedas virzienā.

Andromedas galaktikas fotouzņēmums, kas iegūts ar superjaudīgu tele­skopu, parādīts 60. attēlā (3. piel.). Šī galaktika sastāv no miljoniem zvaigžņu, kas asimetriskā spirālē ar daudziem atzariem rotē ap blīvo centru. Šo mums vistuvāko galaktiku dažkārt dēvē par «Andromedas miglāju». Ja būtu iespē­jams paskatīties no malas, arī mūsu Galaktika būtu līdzīga Andromedai.

Lokālā galaktiku grupa, kas attēlota shēmā 59.c (3. piel.), ar fantastisku ātrumu — 600 km/s — traucas Jaunavas (Virgo) galaktiku klastera (kopas) virzienā, kas savukārt iekļaujas t. s. Lokālā Superklastera un Hydra Centaurus superklastera sistēmā, kuras izmēri ir apmēram 60 miljoni gaismas gadu (59.d att. 3. piel.).

Un te nebūt vēl nebeidzas Šivas «kosmiskā deja».

Virgo klasteru un Hydra Centaurus galaktiku superklasteru pievelk vēl cita gigantiska galaktiku agregācija, ko astronomi sauc par Lielo Atraktoru. Šie galaktiku klasteri un superklasteri, kā redzams 59.e attēlā (3. piel.), veido fantastiskas telpiskas struktūras, kas sastāv no asimetriskām galaktiku sienām, kuras aptver Kosmiskā Tukšuma kanālus. Šo stiegroto veidojumu tīkls sim­boliski atgādina Visuma Indras tīklu, bet tīri vizuāli — fraktālās bioloģiskās struktūras vai supermodernas abstrakcionistu skulptūras.

Kosmologi uzskata, ka Visuma galaktiku struktūras elementi un motīvi jau iedīglī iezīmējušies sākotnējā inflācijas fāzē pēc Lielā Sprādziena, kad Visums vēl bija mazāks par pingponga bumbiņu. Tālākajā kosmosa evolūcijā, tam izplešoties, šīs sākotnējās strukturālās iezīmes saglabājās neatkarīgi no izmēriem un pašlaik veido Visuma sarežģīto superstruktūru (59.e att. 3. piel.).

Šādu mēroga invarianci (sealing invariance) sauc par autosimilaritāti. Autosimilaritāti novēro daudzās dabas parādībās, bet īpaši bioloģisko sistēmu evolūcijā — par to sīkāk runāsim esejā par fraktāļiem un fraktāļu ģeometriju.

Šādā skatījumā Visumam ir līdzība ar dzīvu organismu. Panteistiski ievirzītās reliģijās — kā hinduisms vai budisms — Visumu arī uzskata par dievišķā iemiesojumu. Tā saskaņā ar indiešu mitoloģiju Visumu veido Radīšanas un Iznīcības dievs Šiva Nātarādža, Kosmiskās dejas Dievs. Šiva Nātarādža aizpilda Visumu, viņš ir Visums (sk. 33. eseju un 52. att. 2. piel.). Arī budistu ticējumos Visums identificējas ar dharmakāju — absolutizēto Būdas ķermeni.

40. ZEMES ĶĪMISKAS UN BIOLOĢISKAS EVOLŪCIJAS SCENĀRIJS

Pēc fascinējošās ekskursijas telpā — Visuma dzīlēs — atgriezīsimies uz Zemes un nolaidīsimies laika dzīlēs līdz pat Zemes rašanās momentam pirms apmēram 4,5 miljardiem gadu, un īsi iepazīsimies ar mūsdienu zinātnes uzskatiem par iespējamo Zemes ķīmiskās un bioloģiskās evolūcijas scenāriju [175, 57, 130a, 139].

Dzīvības izcelšanās problēma ir viena no mūsdienu zinātnes fascinējošāka­jām, bet vienlaikus arī komplicētākajām problēmām. Bioloģiskā evolūcija, izrādās, ir tikai pēdējais cēliens Zemes ķīmiskajā evolūcijā, kas sākās ar fotoķīmiskām reakcijām pirmatnējā atmosfērā un beidzās ar visvienkāršāko biosistēmu, t. s., protobiontu, izveidošanos.

Zemes ķīmisko evolūciju, ko var uzskatīt par absolūti nepieciešamu prologu dzīvās šūnas tapšanai no nedzīvās matērijas, var nosacīti iedalīt piecās stadijās:

a)   Zemes pirmatnējās atmosfēras veidošanās, radot izejmateriālu un vidi sarežģītāku dzīvībai nepieciešamo molekulu sintēzei;

b)    aminoskābju un nukleotīdu molekulu sintēze Saules radiācijas un elek­trisko izlāžu izraisītajās ķīmiskajās reakcijās;

c)    biopolimēru — proteīnu un nukleīnskābju makromolekulu — vei­došanās no aminoskābju un nukleotīdu molekulām Zemes pirmatnējo okeānu ūdeņos;

d)    biopolimēru izdalīšanās no apkārtējās vides pašorganizējošos primitīvu «šūnu», t. s. protobiontu, veidā, kuros nodrošināti virzīti vielmaiņas procesi;

e)    ģenētiskā aparāta izveidošanās, kas ļauj protobiontiem dalīšanās proce­sos reproducēties.

Zemes ķīmiskās evolūcijas sākotnējā fāze, kā domā, ir sākusies 500—600 miljonus gadu pēc Saules sistēmas rašanās, t. i., pirms apmēram 4 miljardiem gadu, kad bija pietiekami atdzisusi Zemes garoza un izveidojusies pirmatnējā atmosfēra, okeāni un kontinenti. Pats svarīgākais priekšnoteikums ķīmiskās evolūcijas pirmajam cēlienam bija tas, ka Zemes pirmatnējā atmosfēra nesa­turēja skābekli, bet sastāvēja tikai no neoksidējošām vai relatīvi inertām gāzēm: amonjaka (NH^), metāna (CH^), ūdeņraža (H2 ), slāpekļa (N2 ) un ogļskābās gāzes (CO,). Kā piecdesmitajos gados pirmie konstatēja amerikāņu biofrziķi

Harolds Kleitons Jūrijs un Stenlijs Millers [130a], šāda sastāva gāzu maisījumā ultravioletās radiācijas vai elektriskās izlādes izraisītajās fotokīmiskajās un elek­troķīmiskajās reakcijās varēja veidoties visdažādākā tipa sarežģītas organiskās molekulas, tai skaitā dzīvos organismos sastopamās aminoskābes un nukleīn­skābju bāzes — pirimidīni un purini (61. att. 154. lpp.). Vēlāk arī citās bioķīmi­jas laboratorijās modelēja fotoķīmiskās un elektroķīmiskās reakcijas, kas varētu būt notikušas Zemes pirmatnējā atmosfērā. Turklāt izrādījās, ka to reakciju efektivitāte, kuru rezultātā veidojas bioorganiskās molekulas — aminoskābes un nukleotīdi, ievērojami pieaug, ja primāro atmosfēru imitējošais gāzu maisījums satur tādas tipiskas aerobo («elpojošo») organismu indes kā sērūdeņradi (H2S), tvana gāzi (CO) un zilskābi (HCN). Turpretī nelielas skābekļa piedevas pilnīgi vai daļēji aizkavē minēto bioorganisko molekulu sintēzi.

Tātad Zemes atmosfērā pirmatnējā ķīmiskā evolūcijā radās biopolimēru «būvķieģeļi» — aminoskābes un nukleotīdi. Šajā attīstības posmā skābeklis bija augstākā mērā kaitīgs. Un otrādi — aerobiem organismiem toksiskās gāzes CO un HCN bija svarīgi atmosfēras komponenti sekmīgai ķīmiskās evolūcijas norisei.

Svarīgs arī vēl cits faktors. Tā kā sākotnējā Zemes atmosfērā nebija skā­bekļa, tad atmosfēras augšējos slāņos neveidojās ozona kārta, kas tagad pasargā Zemi no fotoķīmiski aktīvās Saules ultravioletās radiācijas. Turpretim ķīmis­kās evolūcijas sākuma fāzē bija svarīgi, lai ultravioletā radiācija sasniegtu Zemes virsmu un visā atmosfēras tilpumā izraisītu fotoķīmiskās reakcijas. No tā kļūst saprotams, ka pašreizējā Zemes atmosfērā abiogēna (neorganiska) minēto bioorganisko molekulu sintēze praktiski nav iespējama.

Pirmatnējā Zemes atmosfērā, domājams, līdzīgi sintezējās arī citi svarīgi bioorganiski savienojumi, piemēram, cukuri, taukskābes, lipīdi, kas nepiecie­šami elementāru biosistēmu izveidošanai.

Viss liecina, ka šie ķīmiskās evolūcijas procesi — sarežģītāku savienojumu veidošanās no vienkāršākiem — ir notikuši izteikti nelīdzsvarotos termodina­miskos apstākļos, kad saskaņā ar Prigožina skolas teorētiskajām nostādnēm haotiskā vidēvar veidoties jaunas — sarežģītākas skruktūras (sk. 27. eseju). Šādi evolūcijas procesi nevar notikt klasiskās termodinamikas modeļu ietvaros.

Dažādās fotoķīmiskās un elektriskās izlādes reakcijās sintezētie savienojumi, iespējams, daļēji izšķīda Zemes ūdenstilpnēs un jūrās. Ūdenim no slēgtām ūdenstilpnēm un lagūnām iztvaikojot, izšķīdušie bioorganiskie savienojumi kristalizējās plānu nosēdumu kārtiņu veidā. Šādās kristāliskās biopolimēru «būvķieģelīšu», t. s. monomēru, kārtiņās, kas pakļautas Saules ultravioletās radiācijas iedarbībai, iespējams, noritēja fotostimulēti sintēzes procesi. Kon­densējoties aminoskābēm, veidojās proteīna (olbaltuma) makromolekulas. Savukārt nukleīnskābju bāzu, ribozes un fosfātu polimerizācijas rezultātā veidojās nukleīnskābju makromolekulārās ķēdes (61. att. 154. lpp.).

61. att. Dzīvībai svarīgākie polimēri — proteīni un nukleīnskābes [175]: a — proteīna niakromolekulu veidošanās no aminoskābēm; dzīvos organismos sastopamas 20 t. s. uni­versālās aminoskābes, kas atšķiras cita no citas ar radikālu R ķīmisko struktūru; b — dezoksiribonukleīnskābes (DNS) makromolekulas veidošanās no nukleīnskābju bāzēm, dezoksiribozes un fosfātā. Četru nukleīnskābju bāzu — adenīna (A), guanīna (G), timīna (T) un citozīna (C) — secība DNS molekulā ģenētiski kodē aminoskābju secību proteīna molekulās; katrs DNS bāzu triplets (piemēram, AGC) kodē vienu noteiktu aminoskābi.

Nav izslēgta arī iespēja, ka daļa biopolimēru veidojās fotoķīmiskās reakcijās jau gāzveida fāzē. Kā liecina amerikāņu kosmokīmika Karla Seigana un citu autoru pētījumi, komplicēta sastāva ogļūdeņražu un heteroorganisko savieno­jumu polimēri var gan veidoties starpzvaigžņu telpā, gan tikt iegūti laboratori­jas apstākļos, apstarojot dažādu gāzu maisījumus ar ultravioleto radiāciju.

Tālākai evolūcijai biopolimēriem no jauna jānonāk ūdens vidē, kas bagāta ar visdažādākajiem abiogēnās fotosintēzes produktiem — taukvielām (Iipīdiem), cukuriem, taukskābēm u. c. Tur, domājams, sākas ķīmiskās evolū­cijas pēdējais — nozīmīgākais cēliens, kas ievada bioevolūcijas sākuma fāzi. Notiek biopolimēru agregātu veidošanās. Tie nodalās no apkārtējās vides ar plānām membrānu plēvītēm, kas veidotas no orientētu lipīdu vai taukskābju dubultslāņa. Šādas nodalīšanās rezultātā tad arī, domājams, tapa pirmās vis­primitīvākās biosistēmas, t. s. protobionti. Protobiontu veidošanos var imitēt arī laboratorijas apstākļos.

Šai virzienā ļoti nozīmīgus pētījumus veicis krievu bioķīmiķis Aleksandrs Oparins ar līdzstrādniekiem. Viņš pierādīja, ka ūdens vidē var mākslīgi izvei­dot dažādu biopolimēru «pilienus», t. s. koacervātus, kas ietverti plānā lipīdu vai citu bioorganisko molekulu membrānas plēvē un atgādina primitīvu šūnu. Pats nozīmīgākais, ka šādās biopolimēru koacervātu «šūnās» realizējas virzīti vielmaiņas procesi — notiek virzīta substrāta molekulu difūzija cauri «šūnas» membrānai, reakcija uz polimēru virsmas (kas šajā gadījumā imitē biokataliza- torus, t. s. fermentus) un reakcijas produktu difūzija ārā no «šūnas».

Oparina darbi ļāva domāt, ka protobiontu hipotēze ir visai ticama un tiešām varēja īstenoties agrīnajā Zemes bioevolūcijas norisē. Katrā ziņā šāds modelis labi apraksta iespējami visvienkāršāko metabolisko biosistēmu un uzsver proteīna makromolekulu primāro lomu virzītas un efektīvas vielmaiņas nodrošināšanā. Bet metabolisms, t. i., vielmaiņa, ir tikai viena no svarīgākajām dzīvo sistēmu pamatīpašībām. Otra — ne mazāk svarīga — īpašība ir bio­sistēmu spēja vairoties, reproducēt sevi. Šo aspektu par pašu nozīmīgāko savos pētījumos atzinis slavenais angļu bioķīmiķis Dž. B. Holdeins.

Pēc Holdeina domām, pirmās visvienkāršākās biosistēmas veidojuši repro- ducētspējīgi biopolimēri, kas daloties var «atkārtot» savu molekulāro struk­tūru. Kā zināms, šāda īpašība piemīt dezoksiribonukleīnskābju (DNS) mole­kulām, kuru struktūras pamatā ir dubultspirāle (14. un 62. att. 47., 157. lpp.). Šī dubultspirāle var «dalīties», sintezējot divas jaunas makromolekulu spirāles, kurās precīzi atkārtojas iepriekšējā struktūra. Šāds «ģenētiskais» biosistēmu izcelšanās aspekts — pretstatā «metaboliskajam» — uzskata, ka nukleīnskābes, nevis proteīni ir sākotnējais dzīvības pamats.

Kā vēlāk parādīja viens no izcilākajiem ķīmiskās evolūcijas pētniekiem amerikāņu bioķīmiķis Melvins Kalvins, strīds par to, vai primārie bija proteīni vai nukleīnskābes, ir līdzīgs paradoksam par vistas vai olas primātu. Pēc

Kalvina domām, sākotnēji proteīnu un nukleīnskābju abiogēnā sintēze noritējusi neatkarīgi. Bet vieni paši šie biopolimēri nespēj veidot dzīvas sistē­mas. Proteīna makromolekulas spēj veidot loti komplicētas ģeometriskas struktūras un komplementāras virsmas (62. att. 157. lpp.), uz kurām var efektīvi noritēt visdažādākās katalītiski paātrinātās bioķīmiskās reakcijas resp. proteīna molekulas var izpildīt selektīvu biokatalizatoru lomu. Fermentatīvā katalīze ir svarīgākā dzīvo sistēmu vielmaiņas iezīme. Bet proteīna makromolekulas pašas nespēj sevi reproducēt. Nukleīnskābju (DNS) makromolekulu dubultspirāles struktūra savukārt lieliski nodrošina reproducēšanās iespējas, bet to struktūras vienkāršībā izslēdz katalītisko īpašību parādīšanos.

Pēc Kalvina hipotēzes, tikai šo abu biopolimēru līniju apvienošanās radīja nepieciešamos priekšnoteikumus vienkāršāko biosistēmu evolūcijai, vienlaikus nodrošinot abas svarīgākās biosistēmu funkcijas: vielmaiņu un reproducēšanos. Šī «simbioze» bija savstarpēji izdevīga. Nukleīnskābes kļuva par dzīvo organis­mu ģenētiskās informācijas glabātājām un pārnesējām. Ģenētisko informāciju biosistēmas izmanto, lai sintezētu dzīvības procesu virzītājus — fermentus, ko veido īpašas proteīnu makromolekulas. Savukārt pašu DNS molekulu biosin- tēze var notikt tikai īpašu proteīnu fermentu, t. s. polimerāžu, klātbūtnē. Tieši ar šo «simbiozi», domājams, sākās bioevolūcijas pirmais cēliens: vienkāršāko biosistēmu — vienšūnas mikroorganismu — veidošanās.

DNS un proteīnu makromolekulu savstarpējo simbiozi, kas vienlaicīgi nodrošina gan metabolismu, gan reproducēšanās iespējas, var aprakstīt ar «dīvainās cilpas» modeli, ko vizuālā metaforā lieliski ataino M. Eshera «Zīmējošās rokas» (48. att. 2. piel.). Kā redzējām, «dīvainās cilpas» modelis realizējas gan elementārdaļiņu procesos, gan paradoksālās loģikas slēdzienos.

Ķīmiskās evolūcijas dažādās fāzes var rekonstruēt tikai hipotētiski, mēģi­not iespējamos reakciju veidus modelēt laboratorijā, bet bioevolūcijas norises «pēdas» var jau tikt dokumentāli «fiksētas». Tās saglabājušās ģeoloģiskos noslāņojumos t. s. mikrofosīliju veidā — tās ir pirmatnējo mikroorganismu un to koloniju pārakmeņojušies attēli. Ar šo metodi konstatēts, ka pirmie primitīvākie vienšūnas organismi izveidojušies pirms apmēram 3,5 miljardiem gadu, t. i., ap 500 miljonu gadu pēc Zemes ķīmiskās evolūcijas sākuma. Šie pirmie bioevolūcijas sākuma mikroorganismi pieder pie t. s. prokariotisko baktēriju grupas (no grieķu vai. pro — pirms, karjon — kodols) t. i., pie pirmskodola jeb bezkodola baktērijām. Par šo pirmatnējo baktēriju prototipu var uzskatīt zarnu nūjiņas Escherichia coli (E. coli, 62. att. 157. lpp.). Visa prokariotu ģenētiskā informācija «ierakstīta» vienā DNS molekulas dubult- spirālē, t. i., vienā vienīgā «hromosomā», kas fiksēta šūnas protoplazmā.

Pirmatnējie prokarioti bija anaerobi, tie varēja eksistēt bez elpošanas, jo Zemes atmosfēra, kā jau minēts, skābekli nesaturēja. Anaerobo mikroorganis­mu eksistences pamatā bija rūgšanas procesi, kuros abiogēni sintezētās organiskās

62. att. Hipotētiskā Zemes ķīmiskās un bioloģiskās evolūcijas shēma. Saules staru iedarbībā no Zemes pirmatnējās atmosfēras gāzēm fotoķīmiskās reakcijās izveidojās biosistēmu «būv- ķieģelīši» — aminoskābes un nukleīnskābju bāzes. No šiem biomonomēriem — saskaņā ar M. Kalvina hipotēzi — neatkarīgas evolūcijas gaitā radās biopolimēri: proteīni un nuk­leīnskābes. Šo abu biopolimēru sistēmu «simbiozē» veidojās pirmās dzīvās biosistēmas —vienšūnas organismi [175].

molekulas, ar ko bija bagātīgi piesātināti pirmatnējie ūdeņi, sadalījās ūdenī un ogļskābajā gāzē.

Šajā evolūcijas periodā anaerobie mikroorganismi strauji vairojās, padarot Zemes virsmu par lielu rūgstošu «abru». Ogļskābās gāzes saturs atmosfērā ievērojami pieauga, un pirms apmēram 2 miljardiem gadu tā kļuva par vienu no galvenajiem atmosfēras komponentiem (63. att. 159. lpp.). Tā bija pirmā grandiozā atmosfēras «piesārņošanās» globālos mērogos. Tad evolūcijā no jauna iejaucās Saule, stimulējot bioloģiskās attīstības otro cēlienu. Laika inter­vālā starp 3000 un 2500 miljoniem gadu izveidojās jauna tipa prokariotiskie mikroorganismi — fotosintētiskās baktērijas, kas pretstatā iepriekšējiem mikroorganismiem no «patērētājām» kļuva par «ražotājām». Izmantojot Saules enerģiju, tās no ūdens un ogļskābās gāzes sintezēja cukurus, taukus, olbal­tumvielas un citus sarežģītus organiskus savienojumus. Mazliet vēlāk radās vēl augstāk organizētas fotosintētiskās baktērijas, t. s. ciānbaktērijas, kas izveidoja lielas baktēriju kolonijas, kuru pēdas labi saskatāmas t. s. stromatolītu fosilijās (grieķiski stroma— gulta, lithos— akmens).

Pirms apmēram 1400 miljoniem gadu parādījās pirmie eikariotiskie vien­šūnas organismi (grieķiski eu— īsts), t. s. šūnas ar «īstiem» kodoliem (62. att. 157. lpp ). Šajā periodā dominējošie eikarioti ir vienšūnas zilaļģes.

Eikariotu šūnā DNS molekulas sagrupētas hromosomās, kas izvietotas šūnas kodolā (62. att. 157. lpp.). Bez kodola eikariotu šūnas satur vēl citus augsti organizētus elementus, t. s. organellas: hloroplastus (kuros notiek foto­sintēze) un mitohondrijas (šūnas «enerģētiskās centrāles», kurās ražo adenozīn- trifosfātus (ATF) — dzīvo organismu universālo degvielu).

Pēc nākamajiem 700 miljoniem gadu parādījās daudzšūnu aļģes un daudzas citas augu valsts formas. Zemes rūgstošā «abra» lēni un nenovēršami pārklājās ar zaļo augu segu. Sākumā tās bija aļģes un visprimitīvākie augi, bet evolūcijas cēliena beigu posmā Zemes kontinentus jau klāja milzu paparžu mūžameži. Ogļskābās gāzes saturs atmosfērā strauji samazinājās (63. att. 159. lpp.), un bagā­tajai augu valstij draudētu bojāeja, ja vien pats evolūcijas process neradītu jaunu līdzsvaru — sākumu trešajam bioevolūcijas attīstības cēlienam.

Jau fotosintētisko baktēriju parādīšanās pirms apmēram 2500 miljoniem gadu sāka ievērojami pārveidot Zemes atmosfēras sastāvu. Fotosintēzes pro­cesā tika patērēta ogļskābā gāze un izdalīts skābeklis, kura sākotnējā atmosfērā nebija. Tomēr no sākuma skābekļa daudzums atmosfērā pieauga samērā lēni, jo brīvais skābeklis stājās savienojumos, oksidējot daudzos organiskos savieno­jumus, kā arī neorganiskos elementus. Tā Zemes pirmatnējie okeāni lielās koncentrācijās saturēja divvērtīgās dzelzs jonus (Fe++ ), kas oksidējoties izvei­doja dzelzs rūdas (Fe^O^) ģeoloģiskos noslāņojumus. Tikai tad, kad uz Zemes virsmas viss, kas bija «dedzināms», tika oksidēts, skābekļa daudzums atmosfērā sāka ievērojami pieaugt. Tas notika pirms apmēram 1800 miljoniem gadu, kad

skābekļa koncentrācija atmosfērā sāka tuvoties mūsdienu līmenim — vienai piektdaļai no atmosfēras sastāva. Vienlaikus izveidojās arī ozona kārta atmo­sfēras augšējos slāņos, kas pasargāja jaunizveidotos bioorganismus no Saules fotokīmiski graujošās ultravioletās radiācijas. Tādējādi pati daba radīja ap­stākļus, lai varētu veidoties dzīvnieku valsts, kas patērē augu fotosintēzē ražoto skābekli un savukārt reģenerē augu valstij nepieciešamo ogļskābo gāzi.

Pirmās aerobās baktērijas, kas elpošanai patērēja skābekli, radās vienlaikus ar skābekļa parādīšanos Zemes atmosfērā, t. i., pirms apmēram 2000 miljo­niem gadu. Daudzšūnu dzīvnieku valsts primitīvākie pārstāvji sāka veidoties krietni vien vēlāk — tikai pirms apmēram 500 miljoniem gadu.

Sarežģīto dzīvības formu tapšanu no vienkāršām organiskām molekulām skaistā vizuālā metaforā atainojis Eshers zīmējumā, kas saucas «Evolūcija» (64. att. 3. piel.).

Kā interesantā pārskata rakstā uzsver Hārvarda universitātes biologs Stīvens Goulds [57], dzīvības evolūciju uz Zemes nevar izskaidrot agrāko konven­cionālo deterministisko modeļu ietvaros.

Augstas kompleksitātes pakāpes pašorganizējošās sistēmās, pie kurām pie­der dzīvie organismi, kvalitatīvi jauni attīstības lēcieni notiek, šīm sistēmām

63. att. Hipotētiska Zemes kīmiskās un bioevolīicijas laika skalas shēma [175, 123a],

65■ att. Dažādu organismu parādīšanās atkarībā no to sarežģītības (kompleksitates) pakāpes [57].

nonākot izteikti nelīdzsvarotā stāvoklī determinisma un indeterminisma robež- šķirtnē [3]. Saskaņā ar Prigožina skolas nelīdzsvaroto sistēmu termodinamikas nostādnēm (sk. 27. eseju), tikai tuvojoties haosa stāvoklim, var veidoties jaunas struktūras un pavērties jauni celi tālākai virzībai. Tieši šā indeterminisma komponenta dēļ dzīvības evolūcijas scenārijs principā nav prognozējams.

Stīvens Goulds parāda, ka stereotipiskais priekšstats par nemitīgo evolūci­jas progresu ir jāuzskata par maldīgu [57]. 65. zīmējumā attēlots dažādu organismu parādīšanās biežums atkarībā no to kompleksitātes pakāpes. Zīmē­juma augšdaļā attēlots primitīvo vienšūnas organismu (baktēriju) sadalījums pirrnskembrija laikmetā, bet apakšdaļā — mūsdienās. Pēc ķīmiskās evolūcijas, dzīvība izceļas pie viszemākās dzīvībai nepieciešamās kompleksitātes «kreisās sienas», no kuras sāk atskaitīt organisma kompleksitāti. Kā redzams, bakte- riālās dzīvības formas laika gaitā paliek visveiksmīgākās un vispizplatītākās. Bakteriālās formas vairāk nekā 3 miljardu gadu laikā saglabājušas savu sadalī­juma maksimumu un ir augušas spēkā. Evolūcijas gaitā baktērijas nebūt nav «progresējušas» un kļuvušas par augstākas kompleksitātes pakāpes daudzšūnu organismiem, bet stabili un ar pieaugošu intensitāti noturējušās savā nišā. Daudzšūnu organismu — dzīvnieku — parādīšanās biežums ir krītošs līdz ar kompleksitātes pakāpes pieaugumu. Tātad augstas kompleksitātes pakāpes daudzšūnu organismu parādīšanās jāuzskata drīzāk par ekskluzīvu evolūcijas brīnumu nekā par determinētu progresu. Kas to izraisījis — ļoti mazvarbūtīgu nejaušību summēšanās laika gaitā vai kāds teleoloģisks, mērķtiecīgi virzošs spēks, kas realizējas caur organisko sistēmu pašorganizēšanās principiem? Uz šo jautājumu mūsdienu zinātnei grūti precīzi atbildēt. Vienīgais secinājums — ka homo sapiens, kas parādās kompleksitātes skalas labējā malā, ir nevis evolūcijas «progresa» kronis, bet gan drīzāk unikāls blakusprodukts.

Interesanta ir arī dzīvības koka evolucionārā ikonogramma (66. att.). Sākotnējā daudzšūnu organismu attīstības fāzē dominē anatomiska un morfo­loģiska diversitāte, daudzveidība (bet sugu skaits vēl samērā neliels). Šīs daudzveidīgās dzīvības formas varam atrast tikai kā pārakmeņotas fosilijas iežu nogulumos.

Vēlākā evolūcijas stadijā daudzveidīgo formu meklējumu «eksperimenti» tiek pārtraukti, un turpmāk veiksmīgi attīstās atsevišķas sugas ar augstāku kompleksitātes pakāpi, bet ar ierobežotām anatomiskām un morfoloģiskām atšķirībām [57].

Kad Darvins 1859. gadā formulēja dabiskās izlases principu kā evolūcijas galveno dzinējspēku, tam — sākotnēji atbilstoši Rietumu 19. gs. determinis- tiskajai paradigmai — tika pierakstīts kauzālas nepieciešamības statuss. Darvins un it īpaši konservatīvie darvinisti pārāk uzsvēra sugu savstarpējās «cīņas» lomu dabiskās izlases procesā. Arī šis «cīņas» elements, domājams, ienāca 19. gs. bioloģiskajā domāšanā tiešā hēgeliskās pretstatu cīņas un progresa lozunga ideoloģijas (sk. 79. eseju) ietekmē. Tāpēc nav brīnums, ka tradicionālais darvinisms kā patoloģiskus blakusproduktus radīja arī sociālā darvinisma, nīčiskā pārcilvēka un rasisma ideoloģiju.

66. att. Dzīvības koka evolucionārā ikonogramma. Taja attēlota organismu anatomiska

diversitāte evolūcijas laikā [57].

Klasiskais darvinisms atbilstoši 19. gs. dabaszinātnes tradīcijām bija būtībā izteikti redukcionistisks, jo mēģināja visu kauzāli atvasināt no kāda sākotnēja principa. Turpretī mūsdienu zinātnē pār dzīvību sāk dominēt holistiskā para­digma (sk. 85. eseju). Biosistēmas, organismi un to populācijas jāaplūko kā viens veselums, kurā funkcionē sarežģīts mijiedarbību tīkls, ko Fritjofs Kapra sauc par dzīvības tīklu [22]. Šīs sistēmas funkcionē izteikti nelīdzsvarotā stāvoklī, jo tikai nelīdzsvarotās sistēmas spēj būt adaptīvas un evolucionēt pašorganizēšanās principa ietvaros.

Arī modernais neodarvinisms, kas balstās uz mūsdienu molekulārās bio­loģijas atzinām, ir lielā mērā saglabājis redukcionistiskas ievirzes. Šai kontekstā jāpiemin slavenā franču molekulārā biologa, Nobela prēmijas laureāta Žaka Mono populārā grāmata «Gadījums un nepieciešamība» («Chance andNecessity», [123]). Līdzīgi sinerģētikas nostādnēm Mono uzskata, ka bioloģiskajā evolūcijā darbojas abas pretmetu filozofiskās kategorijas. Izmainās ģenētiskajā mate­riālā, DNS makromolekulu informatīvajā tekstā, notiek nejaušu stohastisku faktoru (radiācijas, ķīmisko mutagēnu u. c.) ietekmē. Šīs gadījuma mutācijas gēnu DNS molekulu ķēdēs izraisa atbilstošas iedzimtības faktoru pārmainās, kas turpmāk iedzimst nākamajās paaudzēs. Gadījuma faktoru radītie mutanti savukārt tiek pakļauti kauzāli funkcionējošai dabiskai atlasei, un rezultātā izdzīvo tikai sugu cīņai vispiemērotākie un veiksmīgākie. Kā redzam, šādā pieejā dabiskā atlase simbolizē nepieciešamības kategoriju un darbojas līdzīgi sava veida Prokrusta gultai. Tādā kārtā Mono dzīvības evolūciju reducē uz ruletes spēli, kuras norisi, pēc viņa domām, regulē kvantu mehānikas var­būtības principi.

Kā sarunā ar Fritjofu Kapru saka Verners Heizenbergs ([21], 42. lpp.), Mono ir lielisks molekulārās bioloģijas popularizētājs, bet vāji izpratis kvantu fizikas filozofiskos pamatus — šajā gadījumā Bora—Heizenberga komplemen- taritātes principu. Kā trāpīgā salīdzinājumā izteicies kāds cits kvantu fizikas dižgars, pieņēmums, ka sarežģītās dzīvības formas radušās tikai gadījumu saspēles rezultātā, līdzinās apgalvojumam, ka, šaujot ar ložmetēju uz klints bluķi, varētu iegūt Milosas Venēru!

Reducējot dabisko atlasi galvenā kārtā uz cīņu starp sugām, darvinisti lielā mērā ignorē šīs «cīņas» pretmetu — sugu simbiozi. Visspilgtākais tās piemērs varētu būt zieda un bites simbioze un izcili veiksmīgā koeksistence [176], Bet daudzus simbiozes piemērus var atrast molekulārās bioloģijas līmenī. Te vis­pirms jāpiemin jau aplūkotā DNS un proteīna molekulu savstarpējā simbioze, kas, kā jau redzējām, veido lieliski darbojošos Eshera «dīvaino cilpu» (48. att. 2. piel.). Vēl jāpiemin arī daudzšūnu organismu simbioze ar dominējošo vienšūnas mikroorganismu populācijām.

Ir, protams, daudz patogēno baktēriju un vīrusu, kas naidīgi daudzšūnu organismiem. Bet vēl lielākā skaitā sastopamas simbiotiski noderīgas un vajadzīgas mikroorganismu populācijas, ko izmanto visdažādākajās biotehno­loģijas nozarēs. Tā bez rauga sēnītēm mums nebūtu ne smaržīgas rupjmaizes, ne putojoša alus, ne skābā vīna. Mikroorganismi spēj ne vien izraisīt slimības, bet arī virzīt daudzšūnu organismu evolūciju. Pēc jaunākajiem uzskatiem, jaunu sugu īpatnu veidošanos nosaka ne tik daudz stohastiskās mutācijas DNS molekulu ķēdēs, kā mikroorganismu informācijas masīvu inkorporācija (ieslēgšana) augstāku daudzšūnu organismu ģenētiskajā sistēmā. Šāda simbio- tiska jaunas informācijas «injekcija» saimnieka genomā spēj izraisīt negaidītus evolucionārās virzības efektus. Mērķtiecīgā simbioze ir raksturīgs pretmets stohastiskām «ruletes tipa» mutācijām.

Pēdējo gadu pētījumi liecina, ka paralēli «vertikālai» ģenētiskās informācijas pārnesei no paaudzes uz paaudzi notiek arī efektīva DNS molekulu «horizontālā» pārnese starp baktērijām un eikariotām šūnām augu un dzīvnieku organismos [123a]. Jau agrāk bija pazīstams t. s. konjugācijas (conjugation) tipa pārneses mehānisms starp mikroorganismu šūnām. Vienšūnas mikroorganismi ir šķietami «nemirstīgi». Daloties tie var sevi «tiražēt» daudzos identiskos «dvīņos». Bet pēc kāda laika šīs dalīšanās intensitāte pakāpeniski samazinās. Tad notiek neparasts process. Divas šūnas satuvojas, un starp tām izveidojas savienojošs tiltiņveida kanāls, caur kuru notiek ģenētiskās informācijas, t. i., tās nesēju — DNS mole­kulu —, apmaiņa. Pēc šāda konjugācijas akta, kas atgādina primitīvu dzimum- kontaktu šūnu līmenī, evolūcijā notiek lēciens un šūnas sāk atkal intensīvi dalīties. Līdzīgi konjugācijas procesi notiek arī daudzšūnu organismos [123a].

Šis piemērs uzskatāmi parāda, ka noslēgtas sistēmas pakāpeniski deģenerējas. Tikai atvērtība un informācijas apmaiņa var nodrošināt normālu attīstības gaitu. Šī likumsakarība ir kopēja gan vienšūnas organismiem, gan to populāci­jām, gan cilvēku sabiedrībai.

Bez konjugācijas ir pazīstami vēl citi ģenētiskās informācijas «horizontālas» pārneses mehānismi starp šūnām ([123a]). Viens no tiem ir t. s. transdukcijas (transduction) mehānisms. To parasti izmanto bakteriofāgi, iešlircinot caur membrānu savu gēna DNS paketi saimniekvienšūnā. Pēc šādas «ideoloģiskas diversijas» iespējami divi tālākās norises varianti. Visbiežāk fāga ģenētiskā informācija tiek izmantota, «tiražējot» fāgu, un rezultātā saimniekšūna — baktērija — tiek sagrauta. Bet iespējama arī cita virzība. Fāga injicētā DNS molekula var tikt «inkorporēta» saimniekšūnas genomā, un rezultātā veidojas jauns baktērijas «mutants». Tātad šāds transdukcijas akts var būt gan letāli iznīcinošs, gan radošs, evolūciju veicinošs.

Šādai «horizontālai» ģenētiskās informācijas pārnesei starp šūnām var būt nesalīdzināmi lielāka nozīme jaunu formu radīšanai evolūcijas procesos, nekā to iedomājās agrāk [123a].

Tātad jaunu — komplicētāku un adaptīvāku dzīvības formu veidošanos lielā mērā nosaka ģenētiskās informācijas plūsma atvērtības apstākļos.

Cits nozīmīgs mikrobioloģiskās simbiozes piemērs ir hloroplastu un mito- hondrijas inkorporācija organeilu statusā eikariotās šūnās (62. att. 157. lpp.). Tagad ir pierādīts, ka pirms eikarioto šūnu veidošanās hloroplasti un mito- hondrijas eksistēja kā neatkarīgi bioloģiski organismi. Šis ir uzskatāms paš- organizējošās simbiozes piemērs. Kā norāda Hofsteters [72], arī skudru pūzni un bišu saimi var uzskatīt par vienotu simbiotisku organismu.

Mūsdienu bioloģijā īpaši populāra ir t. s. Gajas hipotēze ([3, 22]). Saskaņā ar šo holistisko teoriju visa mūsu planēta Zeme — tās biosfēra, ūdeņi un atmosfēra— ir vienota dzīvapašorganizējoša sistēma. Gajas hipotēzi 1965. gadā pirmais izvirzīja pazīstamais amerikāņu atmosfēras ķīmiķis Džeimss Lavloks un nosauca to par godu grieķu Zemes dievietei Gajai [22], Lavloks Gajas teoriju tālāk attīstīja sadarbībā ar mikrobiologi Linu Margulisu. Mūsu apska­tītā dzīvības evolūcijas gaita uz Zemes lieliski apstiprina šīs hipotēzes nostādnes. Dzīvība pati sagatavoja uz Zemes vidi un atmosfēru savai tālākajai attīstībai. Vispirms anaerobās baktērijas rūgšanas procesos palielināja ogļskābās gāzes daudzumu atmosfērā, bet pēc tam fotosintētiskās baktērijas «saražoja» skābekli — atmosfērisko vidi, lai varētu attīstīties augu un dzīvnieku valsts (63. att. 159. lpp.).

Gajas hipotēze — tā ir jaunā holistiskās bioloģijas paradigma, kas aicināta aizstāt veco darvinistiski redukcionistisko paradigmu.

41. MŪŽĪBAS MIRKĻI- KOSMISKĀ GADA ALEGORIJA

Cilvēces prātam ir grūti aptverams gan bezgalīgi mazais, gan bezgalīgi lielais. Vai spējam iztēloties, ko nozīmē vismazākā laika vienība — Planka laika kvants, 10 " sekundes ilgais mirklis, no kura sākam skaitīt laiku pēc Lielā Sprādziena? Vai mūsu Visuma mūža ilgums — 15 miljardi gadu? Tikpat iracionālas prātam ir Visuma telpiskās dimensijas. Vismazākā telpas vienība ir t. s. Planka garuma kvants 10 33 cm. Tādi ir elementārdaļiņu vismazāko kom­ponentu, t. s. elementārdaļiņu stīgu (54. att. 137. lpp.), izmēri.

Šādus izmērus piedēvē arī singulārajam punktam, Lielā Sprādziena iedīglim. Un kā to salīdzināt ar pašreizējā Visuma izmēriem, kas pārsniedz 1000 miljo­nus gaismas gadu?

Lai iespējami uzskatāmi aptvertu Visuma pastāvēšanas ilgumu, 15 miljardus gadu aizstāj ar t. s. kosmisko gadu, kas ilgst no 1. janvāra līdz 31. decembrim. Šādi transformētā laika mērogā 500 Visuma gadi atbilst vienai kosmiskā gada sekundei.

Tātad, ja pieņemam, ka Lielais Sprādziens notika 1. janvārī pīkst. 0:00, tad mūsu galaktika, Lielais Piena ceļš, izveidojās 1. aprīlī, bet Saules sistēma tikai 9. septembrī un Zeme — 14. septembrī. Jau 9. oktobrī uz Zemes radās pirmie primitīvie mikroorganismi, bet īstenā bioloģiskā evolūcija sākās tikai decem­bra otrajā pusē: 19. decembrī parādījās pirmās zivis un citi mugurkaulnieki, 20. decembrī — augu valsts, 21. decembrī — pirmie insekti, 23. decembrī — rāpuli, bet 24. decembrī Zemi sāka apdzīvot milzeņi dinozauri; 26. decembrī parādījās pirmie zīdītāji, 27. decembrī — putni, bet 28. decembrī gāja bojā dinozauru populācija.

Pirmie hominīdi sāka apdzīvot Zemi tikai 30. decembrī, bet visas radības rota — homo sapieris— uz Visuma evolūcijas skatuves parādījās tikai pašā vec­gada nogalē — 31. decembrī pīkst. 22 un 30 minūtēs.

Ēģiptes civilizācijas uzplaukums sākās tikai 10 sekundes pirms pusnakts. Buda piedzima 5 sekundes, bet Jēzus Kristus — 4 sekundes pirms kosmiskā gada beigām. Un Mikelandželo savu slaveno Pasaules radīšanas ciklu uz Siksta kapelas griestiem (19. att. 1. piel.) pabeidza tikai vienu sekundi pirms pusnakts!

Cik nožēlojami niecīgs ir cilvēka dzīves ilgums šajā kosmiskajā laika skalā: tikai dažas sekundes desmitdaļas: no 0,1 līdz 0,2 sekundēm!

Šai kontekstā jāpiebilst, ka Vecajā Derībā aprakstītā mitoloģiskā Pasaules radīšana pirms 5758 gadiem atbilst tikai kosmiskā gada 11 sekundēm.

Vairāk nekā apbrīnojams ir indiešu mitoloģijā apcerētais Zemes vecums. Šie novērtējumi izkristalizējušies uzskatos par kalpu— Brahmas dienu, ko veido 1000 cikli jeb mahājugas, kas katra ir 4 320 000 cilvēka gadus gara [90]. Tātad Zemes pastāvēšanas ilgums, kas līdzinās vienai Brahmas dienai, ir 4,3 miljardi gadu — vairāk nekā pārsteidzoši tuvu astrofiziku novērtētajam Zemes vecumam: ap 4,5 miljardi gadu! Un atkal ar lielu pietāti jāapbrīno Austrumu gudro intuitīvās spējas ieskatīties kosmisko norišu būtībā. Turklāt indiešu mitoloģijā Visuma evolūcija tiek aprakstīta kā ciklisks process — gluži kā Lielā Sprādziena modelī, Pasaule rodas, attīstās un iet bojā, lai šo ciklu atkal uzsāktu no jauna.

Brīnišķīga filozofiski vizuāla laika relativitātes metafora atrodama latviešu (un laikam arī skandināvu) mitoloģijā — pasakā «Kas ir mūžība?».

Viens no šīs filozofiskās pasakas variantiem ir šāds. Aiz trejdeviņām jūrām, aiz trejdeviņiem kalniem gul milzīgs akmens. Pa tūkstoš gadiem reizi atlaižas mazs putniņš un noslauka knābīti uz akmens. Kad šis akmens būs nodilis, būs pagājis viens mirklis no mūžības.

Dziji filozofiski un tēlaini mūžības problēmu lakoniskā četrrindē apdziedā- jis angļu mistiķis, dzejnieks un gleznotājs Viljams Bleiks:

To see the ivorld in a grain of sand, And heaven in a ivildflower Hold infinity in the palm ofyour hand And eternity in an hour.

Ieraudzīt pasauli smilšu graudā Un debesis lauku puķē, Turēt bezgalību savā plaukstā Un mūžību just katrā stundā.

42. MŪŽĪGAIS UN MIRKLĪGAIS. AKMENS UN ZIEDA METAFORAS

Mūžīgais un mirklīgais, pastāvīgais un mainīgais, statiskais un dinamiskais — tās ir nozīmīgas Lielo Patiesību pretmetu filozofiskās kategorijas.

Filozofiskos mītos, kā tikko redzējām, akmens vai klints simbolizē mūžīgo, pastāvīgo. Turpretim ziedi — īslaicīgo, mainīgo, kādu mūžības mirkli. īpaši nozīmīga akmens un zieda pretmetu metafora ir dzenbudistu sakrālajā filo­zofijā. Akmens simbolika caurauž dzenbudistu gleznainos akmensdārzus, meditācijas un filozofisko pārdomu svētvietas. Dzenbudistu filozofiskajā gaisotnē jau 15. gadsimtā, Muromači periodā, radās t. s. japāņu stila akmens- dārzi (sekitet). Šie dārzi reprezentē abstrahētu dabas ainavu, ko veido tikai no akmeņiem un baltām smiltīm. Šo akmensdārzu stilu sauc par kare-sansui — tas nozīmē: sausā (abstrahētā) ainava. Te jāpiemin, ka japāņu vārdu «ainava» apzīmē divi hieroglifi: san — kalns un sui — ūdens. Kalnu šajā abstrakti iemūžinātajā ainavā simbolizē akmeņi, bet ūdeni — baltās smiltis, kuru klā­jumā īpaši ieveido viļņu zīmējumu [86],

Viens no Japānas visslavenākajiem dzenbudistu kare-sansui akmens- dārziem atrodas Kioto, Rjoandzi templī. To 15. gadsimtā veidojis izcilais dārzu tēlnieks Soami. Šajā akmensdārzā uz balto, viļņojošo smilšu klajuma vairākos grupējumos izvietoti 15 akmens veidojumi, kas atšķiras pēc formas, faktūras un krāsas (67. att. 3. piel.). Šis izvietojums atbilstoši japāņu estētis­kajiem principiem ir izteikti asimetrisks un akcentē Pasaules norišu nepabeig­tību un nesakārtotību [86]. Lai arī šis miniatūrais akmensdārzs aizņem tikai dažus simtus kvadrātmetru, skatītājam rodas bezgalīgi plašas telpas ilūzija. To var uztvert gan kā okeānu ar salām, gan kā mākoņu jūru, caur kuru izlaužas kalnu virsotnes.

Šo akmens un smilts poēmu ne bez pamata dēvē par dzenbudistu filozo­fisko dārzu. Tā pamatmērķis — rosināt meditējošā skatītājā pārdomas par dzīves mūžīgajām un mainīgajām vērtībām. Akmeņi sakārtoti tā, ka no jebkura skatpunkta no visiem 15 akmeņiem redzami tikai 14. Tas rosina pārdomas par to, ka Pasaulē visu nekad nevaram izzināt, paliek kāds kantisks noslēpums — lieta sevī («Dingan sich»)—, kas mūsu prātam nav pieejams. Savukārt abstraktā, mūžīgo simbolizējošā kare-sansui iekļaujas kā sastāvdaļa apkārtējā gleznainajā kalnu parku ainavā, kas mainās līdz ar gadalaikiem un uzsver nepārtraukto mainību Dabā. Šī kopaina, mūsuprāt, raksturo japāņu estētisko un filozofiski sakrālo principu nedalāmo vienību un komplementaritāti.

Runājot par dzenbudisma būtību, Guna Eglīte japāņu rakstniekam Kava- batam Jasunari veltītā rakstā [38] burvīgi pasaka: «.. dabai un cilvēkam ir vienots sākums, kas nepārtraukti attīstās un mainās. Šis vienotais sākums jeb Visuma dvēsele ietver sevī visu — ziedus, lapas, sniegu, mēnesi, kalnus un jūras, dzīvo un nedzīvo, esības un maiņas ritmus. Emocionālās vienības izjūtā ar Visuma dvēseli ne tikai cilvēks pārdzīvo sevi kā dabas daļu, bet arī daba kjūst cilvēka būtībai neatņemama. [..] Pēc dzenbudistu mācības Visuma dvēseli var uztvert garīgas atskārsmes brīdī (satori). Tieši šai brīdī, attīrot savu prātu no egoistiskām domām un izskalojot no sirds tukšu vēlēšanos smiltis, ir iespējams mentālā līmenī «pieslēgties kosmosam» — izjust, ka visam savs laiks, savs ritms, savs Ceļš. Šī izjūta paver iespējas dziļākai skaistuma uztverei.»

Mūžīguma pretpola — īslaicīguma un nepastāvīguma dzenbudiskā meta­fora ir zieds. īpašu vietu šajā poētiskumā ieņem sakuras— ķiršu — ziedēšanas pēkšņums un īslaicīgums. Ķiršu ziedēšana japāņiem ir sakrāli svētki. Viņus saviļņo ne vien tas, ka sakuras ziedu ir bezgala daudz, bet arī šo ziedu īsais mūžs. Sakuras ziedlapiņas nepazīst vītuma. Jautri griezdamās, tās līdzīgi sniega pārslām lido uz zemi pie niecīgākās vēja pūsmas. Tās nobirst pavisam svaigas, neko nezaudējot no sava skaistuma [133].

Kā jau vairākkārt esam konstatējuši, patiesi pārsteidzoša ir ideju un para­digmu kontinuitāte cauri laika gadu simtiem. Tā kādreiz, atgriezies no Japānas, apmeklēju Dainu kalnu Siguldā. Un ar patīkamu pārsteigumu pamanīju, ka Indula Rankas abstraktā skulptūra — mans mīļais «Veļu akmens» — ir idejiski tik radniecīga Rjoandzi kare-sansui vidējai pelēcīgajai akmens veidojumu grupai (sal. 67. un 68. att. 3. piel.). Rankas «Veļu akmens», kas ari simboliski asociējas ar mūžīgo, tikpat burvīgi iekļāvies apkārtējā ainavā kā Rjoandzi mūžību apliecinošie akmeņi.

Japāņiem mūžības simbols ir arī viens no pasaules skaistākajiem vulkānis­kās izcelsmes kalniem — Fudzijama (Ugunskalns). Sakuras ziedi uz sniegiem klātā Fudzi kalna fona ir vēl viena no japāņu iemīļotākajām mūžīgā un īslai­cīgā pretmetu metaforām ar dziļu filozofisku zemtekstu (69. att. 3. piel.).

Mūžības pieskārienu japāņi izjūt arī senās lietās. Viņus valdzina gan saplai­sājusi Edo perioda tējas tasīte, kas glabā neskaitāmus roku pieskārienus, gan sens nodzeltējis tušas zīmējuma tīstoklis, gan nomelnējis sudrabs un nosūnojis akmens dārzā. Šīs laika ritumā radušās iezīmes tiek apzīmētas ar īpašu estētisku katgoriju — sabi, kas burtiskā tulkojumā nozīmē «rūsa». Sabi tātad ir neviltota rūsa, arhaiska nepilnība, senatnes smarža, laika zīmogs [133].

Šādas seno laiku tradīcijas veido tautas kultūras koka sakņu tīklojumu, bez kura nespēj izdzīvot gadalaikos mainīgā lapotne.

Japāna ir sala Lielā Klusā okeāna malā, kurā satek visas kalnu upes. Japā­ņiem arī okeāns ir mūžības simbols. Tāpēc mūžību japāņu hieroglifā attēlo upes, kas saplūst okeānā (70. att. 169. lpp.).

1()K

70. att. Japāņu hieroglifs, kas nozīmē — mūžība. Piktogrāfiski tās ir kalnu upes, kas

saplūst Okeānā.

43. EINŠTEINS: «ES GRIBU

ZINĀT, KĀ DIEVS RADĪJA ŠO PASAULI.»

DIEVA EKSISTENCES IRACIONĀLĀ BŪTĪBA

Lielā Sprādziena kosmoloģija ir zinātnē apstiprināts fakts, ka Visumam ir sākums laikā un telpā, tas ir transcendents pēc savas būtības. Nevaram izbēgt no reliģiski tendēta būtiska jautājuma: vai Lielais Sprādziens bija Pasaules Rašanās vai Radīšanas akts?

Šim kardinālajam jautājumam nevarēja paiet garām ari Alberts Einšteins: «Es gribu zināt, kā Dievs radīja šo Pasauli. Mani neinteresē kāda noteikta parādība, viena vai otra elementa spektrs. Es gribu uzzināt Viņa domas; viss pārējais ir tikai detaļas.» («/ ivant to know how God created this world, I am not interested in this or that phenomenon, in the spectrum of this or that element. I ivant to know His thoughts; the rest are details», [166], 1. lpp. un 123. att. 284. lpp.)

Lielā Sprādziena kosmoloģija atrisināja kantisko dilemmu par laiku un telpu, par to, ka ar tīro (loģisko) prātu nevar secināt, vai telpa un laiks ir bezgalīgi vai galīgi, un precīzi atbildēt fizikālo teoriju un eksperimentālo atklājumu ietvaros. Vai tā dod arī tikpat precīzu atbildi uz jautājumu par Dieva eksistenci?

Jau izsenis filozofi ir mēģinājuši Dieva eksistenci pamatot racionālu sprie­dumu formā, balstoties uz Pasaules norišu vērojumiem. Šai aspektā visnozī­mīgākie ir katoļu filozofa Sv. Akvīnas Toma Dieva esamības pierādījumi. Šie uz racionālo prātu dibinātie pierādījumi izriet no Akvīnas Toma pamat- aksiomas: «Cilvēka varenākā daba ir prāts.» [194] Attīstot tālāk Aristoteļa racionālismā sakņoto filozofiju, Akvīnas Toms izstrādā mācību par pieciem domas ceļiem, kas ved pie pārliecības par Dieva esamību [94]. Šos prāta ceļus mēdz dēvēt par pieciem Dieva esamības pierādījumiem. Dievs tiek postulēts kā Pasaules pirmkustinātājs, pirmais Cēlonis, kura esamība ir nepieciešama. Dievs ir maksimālā esamība un pilnība un mērķtiecīgi virza Pasaules norises. Šie pierādījumi ir kvintesence katoliskajam intelektuālismam, kas balstās uz tēzi: «Es saprotu, lai ticētu; es ticu, lai saprastu.»

Tādā kārtā aristoteliskais racionālisms caur Akvīnas Toma darbiem tiek pārmantots racionālistiskajā Dekarta filozofijā, kas kā kartēzisms uz vairākiem gadsimtiem kļūst par Rietumu dominējošo paradigmu.

Tikai vēlāk metafiziskā racionālisma kritikas ietvaros Imanuels Kants parā­dīja, ka ar tīrā prāta loģiskajiem slēdzieniem nevar pierādīt ne to, ka Dievs eksistē, ne arī to, ka neeksistē [84].

Jau romiešu valdniekam un filozofam Markam Aurēlijām piedēvē teicienu: «Mans prāts saka, ka Dieva nav; mans prāts saka, ka Dievs ir. Bet es neesmu tik pašpārliecināts, lai domātu, ka mans prāts var izšķirt, vai Dievs ir vai nav.» Vēlāk spāņu filozofs Unamuno teicis, ka ir muļķīgi strīdēties, vai Dievs ir vai nav, — jo Dievs ir ārpus abiem šiem jēdzieniem.

Ļoti asprātīgu sentenci par šo problēmu dzirdēju no Panevēžas teātra avan­gardiskā režisora Joza Miltina: «Ja Dievs ir, Pasaules eksistence ir mistērija, bet, ja Dieva nav, tad tā ir viena liela mistifikācija.»

Atšķirībā no Sv. Akvīnas Toma ievērojamākais agrīno viduslaiku kristiešu filozofs Sv. Augustīns, kuru visvairāk ietekmējušas Platona iracionālās ievirzes, pauž uzskatu, ka Dieva esamības pierādījumi sakņojas cilvēka dvēselē. No cilvēka dvēselē mītošās patiesības Augustīns virzās uz augstāko Patiesību — atziņu par Dieva esamību [94], Augustīns, lielā mērā turpinot Platona un neo- platonistu filozofiskās tradīcijas, attīsta padziļinātu skatījumu uz cilvēka iekšējo pieredzi, parāda cilvēku kā homo interior— iracionāli un emocionāli bagātu būtni, kas tiecas pēc laimes un atrod to iekšējā skatījumā Dieva atklāsmē.

Interesanti, ka Imanuels Kants pēc racionālismā sakņotu Dieva pierādīju­mu kritikas zināmā mērā turpina Sv. Augustīna iezīmēto ceļu. Aplūkojot reliģijas problēmas, Kants uzsver: atziņa, ka pasauli radījis kāds Augstāks Prāts, nekad nevar kļūt par droši pierādītu zinātnisku faktu. Taču viņš uzskata, ka nepieciešams iztēloties Pasauli «tā, it kā pēc savas esamības un iekšējās noteiksmes tā būtu radusies no Augstākā Prāta» [84],

Šie Kanta apsvērumi pauž praktiskā prāta prioritāti pār tīro (racionālo) prātu, parāda viņa izziņas teorijas saikni ar ētiku un reliģiju. Praktiskā prāta dabiskās spējas radīt transcendentālas idejas novērš, pēc Kanta domām, mate­riālisma, naturālisma un fatālisma pretenzijas un paceļ tikumiskās idejas pāri abstraktu spriedumu sfērai [84]. Kanta pierādījumu, kas balstās uz praktisko, iracionālo prātu, Mihails Bulgakovs nodēvējis par sesto Dieva esamības pierā­dījumu [17].

Kā redzams, šīs būtiskās problēmas nostādnēs cauri gadu simtiem vijas gan racionālisma, gan iracionālisma paradigmu pretmetu līnijas.

Praktiskā prāta izauklētos secinājumus Kants izklāsta tēlainu salīdzinājumu formā: «Ja es saku: mēs esam spiesti uzlūkot pasauli tā, it kā tā būtu kādas augstākas sapratnes un gribas veidojums [ Werk], tad es īstenībā nesaku neko vairāk kā tikai: tāpat kā pulkstenis, kuģis, karapulks attiecas pret pulksteņ­meistaru, kuģubūvētāju, pavēlnieku, tā jutekliskā pasaule (jeb tas viss, kas izveido šā parādību kopuma pamatu) attiecas pret nezināmo, ko es, kaut arī neizzinu kā tādu, kāds tas ir pats par sevi, tomēr izzinu to tādu, kāds tas ir man, proti, attiecībā uz pasauli, kuras dala es esmu.» ([84], 115. lpp.)

Cik pārsteidzoša līdzība šai Kanta tēlainajai domu gaitai ar to, ko vēlāk par Dieva esamības problēmu saka mūsu gadsimta ģēnijs Alberts Einšteins…

Einšteins darbā «Par zinātni» («On Science»), runājot par kosmisko reliģiju [41], saka šādus viedigus vārdus: «Es skatos uz gleznu, bet mana iztēle nespēj vei­dot tās radītāja tēlu. Es aplūkoju pulksteni, bet nespēju iedomāties, kāds izskatās pulktsteņmeistars. Cilvēka prāts nespēj uztvert četras dimensijas. Kā gan lai viņš izprastu Dievu, kas tūkstoš gadus un tūkstoš dimensijas uztver kā vienu veselu?»

Vēlāk kādā intervijā Einšteins Dieva problēmu attēlojis zīmīgā līdzībā: «Mēs esam kā mazi bērni, kas iegājuši milzīgā bibliotēkā, kuras plaukti līdz pat griestiem pilni ar grāmatām dažādās valodās. Bērns zina, ka šīs grāmatas kāds ir uzrakstījis. Viņš nezina, kas un kā. Viņš nesaprot valodas, kurās tās rakstītas. Bet bērns atskārst, ka eksistē kāds plāns, pēc kura grāmatas sakār­totas, kāda mistiska kārtība, kuru viņš neizprot, bet neskaidri apjauš. Tāds, manuprāt, ir cilvēka prāts — pat visgudrākais un pieredzējušākais — attiecībā pret Dievu.» (Citēts pēc [51], 557. lpp.)

Neparastā rakursā Dieva esamības pierādījumus izgaismojis krievu rakst­nieks Mihails Bulgakovs epohālajā darbā «Meistars un Margarita» [17]. Literāts ateists Berliozs pie Patriarhu dīkiem tiek iesaistīts it kā nejaušā sarunā ar pašu Volandu. Saruna ievirzās par pieciem Dieva esamības pierādījumiem. Pašpārliecinātais Berliozs deklarē, ka nekādi saprātīgi Dieva esamības pierādī­jumi vispār nevar eksistēt, ka arī sestais Kanta pierādījums ir nepārliecinošs. Dieva nav. Uz Volanda jautājumu, kas tad Pasaulē nosaka lietu kārtību, Berliozs strupi atcērt: «Cilvēks pats!» Te Volands norāda, ka cilvēks var gan plānot, bet visus plānus var izjaukt slimība, piemēram, neārstējama sarkoma, cilvēks var pakjūt zem tramvaja, viņš ir mirstīgs — tā vēl pusbēda, bet viņš var mirt pēkšņi un negaidīti, lūk, kur tas joks. Vai tas neliek domāt, ka cilvēka likteņus nosaka kāda cita vara? Un tūlīt pajautā Berliozam, vai viņš droši var pateikt, ko darīs šovakar. Berliozs, protams, zina, ka šovakar piedalīsies literātu sanāksmē. «Tas nenotiks,» pārsteigtajam Berliozam paziņo Volands. «Jums tramvaja riteņi nogriezīs galvu!» Un vēl jautājums jau šoka stāvoklī novestajam literātam ateistam: «Vai Velna arī nav? Tūlīt jums uzrādīšu septīto pierādī­jumu!» Pārbiedētais Berliozs, kas tagad Volandu notur par vājprātīgu, metas bēgt, paslīd uz nejauši izlijušās saulespuķu eļļas, pakrīt zem tramvaja, un riteņi viņam patiešām nogriež galvu, kā tika pareģots.

Septītā pierādījuma būtība — Pasaulē eksistē Velns un velnišķie spēki. Un, ja eksistē Velns, eksistē arī viņa pretpols — Dievs. Šis Bulgakova izdomātais paradoksālais Dieva eksistences pierādījums atgādina t. s. apgrieztās ģeomet­riskās teorēmas pierādījumu.

Gan sengrieķu filozofs Parmenīds, gan vēlāk vācu filozofs Leibnics uzdeva jautājumu — ne mazāk paradoksālu kā dzenbudistu koanas: «Kāpēc vispār kaut kas ir, nevis — nekā nav?»

Modernās 20. gs. filozofijas ievērojamais pārstāvis Vitgenšteins to pašu formulē lakoniskā teikumā: «Mistiskais nozīmē, ka pasaule eksistē.» ([126], 15. lpp.).

Leibnics uz paša formulēto jautājumu atbildēja, ka Pasaule ir tāpēc, ka eksistē viena vienīga būtne, kuras eksistence ir nepieciešama, — Dievs. Pie Dieva būtības pieder nespēja nebūt. Tāda visumā, pēc Roberta Mūka domām, ir kristīgā teisma pozīcija [126]. Taču, kā uzskata Heidegers, šis tradicionālais teisms neizkliedē Pasaules eksistences mistēriju, pārceļot to bezgala tālajā Dieva dabā, tā kļūst vēl nepieejamāka, un, jo vairāk par to domājam, jo nesaprotamāka tā kļūst ([126], 15. lpp.).

Karls Jungs norāda: «Zinātnes un reliģijas konflikts būtībā pārprot gan zinātni, gan reliģiju. Zinātniskais materiālisms ir ieviesis tikai jaunu hipotēzi, un tas ir intelektuāls grēks. Piešķirot īstenības Augstākajam principam citu nosaukumu, tas apgalvo, ka līdz ar to esot radījis jaunu lietu un iznīcinājis veco. Vienalga, vai eksistences principu nosauc par «Dievu» vai «Matēriju», «Enerģiju» vai ari pēc patikas par jebko citu, — nekas jauns netiek radīts, vienkārši mainās simbols. Materiālists ir metafizikis malgre lui (par spīti viņam pašam).» ([79], 120. lpp.)

Kopš Dekarta laikiem Eiropā valdošais «obligātais» racionālisms radīja mākslīgu «ūdensšķirtni» starp zinātni un reliģiju. Protams, mēģinājums racio­nāli analītiskā pieejā izskaidrot reliģiskās norises beidzās ar fiasko. Ne velti Svētais Augustīns teicis: «Es ticu tāpēc, ka tas ir absurds.» Reliģiju nav iespējams izprast racionālu definīciju ietvaros.

Pretendējot būt par vienīgo īstenās patiesības paudēju un pasludinot jeb­kura veida iracionālismu — un vēl jo vairāk reliģisku misticismu — par nezi­nātnisku un tātad maldīgu, dekartiski ņūtoniskā zinātne pati sevi izolēja. Šis racionālā prāta radītais šķietamais konflikts starp zinātni un reliģiju balstījās uz ticību, ka tikai zinātnei pieder patiesības atklājējas prerogatīva. Bet, kā uzskatāmi parāda Cilvēces gara attīstības vēsture, «vienīgās» patiesības sludi­nātāji faktiski spēj atklāt tikai puspatiesību, vienu komplementāro pretmetu pāra pusi.

Mūsu gadsimta jaunās paradigmas (Gēdels, Bors, Heidegers) parādīja analītiski diskurslvās domāšanas ierobežotās iespējas un apstiprināja, ka cilvēka gars bez racionālās jomas ietver arī racionāli nedefinējamu aktivitātes sfēru, kurai var tuvoties tikai ar iracionālu intuīciju — caur dzeju, mākslu, mūziku vai reliģiski mistiskiem pārdzīvojumiem. Tikai šo pretmetu komplementārās patiesības ļauj iedziļināties visās tajās Dabas un Gara sfērās, kuras viens no mūsu gadsimta izcilākajiem domātajiem Martins Heidegers nosauca par esa­mību (das Sein, Being, l'Etre, [126]).

Volfgangs Pauli, viens no kvantu fizikas pamatlicēju kvinteta (sk. 1. tabulu 31. lpp.) visanalītiskākajiem un kritiskākajiem prātiem, līdz ar Nilsu Boru uzskatīja, ka Lielo Patiesību meklējumos komplementaritātes principa nozīme tālu pārsniedz dabaszinātņu ietvarus. Viņi uzskatīja, ka komplementaritātes princips paplašināms un attiecināms arī uz citām cilvēces gara aktivitāšu sfērām. Šādā vispārinājumā Pauli pauda uzskatu, ka zinātne un reliģija arī ir komplementāras [103]. Mēs teiktu — divas esamības reprezentācijas veido viena otru papildinošās pretmetu Lielās Patiesības. Pauli šos pretmetus redzēja vēl plašākā rakursā — kā komplementārus racionālisma un iracionālisma vai racionālisma un misticisma pārus. Pie Volfganga Pauli filozofiskajām domām atgriezīsimies 77.2. esejā.

Tātad tādi pretmeti kā Rietumu racionālisms un Austrumu misticisms vai zinātne un reliģija nevis izslēdz, bet papildina viens otru.

Interesants fakts: 18. gadsimta — racionālisma apogeja gadsimta — izcilā­kajiem zinātniekiem Kepleram, Ņūtonam, Paskālam un Leibnicam reliģiskā pārliecība un ticība Dievišķajam pirmsākumam nebūt nenonāca pretrunā ar viņu zinātnisko darbību un uzskatiem. Šie Cilvēces Dižgari tīri intuitīvi pieņēma zinātni un reliģiju kā Lielās Patiesības. Tikai Ņūtona determinisma apoloģēts Laplass maldīgā pašpārliecībā un ticībā cilvēka racionālā prāta visvarenībai varēja apgalvot, ka viņam Dieva hipotēze nav nepieciešama (sk. 4. eseju).

Austrumu reliģiju, it īpaši budisma, piekritējiem šai aspektā problēmas neradās, jo budisms identificē Dievu ar Dabu — vienā no eksistences formām Buda ir Pasaules iemiesojums ([90], 149. lpp.).

Līdzīgu nostādni pauž Spinozas filozofiskais panteisms un tā sekotāji. Arī Spinoza identificē Dievu ar Dabu, izprotot to kā vienotu, mūžīgu un bezga­līgu substanci, kas ir pati sev cēlonis un kam ir bezgala daudz atribūtu.

Daudzi zinātnieki uzskata, ka panteisms ir viņiem vispieņemamākā reliģi­jas forma. Tā arī Einšteinam budistu un Spinozas Dievs bija tuvāks nekā antropomorfais Vecās Derības Jehova [42]. Savu ticību Dievam viņš nosauca par kosmisko reliģiju. Šajā nostādnē Einšteins saskatījis gara radniecību gan ar sengrieķi Dēmokritu, gan ar Svēto Asīzes Francisku, gan ar Šopenhaueru un Spinozu [42]. Einšteins uzsvēra, ka neviens īstens dabas pētnieks nevar dzīvot bez reliģiskām jūtām. Viņš nespēja iedomāties, ka likumsakarības, kuras zināt­nieks atklāj un izprot, būtu viņa paša izdomātas. Zinātnieks jūtas kā bērns, kuru pie rokas vada kāds Pieaugušais [41].

Cik līdzīga šī godbijīgā pazemība ar otra izcila zinātnes ģēnija — Izaka Ņūtona teikto: «Es nezinu, ko par mani domā pasaule. Bet pats es jūtos kā puisēns, kas spēlējas jūras krastā un šad tad ir iepriecināts, atrodot kādu gludāku oli vai skaistāku gliemežnīcu. Bet lielais Patiesības okeāns vēl gul neatklāts manā priekšā ([32], 563. lpp.). Arī izcilais psihologs Karls Gustavs Jungs runā par dievu kā par Anima Mundi— Pasaules Dvēseli.

Vēlreiz jāuzsver milzīgais ieguldījums, ko cilvēces kultūrai devušas radošās aktivitātes racionāli nedefinējamo reliģisko pārdzīvojumu jomā. Tas izpaužas reliģiskām tēmām veltītos darbos gan arhitektūrā, gan literatūrā, mākslā un mūzikā. Te varam minēt viduslaiku un renesanses šedevrus baznīcu arhitek­tūrā — dievišķās Šartras un Strasbūras katedrāles, kā arī Pētera baziliku Romā, literatūrā — Dantes «Dievišķo komēdiju», mākslā — Mikelandželo «Pasaules radīšanu» un «Pastaro tiesu» Siksta kapelā, Leonardo da Vinči «Klinšu madonnu» un «Jāni Kristītāju», Rafaēla «Siksta madonnu», E1 Grēko «Apustuļus Pēteri un Paulu», Baha baznīcas mūziku. Vai kāds uzdrošināsies apgalvot, ka māk­slinieciski reliģiskā Patiesība šo Meistaru darbos būtu mazāk nozīmīga cilvēces gara kultūras sastāvdaļa nekā Kopernika, Keplera, Ņūtona, Bora un Einšteina zinātniskie traktāti un intelektuālie modeļi? Tās visas ir Lielo Patiesību sastāv­daļas cilvēces gara jaunrades daudzšķautņainajā polifonijā.

Nav svarīgi, vai cilvēks pieder pie kādas tradicionālas vai netradicionālas konfesijas. Viņš var būt dziļi reliģiozs, nebūdams piederīgs kādai draudzei vai baznīcai, bet būdams divtuvībā ar Dievu — kā Karls Gustavs Jungs, Volfgangs Pauli, Alberts Einšteins vai Martins Heidegers. Nozīmīga ir cilvēka attieksme pret heidegerisko esamības— Dabas un Gara — Pasauli, pret Anima Mundi— Pasaules Dvēseli.

Šādu sirds reliģiju veido cilvēka goddevība, apbrīns, atvērtība un dziļā pietāte pret šo esamību, apziņa, ka viņš ir tikai mezgla pērlīte visu Pasauli ietve­rošajā Indras tīklā (36. att. 2. piel.), reizē ar sava individuālā vienreizīguma, neatkārtojamības un sūtības apziņu. Bet, ja cilvēks neapzinās un noliedz savu piederību Dabai un pakļautību Dieva un Dabas likumiem un viņu pārņem egocentriska, laplasiska pārliecība par sava prāta varenumu, tad viņš nokļūst «vienīgo» patiesību — tas nozīmē, puspatiesību — gūstā. Tad viņu pārņem tumša kaisle pakļaut Dabu sev, pārvērst to par savas eksistences «apkārtējo vidi». Un rezultātā viņš pazudina sevi, kļūstot par savu ilūziju un pašapmāna upuri. Gribēdams kļūt par lietu valdnieku, viņš kļūst par to vergu. Viņā neizraisa apbrīnu ne «zvaigžņotā debess pār mani», ne «morāles likums manī», jo kantisko morāles likumu viņš aizstāj ar amorālo principu — «mērķis attaisno līdzekļus».

Alberts Einšteins, kā liecina minētais citāts, līdzīgi daudziem no Ņūtona un Keplera līdz pat mūsdienu kvantu fizikas dižgaru plejādei, nešaubās par Dieva eksistenci. Viņu interesē, kā Dievs radījis pasauli, kādas ir Dieva domas.

Piebildīsim ka socioloģiskā aptauja pasaules visizcilāko zinātnieku — Nobela prēmijas laureātu vidū apliecinājusi, ka ap 90% no viņiem tic Aug­stākās Varas esamībai un ir lielākā vai mazākā mērā reliģiozi cilvēki. Vai ticība ateistiskai pasaules kārtībai neliecina par gara aprobežotību vai kūtrumu, ne­spēju vai negribēšanu dziļāk ieskatīties apkārtējās makropasaules un mikro- pasaules brīnišķīgajā uzbūvē, par iztēles vai dziļākas izpratnes trūkumu, par iedzimtu vai dzīvē iegūtu gara trulumu?

44. LABAIS UN ĻAUNAIS — POLĀRI vai komplementĀri pretmeti?

Volfgangs Pauli, apcerot komplementaritātes principa filozofiskos aspek­tus, pretmetu pārus sadala komplementāros — savstarpēji papildinošos un polāros — savstarpēji izslēdzošos, kā, piemēram, pretējas polaritātes elektriskie lādiņi (sk. [103], 123., 221. lpp.).

Kā komplementārus pretmetus Pauli min zinātni un reliģiju resp. zināt­nisko un ārpuszinātnisko (parazinātnisko) pasaules skatījumu vai — plašākā kontekstā — racionālismu un iracionālismu. Šī filozofiskā interpretācija pilnībā atbilst Austrumu daoiskajām iņ un jan pretmetu komplementaritātes nostādnēm.

Turpretim, runājot par Labo un Ļauno, Volfgangs Pauli vairāk pieturas pie Rietumu domāšanas tradīcijām, uzskatot tos par polāriem, savstarpēji izslē­dzošiem pretmetiem.

Labā un Ļaunā bezkompromisa cīņa visspilgtāk izpaužas senpersiešu reli­ģijā zoroastrismā, kas nosaukumu guvusi no tās iedibinātāja Zaratustras (Zarathushtra = Zoroastrēs) vārda [90]. Zaratustra darbojies 6. gs. pr. Kr. — tajā pašā laikā, kad Ķīnā jaunās reliģijas iedibināja Laodzi un Konfūcijs, bet Indijā — Buda.

Zoroastrisma pamatos ir duālistika, nepārtraukta Labā un Ļaunā sav­starpējā cīņa. Dievišķie un Jaunie spēki izkārtoti līdzīgā hierarhijā.

Dievišķo spēku galva ir Dievs — Ahura Mazda jeb Ormazds, pilnīgi garīga būtne, mūžīgs visas gudrības avots, kas visspēcīgs kļūs tikai Pasules noslēgumā, kad būs uzvarēti visi Jaunie spēki. Ormazdam pakjauts viņa dēls — Spenta Mainju, Labais jeb Svētais gars, kam ir vienāda būtība ar Tēvu un kas izpilda Tēva gribu. (Te saskatāma cieša analoģija ar Jēzu Kristu.) Tālāk seko seši galvenie «eņģeli» — Ameša spentos—, kas kalpo Spenta Mainju un katrs veic īpašus uzdevumus. Šie seši eņģeli veido dievišķo debesu spēku kodolu [90],

Ļauno spēku priekšgalā atrodas otrs Ormazda dēls Anra Mainju jeb Ahrimans, kas arī bijis dievišķa būtne, bet izšķīries par ļaunumu un sacēlies pret savu Tēvu, kļūdams par Ļauno garu jeb Velnu, Sātanu (analoģija ar kris­tiešu Sātanu — Luciferu). Arī Ahrimanam ir pakļauti seši galvenie dēmoni kā ļaunuma pretmeti sešiem debesu eņģeļiem.

Cīņa starp Labo un Ļauno noris gan visas pasaules ietvaros, gan katrā cilvēkā. Labā un Ļaunā — Ormazda eņģeļu un Ahrimana dēmonu — spēki ir līdzvērtīgi, un ikviena cilvēka uzdevums ir palīdzēt labajiem spēkiem uzvarēt (aunos. Tomēr saskaņā ar Zaratustras mācību Pasaules finālā Ormazda spēki uzvarēs Arhimana dēmonu pulkus un iznīdēs ļaunumu. Zīmīgs šeit ir tas, ka, pēc Zaratustras domām, ļaunums ir ierobežots laikā [90]. Un svarīgi ari, ka cilvēkam tiek piedēvēta aktīva ciņa pret ļaunumu.

Ticība Labā uzvarai pār Ļauno ir laikam viens no cilvēkā dominējošajiem arhetipiem (bezapziņas pirmtēliem) jau kopš senseniem laikiem. Tas it īpaši izpaužas daudzu pasaules tautu folklorā. Atcerēsimies, ka arī gandrīz visās latviešu tautas pasakās Labais galu galā pec smagas cīņas pieveic Ļauno.

Zaratustras reliģiskā mācība ietverta Svētajos Rakstos, kas saucas «Avesta» (Likums). Senpersiešu «Avestu» un senindiešu Vēdas pamatoti uzskata par indoeiropiešu reliģiskās domas izcilākajiem pieminekļiem.

Zoroastrisms savā laikā bija viena no pasaules lielajām reliģijām. Tā vairākus gadsimtus bija valdošā reliģija spēcīgajā Persijas valstī, kas aizņēma tagadējās Irānas teritoriju un veidoja savdabīgu ģeogrāfisku un kultūras tiltu starp Austrumiem un Rietumiem. Zoroastrisms tālejoši ietekmēja vairākas pasaules reliģijas — gan jūdaismu, kristietību un islāmu, gan sengrieķu un senindiešu reliģisko domāšanu. Šajās reliģijās tika lielākā vai mazākā mērā iedēstīta doma par Labā un Ļaunā pretmetu antagonistisko polaritāti un savstarpējo cīņu.

Uzskata, ka daudzi ebreju ticējumi, piemēram, mācība par Svētā Gara un Sātana pretmetiem, cēlušies no persiešu avotiem [90]. Zoroastrisma mācībai bija liels iespaids arī uz pirmatnējo kristietību, kad tā izplatījās Mazāzijā, un vēlāk arī uz islāmu, kas gan drīz vien zoroastrismu izspieda no Mazāzijas val­došās reliģijas statusa. Mūsdienās zoroastrisma piekritēju skaits ir sarucis līdz dažiem simttūkstošiem, kas visi atrodas ārpus islāma citadeles Irānas robežām.

Sākotnējā jūdaismā Vecās Derības Dievs Jahve (no senebreju celma Jhwh) sevī apvienoja gan Labo, gan Ļauno. Viņš bija gan mīlestības, gan dusmības Dievs un savās dusmās varēja būt nežēlīgi ļauns. Te lai minam Ādama un Ievas padzīšanu no Paradīzes, Noasa laika grēku plūdus, mēra uzsūtīšanu izraēliešiem par ķēniņa Dāvida grēkiem un daudzus citus Vecajā Derībā pie­sauktus ļaunas patvaļas aktus. Tikai vēlāk parādās dēmoniska būtne Sātans (ebreju sātān— no celma stn, kas nozīmē: celt naidu, vajāt). Sātans ir ļaunais dēmons — apsūdzētājs, pavedinātājs, kārdinātājs un postītājs.

Kā vēstīts Ijaba grāmatā ([11], 1. un 2. nod.), Sātans netic cilvēka labajām īpašībām, apstaigā Zemi, vēro, kur notiek kas ļauns, un ar gandarījumu ziņo Dievam par to. Sātans tur parādās Dievu eņģeļu pulkā, un Dievs dod viņam tiesības iegrūst cilvēkus nelaimē. Tā, lai pārliecinātos par Ijaba uzticību, Dievs dod Sātanam pilnu vaļu pār Ijabu. Un Sātans iznīcina Ijaba mantību, ganām­pulkus, ganus un kalpus, dēlus un meitas un piemeklē pašu Ijabu ar ļaun­dabīgiem augoņiem no kāju pēdām līdz matu galiem. Te Sātans darbojas kā Dieva kalpotājs, Viņa gribas vai iegribu izpildītājs.

Sātans kā Dievam naidīga būtne parādās tikai vēlīnajā jūdaismā un, kā uzskata, galvenokārt duālistiskās persiešu reliģijas ietekmē. Vēlāk Sātans pazīs­tams arī kā Belcebuls (cēlies no vārda «Baalsebūb», kas nozīmē — «mušu ķēniņš»).

Pirmkristieši pārņēma jaunākā jūdaisma uzskatus par Sātanu (vai Belce- bulu) kā Dievam naidīgu pretmetu. Jaunajā Derībā Sātans figurē kā dēmonu virsnieks, laicīgās pasaules valdnieks, kuram, kā parādīts Jēzus kārdināšanas ainā, dota visa vara pār Zemi ([11], Mateja evaņģ. 4:8-10). Dieva un Sātana pretstats sevišķi izceļas Jāņa evaņģēlijā, kur arī minēts, ka Kristus nācis pasaulē Sātana darbu iznīcināt.

Kristietības tradīcijās Sātans tiek identificēts arī ar Lucifera vārdu. Lucifers ir pret Dievu sadumpojies eņģelis, kas kritis nežēlastībā un ir citu kritušo garu un dēmonu vadonis, visaugstākā ranga velns. (Te jāpiezīmē, ka Lucifera vārda nozīmes etimoloģija ir ironiski divdomīga, proti, latīniskās izcelsmes vārds «lūcifer» radies no «lux» — gaisma un «ferre» — nest, tātad nozīmē — gaismas nesējs.) Jāpiebilst, ka jūdaisma un kristietības Jaunais gars, Sātans, a la Belcebuls vai Lucifers, nebūt nav persiešu Ahrimana līdzinieks — viņš, kā redzējām, bija līdzvērtīgs Ormazda pretinieks. Jūdaismā un kristietībā Dieva un Sātana, Labā un Ļaunā pretmetu polaritāte ir nosacīta. Sātans būtībā paliek pakļauts Dieva varai un var valdīt pasaulē tikai tik, cik Dievs tam ļauj. Tātad jūdu un kristiešu reliģiskajos pasaules uzskatos Dievs nes pilnu atbildību par pasaulē notiekošo ļaunumu. Bet kā visvarenais un cilvēku mīlošais Dievs var pie|aut triumfēt ļaunumam un ciest nevainīgiem? Tieši teodīceja— Dieva attaisnošana par to, ka pasaulē eksistē ļaunums, — ir visu reliģiju visgrūtāk risināmā problēma [115]. Visracionālākais tās skaidrojums ir budistiem, kas tic pārdzimšanai (reinkarnācijai) un uzskata, ka ciešanas ir sods par iepriekšējās dzīves grēkiem. Kristietība un islāms neizskaidrojamās un neremdināmās ciešanas, kas cilvēkam šķiet uzliktas nepelnīti, attaisno ar gaidāmo mūžīgo svētlaimi viņpasaulē.

Nepelnītu ciešanu piemeklētais Ijabs Dieva rīcību skaidro tā: «Ja mēs esam no Dieva labu saņēmuši, kā tad lai mēs arī nesaņemam ļaunu?» ([11], Ijaba grāmata.)

Bet kā lai skaidro nāvei ziedoto ganu zēnu, Ijaba dēlu un meitu — šo nevainīgo būtņu — ciešanas Dieva un viņa sūtņa Sātana kopējā eksperimentā, kas bija domāts tikai Ijaba ticības pārbaudei?

Teodīcejas problēma līdz galējībai saasināta Fjodora Dostojevska reliģiski filozofiskajā romānā «Brāļi Karamazovi» [34], Ik rindkopā jūtama Dostojev­ska ticības un šaubu nerimstošajā cīņā atkailinātā dvēsele. Izcilā viņa daiļrades pētniece Zenta Mauriņa uzskata, ka rakstnieka dvēselē vienlaicīgi iemājo

Dona Kihota ticība un Hamleta šaubas [115], kas iemiesojas viņa radītajos tēlos: ticība un mīlestība tēvā Zosimā un jaunākajā Karamazovā — A|ošā, bet mūžīgās šaubas — intelektuālajā dumpiniekā Ivanā Karamazovā. Aprakstot liktenīgo sarunu, kad Ivans brāli Alošu iepazīstina ar savu eseju «Lielinkvizi- tors» (Kop. r., 9. sēj., 283. lpp.), rakstnieks pievērsies tieši teodīcejas problē­mai. Baznīca māca, ka bērniem jācieš par tēvu grēkiem, bet tāds skaidrojums nav cilvēka sirdij saprotams. «Nevar likt nevainīgam ciest citu grēku dēļ!» izmisīgi iesaucas Ivans.

Pie spēcīgākajām un briesmīgākajām Dostojevska darbu lappusēm pieder bērnu mocīšanas apraksti: ģenerāla uzrīdīti medību suņi saplosa puisēnu mātes acu priekšā; truli, sadistiski vecāki spīdzina meitenīti, kas velti piesauc Dievu; trūkuma nomocītais un pamestais puisēns I|juša lēni mirst. Tādas lietas ir ne vien notikušas, bet notiek arī vēl tagad, taču visi mierīgi turpina dzīvot un runā par kultūru un civilizāciju [115].

Bērnu bezjēdzīgo ciešanu satraukts, Ivans Karamazovs saka: «Es esmu blakts un pilnīgā pazemojumā atzīstos, ka nekā nevaru saprast, kam tas viss tā iekār­tots. Ja visiem jācieš, lai ar ciešanām iemantotu mūžīgo harmoniju, tad kam te bērni?.. kāpēc arī viņi mēslojuši ar sevi nezin kam nākamo harmoniju?»

Ivans ar šausmām noraida tādu harmoniju. Mūžīgā harmonija «nav vērta kaut vienas nomocīta bērna asariņas». Neaizsargāto — it sevišķi bērnu — ciešanas viņam vienmēr ir apsūdzība pret Dievu: «Ir ciešanas, nav vainīgā.»

«Ja bērnu ciešanas tiek ieskaitītas tai ciešanu summā, kas vajadzīga patie­sības pirkšanai, tad es iepriekš apgalvoju, ka visa patiesība nav šīs maksas vērta .. Es negribu tādu harmoniju, negribu to aiz mīlestības pret cilvēci .. Pārāk dārgi ir novērtējuši šo harmoniju, mēs neesam tik bagāti, lai tik daudz maksātu par ieeju .. Nevis Dievu es neatzīstu, es tikai ieejas biļeti viņam vispazemīgākā kārtā atdodu atpakaļ,» saka dumpinieks Ivans Karamazovs.

Dostojevskis nepieņēma domu, ka ar kādas būtnes — turklāt vājas, mazas, bezvainīgas — ciešanām kāds cits varētu samaksāt par grēku piedošanu vai pacelties par dažiem pakāpieniem tuvāk Dievam. Viņš neticēja abstraktai nākamības cilvēcei, kuras dēl jānes upuri, neticēja arī Nīčes sludinātajam pār­cilvēkam, kas piesavinājies Dieva tiesības; viņš ticēja, ka ikvienā cilvēkā ir slēp­tas dievišķās iespējas, iesēta Dieva sēkla: «Dievs ir ņēmis sēklu no citām pasaulēm un izsējis to šajā zemē, un ieaudzējis savu dārzu .. Bet izaudzētais dzīvo un ir dzīvs tikai no sajūtas, ka tas saskaras ar citām, noslēpumainām pasaulēm; ja šī sajūta tevī kļūst vājāka vai iet bojā, tad mirst arī tas, kas tevī izaudzēts. Tad tu kļūsi vienaldzīgs pret dzīvi un to pat ienīdīsi.» Tā māca Dostojevskis ar svētnieka Zosimas vārdiem. Katrā cilvēkā ir Dieva sēkla, un tāpēc neviens cilvēks nevar būt līdzeklis mērķa sasniegšanai, lai arī mērķis būtu cik cēls būdams. Te Dostojevska mācība par Labo cieši saskaras ar Kanta ētiku [115].

Dekartam cilvēks ir domājoša būtne, Dostojevskim — ar sirdi jūtoša. Prāts, cilvēka lielākais kārdinājums, perina Ļauno, ja šķirts no sirds [115]. Pie kā noved auksts prāts, bezsirds racionālisms, Dostojevskis uzskatāmi parāda Lielinkvizitora monologā. Viņš ir adekvāts sava prototipa —baznīcas klēpī izauklēto dogmatisko sholastu un inkvizitoru saimes — iemiesojums. Tie bija augsti izglītoti intelektuāli, latinizēto Svēto Rakstu zinātāji. Un pārliecināti cīnītāji pret Ļauno, kas nāk no Velna un tā kārdinājumiem.

Problēmas būtību, apcerot inkvizīcijas tēmu, literāri precīzi formulējis Tomass Manns «Doktorā Faustā»: «Bet kas vieda kārdinājumu? Kas bija par to nolādams? Viegli teikt — kārdinājums nākot no velna! Tas bija pirmavots; lāsts turpretim piederēja rīkam. Kārdinātāja rīks, viņa ierocis bija sieviete.» [112]

Raganībā apsūdzētās vai aizdomās turētās sievietes tika rafinēti spīdzinātas, līdz kamēr viņas atzinās, ka piedalījušās raganu un velnu orģijās, kailas jājušas uz slotas vai pie mierīgi dusoša vīra sāniem kopojušās ar inkubu, un inkvizīci­jas tiesa nešauboties lēma tās publiski sadedzināt sārtā. Inkvizitoru loģika bija dzelžaina. Sadedzinot grēcinieces miesu, tās dvēsele tiks glābta no elles liesmām. Pēc arhīvu datiem lēš, ka inkvizīcijas laikos Eiropā kā raganas sade­dzināja vairāk nekā miljonu sieviešu ([180], 61. lpp.). Tas bij reliģiska fanā­tisma inspirēts masveida sadisms.

Dostojevskis paredzēja, kādas briesmas cilvēcei draud no abstraktā prāta, kas no jauna sāka dominēt 19. gs. beigās. «Velnos» viņš pravietiski attēlo visdažādākās sugas intelektuālus, ļaunuma dēmona apsēstus cilvēkus, kas gatavi uz jebkādu neģēlību, jo viņu smadzenēs reliģisko fanātismu aizstājis idejiskais fanātisms. Kad reliģijai vairs netic, prāts radušos vakuumu aizpilda ar ideoloģiskām dogmām.

Dostojevskis prātam un zinātnei ierāda tikai palīglomu; viņaprāt, kultūra, kas balstīta tikai uz prātu un zinātni, ir baismīga. Civilizācija, kam nav sakņu, rada intelektuāļus bez dvēseles un ved pie ateisma un sātanisma. «Velnos» Dostojevskis pravietiski paredz, ka tuvojas Sātana valstība, kurā cilvēkus apsēdīs ideja izdarīt varmācīgu apvērsumu un pasauli pārveidot atbilstoši savām teorijām, noziegumus un brutalitāti padarot par sistēmu un sankcionē­jot varasdarbus un slepkavības nodomāto mērķu sasniegšanai [115]. Dostojevska 19. gs. nogalē izteiktais pravietojums visā pilnībā piepildījās mūsu gadsimtā: Krievijā un Vācijā dzima visbriesmīgākie totalitārisma monstri. Ļaunuma impērijas, kuru valdīšanas laikā gan komunistu Gulaga nāves nometnēs, gan nacistu gāzes kamerās gāja bojā miljoniem nevainīgu cilvēku.

Un te atkal vēl sakāpinātākā formā mums jāatgriežas pie teodīcejas problē­mas. Vai tad nebija Dieva spēkos novērst drausmīgās vēsturiskās kataklizmas, miljoniem nevainīgu cilvēku ciešanas un bojāeju? Vai varbūt Dievam bija citi nolūki un Viņš uz laiku pasauli nodeva Sātana varā, sodot cilvēkus par grēkiem? Taču kristietībā Sātanam nekad nav ierādīta tāda suverēna vara, kāda persiešu reliģijā dota ļaunajam dēmonu valdniekam Ahrimanam. Dostojevskis «Brāļos Karamazovos» apliecina, ka kristietības Sātans ir tikai izpildītājs un ierocis Dieva rokās.

Ivanam murgainā vīzijā parādās pats Velns un iesaista viņu diaboliskā dialogā. Velns stāsta, ka viņam savs amats esot līdz nāvei apnicis, taču viņš nedrīkstot atstāt posteni, un pienākums liekot turpināt visas velnišķības. No cilvēces posta velns novēršas: «Ne jau es to esmu radījis, man par to nav jāat­bild. Vienīgi dienesta pienākumu un sava sociālā stāvokļa dēl es biju spiests nomākt sevī cēlumu un palikt pie cūcībām: .. es musinu un, zobus sakodis, izpildu savu uzdevumu: pazudināt tūkstošus, lai izglābtos viens. Cik daudz, piemēram, vajadzēja pazudināt dvēseļu, lai dabūtu vienu vienīgu taisno Ijabu, ar ko mani toreiz tik nejauki izākstīja!» [34] Tāda patiesi velnišķa ētika ir Dostojevska velnam, kas apsēdis Ivanu Karamazovu. Viņš savu darbu dara pēc pavēles un aiz pienākuma: gluži tāpat, kā to dara cietumsargi un bendes, algotņi un spīdzinātāji — gan lielāki, gan mazāki [115].

Pavisam citā aspektā Labā un Ļaunā problēmu risina Johans Volfgangs Gēte savā filozofiskajā mūža drāmā «Fausts». Mefistofelis, ieradies pie Fausta, apliecina, ka viņš vēloties ļaunu, bet darot tikai labu. Mefistofelis kļūst par Fausta partneri, par viņa otro «Es». Faustā kā pretmeti sadzīvo un viens otru papildina gan labais, gan ļaunais. Savam vēlākajam biogrāfam Ekermanim Gēte esot teicis, ka Fausts un Mefistofelis abi esot daļa no viņa paša [115]. Tā ir atziņa, ka katrā cilvēkā vienlaikus mājo gan dievišķais, gan velnišķais. Tāpat kā ikvienā cilvēkā varam dažādās proporcijās atrast gan Dona Kihota ideālismu, gan Sančo pragmatismu.

Labā un Ļaunā pretmetu komplementaritātes ideju, kas būtībā ir tuva Aus­trumu domāšanas tradīcijām, lieliski pārtvēris Tomass Manns. Romānā «Lote Veimārā», kas aptver kādu Gētes dzīves posmu, viņš turpina attīstīt «Fausta» autora aizsākto ideju. Romāna varonis doktors Rīmers, runājot par Gēti, saka savai sarunu biedrenei ([110], 79. lpp.): «.. ir maldīgi uzskatīt Dievu un Velnu par pretējiem principiem. Drīzāk, pareizi skatoties, Velnišķais ir tikai viena puse, .. Dievišķā mugurpuse. Kā gan citādi. Tā kā Dievs ir Veselais, tad arī Velns ir Veselais, un nav iespējams tuvoties Dievišķīgajam, netuvojoties arī Velnišķīgajam. Tā ar vienu aci, tā sakot, skatāmas Debesis un mīlestība, ar otru — ledainā negācijas elle un visiznīcinošā neitralitāte. Bet divas acis, mana dārgā, vai nu tās novietotas tuvāk vai tālāk viena no otras, dod tikai vienu skatu. Un atļaujiet jautāt, kāds ir šis skats, kurā acu baismā pretruna izlīdzi­nās? Es to jums pateikšu un arī sev pašam. Tas ir mākslas skats, kurā vien­laikus ir absolūtā mīlestība un absolūtā iznīcība vai vienaldzība, un tas nozīmē baismīgo tuvošanos Dievišķi Velnišķajam, kuru mēs dēvējam par «Dižumu»…»

Epohālajā darbā «Doktors Fausts» [112] Tomass Manns vēl reljefak attīsta Labā un Ļaunā komplementaritātes ideju. Tā iekļauta teoloģijas privātdocenta

Šlepfūsa lekcijās, ko klausās romāna galvenais varonis, kuram nākotnē lemts k[ūt par izcilāko atonālās polifonijas komponistu. Šlepfūsa lekcijās centrālo vietu ieņem Ļaunā un Labā dialektiskās vienības problēma vai, kā mēs teiktu, komplementaritāte. Tieši šī problēma teodīcejā ir visnozīmīgākā.

Tomass Manns liek Šlepfūsam apgalvot: «Ļaunais sekmēja Visuma pilnību, bez tā Visums nebūtu pilnīgs, tāpēc Dievs to pieļāva, jo, pats būdams pilnīgs, bija spiests gribēt pilnību — nejau absolūti Labā, bet gan vispusīga un mij iedarbīga eksistences kāpinājuma izpratnē. Ļaunais kļuva vēl daudz ļaunāks, jo pastāvēja Labais, bet Labais — daudz jaukāks, ja eksistēja Ļaunais; varbūt par to varēja strīdēties — Ļaunais vispār nebūtu ļauns, ja nebūtu Labā, un Labais arī nemaz nebūtu labs, ja nepastāvētu Ļaunais. Vismaz Svētais Augustīns bija uzdrošinājies secināt, ka Ļaunā funkcija esot jo vairāk izcelt Labo; salīdzinājumā ar Ļauno tas topot vēl tīkamāks un slavējamāks. Pret to gan bija iebildis Akvīnas Toms, brīdinādams: bīstami esot domāt, ka Dievs vēloties, lai notiktu Ļaunais. Dievs nevēloties to, tāpat kā Viņš nevēloties, lai Ļaunais nenotiktu, bet, nedz vēlēdamies, nedz nevēlēdamies, atļaujot pastāvēt Ļaunajam, un tas, saprotams, veicinot pilnību. Taču maldīgs būtu apgalvojums, ka Dievs pieļaujot ļaunumu Labā interesēs; jo neesot uzskatāms par labu tas, kas pats par sevi neatbilst «Labā» idejai, bet atzīts par tādu, ārēji salīdzinot. Galu galā, teica Slepjīiss, šeit rodoties absolūti Labā un Ļaunā problēma, labā un daiļā neatkarīgi no ļaunā un neglītā — absolūtās kvalitātes problēma. Kur trūkstot salīdzinājuma, viņš sacīja, zūdot arī mēraukla un vairs nevarot būt runa ne par kaut ko smagu vai vieglu, ne lielu vai mazu. Labais un daiļais tādā gadījumā tiktu reducēti par bezkvalitātes esību, visai līdzīgu nebūtībai un, iespējams, nemaz ne augstāk vērtējamu.

īstais Dieva attaisnojums, ievērojot pasaules postu, — turpināja diktēt Slepfūss, — pastāvot viņa spējā no ļauna radīt labu. Sai īpašībai Dievam par slavu katrā ziņā jāizpauioties darbībā, un tai nebūtu kur atklāties, ja Dievs dzīvo radību nebūtu atdevis grēka varā. Tad Visumam paliktu apslēpts tas labais, ko Dievs prot radīt no ļaunā, no grēka, netikuma un ciešanām, un eņģeļiem tad būtu mazāk iegansta tā Kunga slavināšanai. Protams, atgadoties arī otrādi, kā ik uz sola mācot vēsture, — no labā rodoties daudz ļauna, tā ka Dievam, lai to novērstu, būtu jāaizkavē arī labais un vispār nevajadzētu pieļaut Pasaules pastāvēšanu. Bet tas būtu pretrunā ar Radītāja būtību, un tādēļ Dievs radījis Pasuli tādu, kāda tā ir, proti, ļaunuma cauraustu, tas ir, daļēji pametis Pasauli dēmonisku spēku varā.»

Šie Tomasa Manna uzskati par Labā un Ļaunā savstarpējo komplementa- ritāti ir pārsteidzoši tuvi gan tradicionālajai Austrumu reliģiski filozofiskajai domāšanai, gan mūsdienās dominējošajai pretmetu komplementaritātes para­digmai arī citās cilvēces kultūras jomās. Tas iezīmē izmaiņas Rietumu tradīci­jās tik ilgi valdījušajos uzskatos par Labā un Ļaunā pretmetu antagonistisko, savstarpēji izslēdzošo polaritāti.

Austrumiem raksturīgā Labā un Ļaunā pretmetu interpretācija visspilgtāk izpaužas hinduisma nostādnēs. Hinduisms, kā zināms, ir pati lielākā un nozī­mīgākā Dienvidāzijas reliģija, no kuras lielā mērā izaugušas ari vairākas citas Austrumu reliģijas, piemēram, budisms un džainisms [90]. Hinduisma Mahadeva (Lielais Dievs) ir Šiva («Laimi nesošais»), Šiva ir vienlaicīgi Labais un Ļaunais, radītājs un iznīcinātājs, dzīvība un nāve. Šis būtiski pretrunīgais raksturs personificē pretmetus pašas dabas spēkos. Tā mākoņi var atnest gan auglīgu lietu, gan postošus orkānus un plūdus. Saule var gan sniegt dāsnu siltumu un auglību, gan izdedzināt. Daba var būt cilvēkam gan draudzīga un vēlīga, gan naidīga un iznīcinoša. Tie ir pretmeti, kas papildina viens otru.

Šiva ir cildens askēts un jogas ceļa gājējs, kas vientulībā meditē Himalaju kalnos. Bet tai pašā laikā Viņš ir Nātarādža— kosmiskās dejas dievs, kas dejo laikā un ārpus laika, dejo mūžīgi un mūžības mirkli. Šivas Nātarādžas kosmiskā deja ir vienlaicīgi gan radīšana, gan iznīcināšana.

Tieši šīs pretējās īpašības pamudinājušas austriešu atomfiziki Fritjofu Kapru grāmatā «Fizikas Dao» {«The Tao of Physics», [20]) salīdzināt Šivas kosmisko deju ar vizualizētiem Visuma elementārdaļiņu rašanās un anihilāci­jas procesiem (51. att. 131. lpp.).

Hinduismā tradicionālais Šivas Nātarādžas tēls atainots 52. attēlā. (2. piel.) Tajā ietverta virkne nozīmīgu reliģiski filozofisku simbolu. Viņš parādīts kā četrrocīgs dejojošs Dejas Dievs, ko apvij ugunīgs oreols — degošu lotosa ziedu liesmas, kas simbolizē apskaidrību. Saspiestā gulošā būtne, uz kuras Šiva dejo, ir gara tumsības un nezināšanas alegorija. Bungas Šivas augšējā kreisajā rokā simbolizē radīšanas mūziku, bet liesmas mēle augšējā labajā rokā — iznīcinā­šanas uguni [188].

Radīšanas un iznīcināšanas komplementāro pretmetu iemiesojums Šivas tēlā adekvāti simbolizē Austrumu filozofijas pamattēzi — uzskatu par pasaules attīstības ciklisko raksturu.

Saskaņā ar hinduisma mitoloģiju Pasaule izšķiļas no olas un attīstās kā putns. Bet katram putnam vai dzīvniekam — ari cilvēkam — ir savs noteikts dzīves cikls. Augšanai seko briedums, tad — sairšana, un radošie procesi pārvēršas novecošanas un nāves procesos. Arī Pasaules un Visuma attīstībai ir ciklisks raksturs — šos ciklus veido periodi jeb jugas. Visums līdzīgi dzīvam organismam attīstās, sasniedz pilnbriedu un pēc tam sairst un iet bojā, lai atkal no jauna uzsāktu attīstības ciklu. Austrumu filozofijā dominē laika cikliskā izpratne. Tā ir kustība pa apli. Šie indiešu mitoloģijas priekšstati tuvi mūsdienu modernajai kosmoloģijai.

Atgriežoties pie Šivas tēla (52. att. 2. piel.), uzsvērsim, ka abu priekšējo roku žesti: viens — norādot uz augšu, otrs — uz leju, simbolizē mūžīgo līdz­svaru starp dzīvību un nāvi [188], Arī Šivas sieva Mahādevi (Lielā dieviete) sevī apvieno Labā un Ļaunā pretmetus. Viņa var parādīties gan kā Lokamāta —

īss

Pasaules Māte, gan kā skaistā un labā Parvātī, gan kā mežonīgā cīnītāja Durga ar desmit rokām, gan kā ļaunā, asinskārā dieviete Kālī [90],

Filozofiskā aspektā Labā un Ļaunā, skaistā un neglītā pretmetu komple- mentaritāte visreljefāk izkristalizējas «Daocledzin» tekstos [101]:

Tad, kad iesāka atzīt, ka skaistais ir skaists,

Pamanīja, ka pastāv neglītais.

Tad, kad iesāka atzīt, ka labais ir labs,

Pamanīja, ka pastāv ļaunais.

Esošais neesošs kļūst, kā nav, tas gūst esamību.

Grūtais un vieglais viens otram priekšnosacījums.

Garais un īsais viens otram salīdzinājums.

Skaņas un toņi cits citu saskaņā saista.

Agrāk un vēlāk viens otram ir turpinājums.

Tā varējām pārliecināties, kā ar Gēti un it īpaši ar Tomasu Mannu Rietumu filozofiskās domas apritē atdzimuši orientālo domātāju uzskati par Labā un Ļaunā pretmetu, par iņ un jan tipa savstarpējo komplementaritāti. Šo domu adekvāti papildina daoiskās iņ un jan kategorijās domājošā holandiešu māksli­nieka Mauritsa Eshera grafika «Eņģeli un velni» (71. att. 3. piel.), kurā lieliski vizualizēta Labā un Ļaunā komplementaritātes ideja. Gluži kā citētajā Laodzi teksta fragmentā, mēs vispirms pamanām skaistos, labos eņģeļus un tikai pēc tam neglītos velnus. Taču tieši šie neglītie, ļauni ņirdzīgie velni padara baltos eņģeļus vēl skaistākus un dievišķīgākus.

45. EINŠTEINS: «VAI DIEVAM BIJA KĀDA IZVĒLES IESPĒJA PASAULES RADĪŠANĀ?»

Domu par Dievu Einšteins attīsta tālāk ar jautājumu: «Kas mani patiesi interesē visvairāk — tā ir problēma, vai Dievam bija kāda izvēles iespēja Pasaules radīšanā.» («What really interests me is ivhether God had any choice in the creation of the ivorld.» [166], 103. lpp.)

Tas ir kardināls filozofiskas (un varbūt arī ētiskas) dabas jautājums, cik lielā mērā šajā radīšanas aktā Dieva rīcību nosaka brīva izvēle (vai pat patvaļa). Un, ja Pasaule tika radīta un tās evolūcijas likumi iestādīti, vai Dievam bija, ir vai būs iespēja grozīt tās attīstības gaitu? Vecajā Derībā leģendu formā aprak­stīti vairāki šādi patvaļas akti. Kaut vai Ievas un Ādama padzīšana no Paradīzes un vēlāk inscenētie grēku plūdi. Mehāniskā determinisma piekritējam un deistu ideju paudējam Izakam Ņūtonam šādi Dieva patvaļas akti nebija pieņe­mami. Viņš uzskatīja, ka Pasaules radīšanas aktā Dievs bija Pirmais Iekusti­nātājs, Pasaules evolūcijas Pirmcēlonis. Bet tālāk Pasaules norises ir strikti determinētas, tās nosaka Dabas likumi, nevis patvaļīgas Dieva gribas akti.

Modernās astrofizikas dati liecina, ka pasaules rašanās un evolūcijas norisē eksistē daži visai strikti nosacījumi, kas iemiesojas pašā matērijas dabā un struktūrās un nevar tikt pārkāpti. Jau minējām, ka Visuma sākotnē kodolsin- tēzes procesos veidojās vieglie elementi — hēlijs, litijs, deiterijs [135a]. Tālākā Visuma attīstība, kas saistīta ar smago elementu kodolu sintēzi, bez kuriem nebūtu iespējama dzīvība, izrādās strikti atkarīga no vairākiem fizikāliem lielumiem un konstantēm, no to precīzās vērtības. Vairākas šādas konstantes rakstā «Dzīvība Visumā» {«Life in the Universe») minējis slavenais kodolfrzikis un kosmologs, Nobela prēmijas laureāts Stīvens Veinbergs [199]. Viena no tām ir oglekļa C^ kodolu ierosinātā stāvokļa enerģija. Tās precīzai vērtībai ir izšķiroša nozīme smagāko elementu kodolsintēzes ķēdē. Izejas kodolreakcijā divi hēlija atomi savienojas, veidojot nestabilu berilija 8 (Be^) atomkodolu, kas dažkārt pirms sabrukšanas atpakaļ par hēlija atomiem absorbē vēl vienu hēlija kodolu, veidojot oglekļa 12 (C12 ) kodolu ierosinātā stāvoklī. Tad oglekļa 12 (C1 ") kodols izstaro fotonu un pārvēršas stabilā oglekļa atomā ar zemāku enerģiju. Tālākajās kodolu reakcijās ogleklis ir izejmateriāls, no kura veidojas skābeklis, slāpeklis un citi elementi, kas nepieciešami, lai rastos dzīvība. Te jāuzsver, ka hēlija kodola saķeršana berilija 8 (Bc8 ) kodolā ir rezonanses process, kura reakcijas ātruma konstante ir diskrēti atkarīga no reaģējošo kodolu un to reakcijas produktu enerģijām. Ja oglekļa 12 ierosinātā stāvokļa enerģija būtu nedaudz mazāka vai tikai nedaudz izskaņota no īstā «viļņu garuma», berilija 8 kodols atkal sabruktu, pirms pagūtu veidoties oglekļa atoma kodols. Tādā gadījumā Visums sastāvētu tikai no ūdeņraža un hēlija bez dzīvībai nepieciešamajiem komponentiem.

Vēl svarīgāka ir kāda cita Visuma konstante, kurai jābūt ļoti precīzi «noska­ņotai» [199]. Tā ir vakuumu enerģijas t. s. kosmoloģiskā konstante, kurai bijusi būtiska loma pašā Visuma radīšanas procesa sākumā, tā sauktajā inflācijas posmā (57. att. 3. piel.). Lai veidotos Visums, kurā būtu iespējama dzīvība, šai konstantei jābūt ar precizitāti līdz pat simt divdesmitajai decimālzīmei! Pretējā gadījumā pilns Visuma izplešanās un saraušanās cikls beigtos, pirms pagūtu veidoties dzīvība. Vai arī Visuma izplešanās notiktu tik strauji, ka zvaigznes un galaktikas vispār nevarētu veidoties.

Šos nosacījumus bieži dēvē par antropoloģisko principu. Visuma konstantes un raksturlielumi ir tieši tādi, kādi nepieciešami, lai tajā varētu eksistēt cilvēks. Tas liek domāt, ka tiešām pastāv kāds Augstāks Saprāts, kas organizējis Visumu tā, lai tajā parādītos homo sapiens. Bet varbūt to var izskaidrot ar sinerģētisko pašorganizēšanās principu, kas jau sākotnēji iemiesots pasaules primordiārajā matērijā un galu galā noved pie dzīvās dabas un homo sapiens rašanās.

Šie noteikumi tad arī ir atbilde uz Einšteina jautājumu. Varbūt Radītājs veica vairākus Pasaules radīšanas mēģinājumus, kamēr «noskaidroja» visas svarīgākās konstantes līdz nepieciešamajai precizitātei. Viena no būtiskākajām mistērijām Pasaules radīšanā ir tā, ka Dievam bija jāpakļaujas paša radītajiem dabas likumiem, ka Viņam nebija citas izvēles, lai radīšanas akta finālā rastos Homo sapiens kā Dieva izpausmes objekts un garīgā saikne ar pašu Radītāju. Tā arī varētu būt atbilde uz ateistu retorisko jautājumu: «Vai visuvarenais Dievs spēj radīt tādu akmeni, kuru viņš pats nevar pacelt?» Tieši šajā jautā­jumā ietvertais loģiskais paradokss izraisa pareizo atbildi — mes sastopamies ar divu Lielo Patiesību komplementāro pāri: brīvību un nepieciešamību vai arī indeterminismu un determinismu. Tas nosaka Radītāja rīcības iespējas. Šai kontekstā angļu astrofizikis Stīvens Hokings [65], diskutējot par vienpusīgu determinisma dominanti, secina: «Ja viss ir determinēts, tad vienmēr var apgalvot, ka zinātnes likumi ir Dieva gribas izpausme.» Bet tieši šajā apgalvo­jumā nav grūti saskatīt iekšējo pretrunu. Savukārt Alberts Einšteins vēstulē Bornam iebildumus pret kvantu fizikas statistisko interpretāciju un no tās izrietošo indeterminismu pauž, ironiski izsaucoties: «Es neticu, ka Dievs rada dabas likumus ar spēļu kauliņu palīdzību.» Un ar dziļu bijību pret orientālās filozofijas spēju intuitīvi ieskatīties lietu būtībā atcerēsimies, kā šī problēma traktēta senajā budistu Avatamsakasūtrā ([186], 44. lpp.). Ne Liktenis, ne Dieva griba, ne akls gadījums viens pats nenosaka cilvēka dzīvi, to nosaka «parādību secība, kuras īstenais avots ir cēloņu un nosacījumu uzkrāšanās».

Tātad likumsakarīgas nepieciešamības (determinisma) un stohastiskas ne­jaušības (indeterminisma) daoiski duālistiskā saspēle, iespējams, nosaka kā Dieva, tā cilvēka rīcības iespējas.

Te gan jāatceras, ka dabas norisēs, kas notiek termodinamiski izteiktos nelīdzsvarotos procesos, visniecīgākā fluktuācija var izraisīt neparedzamas enerģētiski grandiozas dinamiski nelineāras sekas. Atcerēsimies šķietami paradoksālo «butterfly» efektu: tauriņa spārnu vēdas var izraisīt mežonīgu tornado, cilvēka kliedziens — sniega lavīnu. Atcerēsimies, ka pēc Lielā Sprā­dziena, lai veidotos asimetriska pasaules uzbūve tikai no vielas, kurā antivielas eksistence ir gandrīz neiespējama, pēcsprādziena fāzē vajadzēja veidoties pavisam niecīgam vielas pārākumam pār antivielu — attiecībā 1:101 Pretējā gadījumā vielas un antivielas elementārdaļiņas savstarpēji anihilētos un pasaule ietu bojā jau savas eksistences pirmajā sekundē. Kāds bija cēlonis šai nelielajai fluktuācijai, kas sākotnēji izraisīja niecīgo vielas pārsvaru pār antivielu un galarezultātā izveidoja Visumu no stabilām vielas elementārdaļiņām — elek­troniem, protoniem un neitroniem? Vai tās bija nejaušas, tīri stohastiskas gadījuma fluktuācijas vai apzināts Radītāja gribas akts? Ja pieņemam otro variantu, tad kāpēc gan tālākajos Visuma un vēlāk dzīvības attīstības posmos dažādos kritiskos mezglu punktos, kad visu virzību nosaka šķietami gadījuma fluktuācijas, nevarētu īstenoties Dieva gribas izpausmes moments? Tad varētu uzskatīt, ka Dieva rīcības brīvību lielākos vai mazākos laika sprīžos ierobežo Viņa paša radītie determinētie dabas likumi, bet tieši šajos kritiskajos tālākās attīstības alternatīvajos mezgla punktos Dievam paveras iespēja brīvi iejaukties un notikumus pagriezt vēlamā virzienā.

Pārrunās par Dieva rīcības iespējām esam nonākuši gaismas un ēnas, rembrantiskās chiaroscuro robežjoslā, kurā racionālais, analītiski domājošais prāts saplūst ar intuitīvo, mistisko pasaules uztveri. Un tieši tumsas puse šajos gaismas un tumsas daoiskajos pretmetos simbolizē Dieva būtības neizdibi- nāmību prāta analītisko iespēju robežās. Lielās Patiesības izzināšanai tīrā analītiskā prāta puse ir jāpapildina ar tās pretmetu — intuitīvo, misticismā gremdēto pasaules izziņas pusi. Tikai abu simbioze spēj nodrošināt iespēju ieskatīties lietu un parādību dziļākajā būtībā.

46. DEDUKTĪVO SISTĒMU NEPILNĪBA. GĒDELA TEORĒMA

Renē Dekarta iedibinātajam un 18. gs. valdošajam filozofiskajam racionā­lismam, kas balstījās uz ticību cilvēka prāta visuvarenībai (cogito, ergo sum — domāju, tātad esmu), pirmo nopietno triecienu deva angļu empīriki, it īpaši Deivida Hjūma filozofiskais skepticisms. Tālāk sekoja Imanuela Kanta «Tīrā prāta kritika», kas gan apstiprināja prāta aprioro dabu, bet vienlaicīgi parādīja tā robežas, atstājot ārpus prātam sasniedzamām iespējām lietas sevī(Dinge an sich) un konstatējot tīrā prāta nevarību tādu nozīmīgu problēmu kā laika un telpas būtības noskaidrošanā. 20. gs. sākumpusē telpas un laika problēmas no metafiziskās filozofijas tika pārceltas uz dabaszinātņu jomu. Vispārīgā relativi­tātes teorija un astrofizika, kā redzējām, pavēra iespēju diezgan precīzi no­skaidrot fizikālā laika un telpas relativitāti, to saistību ar vielu, kā arī telpas un laika galīgumu. Piedevām — Lielā Sprādziena kosmoloģija pacēla priekškaru pasaules radīšanas aktam, tā mistiski dievišķajai būtībai.

Kvantu fizika savukārt norādīja mehāniskā determinisma un kauzalitātes robežas, papildinot ar statistisko nenoteiktības principu un indeterminismu. Jaunās kvantu fizikas būtību metaforiska salīdzinājuma formā, kā jau minē­jām, vislabāk raksturojis vācu filozofs un logikis Hanss Reihenbahs [180]: «Notikumi dabā vairāk līdzinās ripojošam spēļu kauliņam nekā rotējošām zvaigznēm; tos pārvalda varbūtības likumi, bet ne cēloņsakarības, un zināt­nieks vairāk līdzinās spēlmanim nekā pravietim.»

Deduktīvās domāšanas spēcīgākais bastions joprojām palika matemātiskā skaitļu teorija un matemātiskā loģika. Grupa matemātiku, matemātiskās loģikas un loģiskā pozitīvisma eksperti, slavenā vācu matemātiķa Dāvida Hilberta virsvadībā strādāja pie visai godkārīga mērķa — izveidot pašsaskaņo- tu, nepretrunīgu un pilnīgu matemātisko pierādījumu sistēmu. Šie pētījumi koncentrējās galvenokārt skaitļu teorijā — viseksaktākajā un loģiski pilnīgāka­jā matemātikas nozarē. Izcilo angļu matemātiķu, loģiķu un filozofu Bērtranda Rasela un Alfrēda Vaitheda pūļu rezultātā no 1910. gada līdz 1913. gadam tika publicēts gigantisks triju sējumu opuss «Principia Mathematica», kura au­toriem šķita, ka viņi sasnieguši iecerēto mērķi un matemātisko pierādījumu sistēmu un līdz ar to deduktīvo loģiku pacēluši uz neapgāžama pjedestāla.

Šā monumentālā darba autori mēģināja parādīt, ka visi mums pazīstamie mate­mātiskie jēdzieni un fakti var tikt loģiski izvedināti no noteiktiem vienkāršiem primāriem principiem. Loģiskie pozitīvisti cerēja, ka ari citas zinātnes, pat fiziku un psiholoģiju, var nostādīt uz līdzīgiem stingri loģiskiem pamatiem.

Pēc Rudija Rakera domām [160], Rasela un Vaitheda nozīmīgākais sasniegums bija tas, ka viņi skaidri definēja procedūru, kā no viena apgalvojuma loģiski secināt citus apgalvojumus. Matemātiskā formālisma pārstāvis Dāvids Hilberts norādīja, ka, balstoties uz šo definīciju, matemātikā vienīgā problēma paliek izvēlēties pareizās aksiomas un izdarīt visus iespējamos loģiskos slēdzie­nus, kas seko no šīm aksiomām.

Vēlāk, divdesmitajos un trīsdesmitajos gados, Hilberts un viņa skola mēģi­nāja tālāk papildināt «Principia Mathematica» pamatnostādnes, paplašinot to absolūtās nepretrunības loģisko sistēmu no aritmētikas līdz kopu teorijai. Taču drīz vien «Principia Mathematica» loģiskajai sistēmai fatālu triecienu deva Kurta Gēdela slavenā nepilnīguma (incompleteness) teorēma.

Modernās matemātikas ģēnijs Kurts Gēdels dzimis Brno, Morāvijā, kas tai laikā ietilpa Austroungārijas impērijā. Jau septiņpadsmit gadu vecumā viņš uz­sāka matemātikas studijas Vīnes universitātē. Vīnē tolaik gaisā virmoja gadsimta jaunās paradigmas idejas itin visās garīgo aktivitāšu jomās. Tur darbojās psi­hoanalīzes iedibinātājs Zigmunds Freids un atonālās divpadsmit toņu mūzikas tēvs Arnolds Šēnbergs, uzplauka modernā arhitektūra un abstraktā glezniecība.

Jaunie avangarda filozofi pulcējās t. s. Vīnes grupā, kuras sanāksmes regu­lāri apmeklēja arī Kurts Gēdels. Viens no Vīnes grupas spīdekļiem bija loģiskā pozitīvisma piekritējs, vēlāk slavenais zinātnes filozofs Rūdolfs Karnaps [23]. Loģiskā pozitīvisma credo tika skaidri definēts Karnapa manifestā: «Mēs nedo­dam atbildes uz filozofiskiem jautājumiem, faktiski mēs noraidām visus filozo­fiskos jautājumus— vienalga, vai tā būtu metafizika, ētika vai epistemoloģija.» (Citēts pēc [160], 170. lpp.)

Vīnes pulciņu dažkārt apmeklēja arī jaunais, talantīgais filozofs loģikis Ludvigs Vitgenšteins, kas jau 1921. gadā bija publicējis loti oriģinālo un nozī­mīgo darbu loģistikā «Loģiski filozofiskais traktāts» {«Tractatus Logico-Philo- sophicus»), Vitgenšteins gan nekad nekļuva par pārliecinātu loģisko pozitīvistu. Kā norāda Rudijs Rakers ([160], 170. lpp.), Vitgenšteina uzskati dažkārt saskanēja ar dzenbudistu filozofiskajām nostādnēm. Tā, piemēram, savā «Tractatus» viņš raksta: «Uzskatu, ka pat tad, kad visi iespējamie zinātniskie jautājumi būs atbildēti, dzīvības problēma paliks pilnīgi neskarta.» Pēc Vitgen­šteina domām, šī problēma ir neatrisināma, uz to nav gaidāma atbilde.

Tāda tolaik bija garīgā gaisotne Vīnē, kur veidojās Kurta Gēdela nekon- vencionālā jaunā paradigma matemātikā un loģikā, kas, tāpat kā Einšteina relativitātes teorija un Bora-Heizenberga komplementaritātes princips, totāli izmainīja 20. gadsimta zinātni.

Savu epohālo teorēmu Gēdels pierādīja 1930. gadā — tikai trīs gadus pēc Heizenberga nenoteiktības relācijas un Bora komplementaritātes principa formulējuma. Jaunajam matemātiķim bija tikai 24 gadi. Gēdela raksts tika publicēts 1931. gadā ar nosaukumu «Par formāli neizšķiramiem apgalvoju­miem [Ņūtona darbā] «Matemātikas principi» un radniecīgās sistēmās» {«On Formally Undecidable Propositions in «Principia Mathematica» and Related Systems»). Neformalizētā valodā Gēdela nepilnīguma teorēmas būtība izsakāma šādi: skaitļu teorija satur apgalvojumus, kas nav pierādāmi dotās sistēmas iet­varos. Citiem vārdiem, aksiomātiski formulētā pašsaskaņotā (nepretrunīgā) skaitļu teorija satur nepierādāmus apgalvojumus.

Plašākā kontekstā Gēdela teorēmas vispārinājums skan: jebkura aksiomā- tiska deduktīva sistēma satur apgalvojumus, kas nav pierādāmi šīs sistēmas iet­varos. Tas nozīmē, ka jebkura deduktīva sistēma ir nepilnīga.

Interesanti, ka abas agrāk pilnīgi nepieņemamās, klasiskās zinātnes para­digmas ietvaros šķietami nezinātniskās kategorijas nenoteiktība un nepilnīgums kļūst par jaunās, modernās domāšanas vadmotīviem. Tic veido jaunās para­digmas pamatus, uz kuriem balstās gan modernā fizika, gan mūsdienu loģiskā domāšana, kas saistīta ar atteikšanos no strikta determinisma un deduktīvās loģikas primāta. Ievērojamais krievu matemātiķis un lingvists Vasilijs Nalimovs grāmatā «Varbūtīgais valodas modelis» («BepOHTHOCTHan MO.ne.nb H3biKa» [129]) uzsver Gēdela teorēmas gnozeoloģiski filozofisko nozīmīgumu: tās vis­pārinātais secinājums ir, ka cilvēka domāšana ir daudz bagātāka par tās deduk­tīvo sastāvdaļu. Citiem vārdiem, deduktīvā domāšana nav vienīgais pasaules izziņas avots (kā domāja racionālisti un formālās loģikas adepti).

Arī slavenais amerikāņu matemātiķis Rudijs Rakers saistošajā grāmatā «Bezgalība un prāts» («Infinity and the Mind», [160]), analizējot šo problēmu, parāda, ka Gēdela teorēma faktiski uzliek veto loģisko pozitīvistu sapņiem radīt universālu matemātiski loģisku «patiesības mašīnu». To nosaka Gēdela teorēmā pierādītais deduktīvo sistēmu iekšējais nepilnīgums (incompletability). Gēdels norāda, ka no šā strupceļa var izkļūt tikai ar jauna veida intuitīvu domāšanu. Rudijs Rakers uzskata, ka Gēdela teorēma savā dziļākajā būtībā parāda, ka racionālā doma nekad nevar sasniegt galīgo, absolūto patiesību ([160], 177. lpp.). Rakers racionālās domāšanas mēģinājumus sasniegt galīgo patie­sību alegoriski salīdzina ar Franča Kafkas varoņa K. gaitām slavenajā romānā «Pils («Das Schloss»). Apjukušais un nelaimīgais K. bezcerīgi klīst pa Pils nebei­dzamajiem koridoriem, tiekas ar visādiem ļaudīm un ierēdņiem, visiem taujā, klauvē pie daudzām durvīm, mēģina izprast šā mistiskā labirinta uzbūvi. Bet veltīgi. Visi mēģinājumi beidzas neveiksmīgi. Nekur šajā zinātnes Pilī nevar atrast izeju uz absolūto Patiesību [160].

Šai kontekstā Rudijs Rakers raksta, ka Kurtu Gēdelu dažkārt salīdzina ne vien ar Albertu Einšteinu, bet arī ar Franci Kafku. Arī Kafka ar saviem dzīļu psiholoģijas romāniem bija laikmeta jaunās paradigmas iezvanītājs.

Pēc kara Kurtu Gēdelu uzaicināja darboties leģendārajā Padziļināto pētī­jumu institūtā Prinstonā ASV. Tur nostiprinājās viņa ciešā draudzība ar Albertu Einšteinu. Abus gadsimta izcilākos domātājus bieži vien varēja sastapt kopējā pastaigā Prinstonas universitātes parkā, dzīvi diskutējot. Šie garīgie kontakti ar Einšteinu Kurtu Gēdelu dzīves pēdējā posmā pievērsa filozofiskām problēmām. Tā 1949. gadā viņš uzrakstīja apcerējumu par relativitātes teori­jas saistību ar ideālistisko filozofiju [160], Filozofiskajos uzskatos Gēdels bija konsekvents Platona piekritējs. Viņš atzina, ka mentālie objekti un idejas eksistē tikpat reāli un neatkarīgi no subjekta kā fizikālā pasaule. Rudijs Rakers saistoši aprakstījis vairākas tikšanās un sarunas ar Kurtu Gēdelu [160). Vienā no pēdējām tikšanās reizēm, nepilnu gadu pirms Gēdela nāves 1978. gadā, Rakers jautā, vai Gēdels tic vienotam Pasaules Saprātam, kas eksistē pāri visām reālās pasaules parādībām. Uz to Gēdels atbild ar noteiktu «yes». Pēc viņa domām — saprāts ir delikāti strukturēta sistēma. Tāds Visuma Saprāts var eksistēt neatkarīgi no cilvēku subjektīvā prāta un apziņas. Uz jautājumu, vai šāds saprāts ir Visumā visur, ārpus tā saprāta, kurš lokalizēts cilvēka smadze­nēs, Gēdels atbild: «Protams. Tā ir mistiskās domāšanas pamatpatiesība.»

Šādas domāšanas un visas filozofijas mērķis, kā uzskatīja Gēdels, ir kontakts ar Absolūto. Viņš sarunu nobeidz ar citātu no Platona: «Kad Plūtus varēs pilnīgi uztvert Labo, viņa filozofija beigsies.»

Rakers uzsver, ka būtiski ir atšķirt īsteno iracionālo misticismu no vulgāra okultisma. īstenā klasiskā misticisma tīrā līnija ved no Platona uz Plotīnu, tad uz Meistaru Ekhartu un tādiem mūsdienu modernajiem domātājiem kā Hakslijs un dzenbudisma filozofs Suzuki. Šā klasiskā misticisma pamattēze skan: «Realitāte ir Viens. Absolūtais ir ārpus Laika.»

Ap Kurta Gēdela vārdu vijas maģisks oreols. Viņš bija izraisījis radikālu «fāzu pāreju» uz principiāli jaunu paradigmu gan matemātikā, gan loģikā, gan filozofiskajā domāšanā vispār. Rudijs Rakers atceras, ka sarunas ar Gēdelu bijušas hipnotizējošas, viņam palicis iespaids, ka sazināšanās notiek telepātiski, bez vārdiem, jo Gēdels atbildējis uz jautājumiem, pirms vēl Rakers tos precīzi formulējis vārdos. Palicis iespaids, ka Gēdels spējis lasīt domas [166]. Rudijs Rakers apraksta dīvainu sapni, ko viņš redzējis Gēdela nāves dienā un kas loti atgādina Karla Gustava Junga vizionāros sapņus (sk. 82.1. eseju). 1978. gada janvārī Rakers vēlreiz gribējis tikties ar Gēdelu, bet uzzinājis, ka viņš ir smagi slims, un tad kādu nakti redzējis šo neparasto sapni. Rakers sapņojis, ka viņš sēd pie slimā Gēdela gultas un priekšā ir šaha galdiņš ar figūrām. Gēdels izstiepis roku, lai izdarītu gājienu, bet nejauši apgāzis šaha galdiņu, un visas figūras nobirušas uz grīdas. Tai pašā mirklī Rakers redzējis, ka tukšais šaha galdiņš pēkšņi izplešas par bezgalīgu matemātisku plakni. Un tad pazūd. Tad viņa acu priekšā novirmojuši dažādi matemātiskie simboli un parādījies tuk­šums, kurā plūst tikai balta gaisma. Nākamajā dienā Rakers uzzinājis, ka iepriekšējā naktī Gēdels ir miris [160].

Šis Rudija Rakera pravietiskais sapnis ir vēl viens apstiprinājums Karla Gustava Junga hipotēzei par fizisko un psihisko norišu iespējamo sinhronitāti.

Interesanti konstatēt, ka Gēdela teorēmas iedīgļus varam atrast jau grieķu sofistu prātulās. Vispazīstamākais no tiem ir t. s. Epimenīda jeb mela para­dokss. Paradoksu veido divi loģiski nesavienojami apgalvojumi: «Visi krētieši ir meli,» — un: «Es esmu krētietis.» Jebkura krētieša apgalvojums, ka visi krētieši ir meļi, ir loģisks bumerangs. Tā vispārinājums jau ir Gēdela teorēmas pamatapgalvojums, proti, ka noslēgta deduktīva pierādījumu sistēma var satu­rēt apgalvojumus, kas nav pierādāmi šīs sistēmas ietvaros. Lai tos pierādītu, ir «jāizlec» no sistēmas. Ticamu apgalvojumu, ka «visi krētieši ir meli», var izteikt tikai «nekrētieši».

Un vai neliekas dīvaini, ka izcilākie 20. gs. matemātiķi un loģiķi, kas vei­doja «Principia Mathematica» kā absolutizētu, pilnīgu un pašsaskaņotu loģisko pierādījumu sistēmu, vienkārši ignorēja Epimenīda un līdzīgus paradoksus kā nepieklājīgus kuriozus, līdz Kurts Gēdels šo paradoksu matemātiski formali­zēja, pierādot deduktīvo sistēmu nepilnību? Šim gadījumam ir vistiešākais analogs mehāniskā determinisma vēsturē. Arī deterministi līdzīgi viņiem radnie­cīgajiem deduktīvās loģikas dievinātājiem vienkārši ignorēja fizikāla svārsta labilā stāvokļa dinamikas statistisko interpretāciju (43. att. 98. lpp.). Tikai kom­plementaritātes princips, tāpat kā Gēdela teorēma, nostādīja lietas savās vietās!

<56 att. M. iisluTii iiraflka "Mēbiusa lente ii" 0963).

57. att. Vizualizēts Mela Sprādzienā (Bifļ Hanu) scenārļis [199],

58. att. Zemes rietumu puslodes fotouzņēmums no satelita.

59. att. Visuma dimensijas: a — Saules sistēmas shematisks attēls, tās diametrs — 10,4 gaismas stundas; b — mūsu Galaktika, kuras vienā atzarā atrodas Saules sistēma; c — mūsu Galaktika kopā ar Andromedas galaktiku veido Visumā lokālu galaktiku grupu, tās caurmērs — apmēram 10 miljoni gaismas gadu; (I — abu galaktiku lokālā grupa ietilpst galaktiku superklastera kopā, kuras caurmērs ir apmēram 60 miljoni gaismas gadu; e — šis galaktiku superklasters savukārt ir sastāvdaļa gigantiskā galaktiku agregāci- jā, ko astronomi sauc par Lielo atraktoru.

60. att. Ar superjaudigu teleskopu ieguls Andromedas

ii'il ll lil, ls Inti rlllrk

64. att. M. Eshera grafika "Evolūcija" (1939).

67. att. Rjoandzi dzenbudistu tempļa akmensdārzs Kioto, Japānā (15. gs., Muromači periods).

()H. att, Indula Rankas skulDtŪrsi "Veļu akmens" Siguldā, Dainu kalnā.

islaicigā un mūžīgā pretmeti japāņu estētiski

69. att. Sakuras ziedi uz sniegiem klātā Fudzi kalna fona — filozofiskajā uztverē.

7 i. till. Leonardu da VlnCI. Perspektīvas studijas gleznai "Adoration of the Mani" (Austrumu gudrie pielūdz Kristus lienu i :iiiiu I4Q1

47. LOĢISKIE PARADOKSI UN DĪVAINĀS CILPAS

Loģiskos paradoksus aizraujošajā grāmatā «Gēdels, Eshers, Bahs» [72] uzskatāmi un detalizēti «apsmadzeņo» amerikāņu matemātiķis Duglass Hofsteters. Viņš tos nosauc par dīvainām cilpām («strange Loopiness») un uzskata par pašatsauces (self—reference) izpausmēm.

Hofsteters «paplašina» Epimenīda paradoksu ar šādiem diviem teikumiem:

«Nākošais teikums ir nepatiess.»

«Iepriekšējais teikums ir patiess.»

Apskatot kopā, abiem teikumiem ir tāds pats paradoksāls efekts kā sākot­nējam Epimenīda paradoksam: atsevišķi tie ir tīri «nevainīgi», un katrs pats par sevi ir noderīgs apgalvojums.

Dīvaino loģisko cilpu, kā jau minējām, lieliski vizualizējis holandiešu māk­slinieks Mauritss Eshers grafikā «Zīmējošās rokas» (48. att. 2. piel.). Šis zīmē­jums neprasa verbālus komentārus, tas vizuāli un uzskatāmi ilustrē dīvainās cilpas paradoksa būtību. Tas arīdzan parāda, ko īstenībā nozīmē jēdziens «paš- atsauce». Vienlaicīgi tā ir arī labākā vizuālā metafora Gēdela teorēmai, tāpat kā elementārdaļiņu teorijas «bootstrap» principam (sk. 35. eseju). Vai nav dīvaini, ka arī mikropasaule būvēta uz loģiskiem paradoksiem? Vai tas nelie­cina par tās iracionālo dabu? Hofsteters parāda, ka dīvainās cilpas atrodamas arī Baha polifoniskajos kanonos un fūgās, it īpaši loti komplicētajā sešda(īgajā fūgā «Muzikālais upuris» («Musikalisches Opfer»), kas pazīstama arī ar nosau­kumu «RICERCAR».

Šo — vienu no savām sarežģītākajām polifoniskajam kompozīcijām — Bahs veltījis patronam Prūsijas karalim Fridriham Lielajam, un vārdu «RICERCAR» veido dāvinājuma latīņu teksta pirmie burti. Bet akronīmam ir arī dziļāka simboliska nozīme: itāliski tas nozīmē «meklēt» un savā laikā tika lietots kā sinonīms fūgai. Sešdalīgās fūgas pamatā ir t. s. Karaliskā tēma. Nozīmīgākais šis fūgas struktūrā, kā norāda Hofsteters, ir tas, ka, izmantojot kanonu tehniku, komponists pēc sešām modulācijām atgriežas sākuma punktā, tā veidodams kanoniem raksturīgo «dīvaino cilpu». Tagad lasītājam būs skaidrs, kāpēc 1 lofsteters grāmatai devis nosaukumu «Gēdels, Eshers, Bahs», — viņš uzsvēris iekšējās struktūras radniecību (izomorfismu) šo autoru matemātiskās, vizuālās un muzikālās izteiksmes formās.

Interesanti, ka Einšteinam vistuvākā bijusi tieši harmoniskā, skaidrā Mocarta mūzika. Viņš pasauli gribējis redzēt tik harmoniski veidotu kā Mocarta simfo­nijas. Tomēr izrādās, ka pasaules uzbūvei vairāk izomorfa ir tieši Baha polifo­niskā mūzika ar iekšējiem paradoksiem, kurus atrisina komplementaritātes principam tik tuvā kontrapunkta koncepcija. Dažādās balsis izteiksmīgi papil­dina viena otru, un to pretmetu holistiskā vienība dod visaugstākās pakāpes harmonisko piepildījumu.

Ja nenoteiktības relācija un komplementaritātes princips izraisīja revolūciju fizikā, tad Gēdela teorēma līdzīgu revolūciju izraisīja matemātikā un loģikā. Šī jaunā, uz paradoksiem balstītā loģika deva iespēju daudz dziļāk izprast kom­plementaritātes principa būtību. Komplementaritātes princips atzīst par iespē­jamu vienlaicīgi lietot divas savstarpēji papildinošas valodas, kuras katra atse­višķi balstās uz parasto formālo loģiku. Aristoteļa siloģisma pamatā ir trešā izslēgtā princips: ja A ir B, tas nevar būt C. Komplementaritātes princips pieļauj šo iespēju: A var vienlaicīgi būt gan B, gan C. Tātad formālā loģika tiek aizstāta ar komplementaritātes loģiku (sk. 86.5. eseju). Tā kvantu fizikā elektrons var vienlaicīgi būt gan vilnis, gan daļiņa. Tas ir pretrunā ar formālo loģiku, bet ir saskaņā ar Bora principu par Lielo Patiesību, kuras pretmets arī ir Liela Patiesība. Varbūtība, ka elektrons parādās kā daļiņa, ir tikpat liela kā varbūtība, ka tas parādās kā vilnis. Tas šķiet paradoksāli tikai no formālās loģikas viedokļa. Bora panākumu atslēga slēpās tai apstāklī, ka viņš neizvairījās no paradoksiem, bet — gluži pretēji — uzskatīja, ka «bez paradoksiem nav progresa» («no progress withoutparadox»).

Komplementaritātes principu un ar to saistīto «paradoksālo» loģiku visuz­skatāmāk ilustrē skaidrojumos bieži pieminētā monētas metafora. Ikvienu monētu raksturo divas puses, teiksim, skaitlis un ģerbonis. Bet redzēt mēs varam tikai vienu — vai nu skaitli, vai ģerboni, bet ne abus reizē. Tomēr tie abi eksistē vienlaicīgi, to komplementārais pāris izsaka monētas būtību: tā nevar būt tikai skaitlis vai tikai ģerbonis.

Metot monētu, savukārt ar varbūtību apmēram 1/2 uzkritīs vai nu skaitlis, vai ģerbonis. Tas nozīmē, ka komplementaritātes loģika sevī ietver arī var­būtības loģiku. Pie dažādām loģikas formām atgriezīsimies 86. esejā, runājot par domāšanas un pasaules izziņas metožu spektru.

Loģiskais paradokss ir domāšanas metode, kas dod iespēju «izlēkt» no gēdeliskās deduktīvās sistēmas, izmantojot tās nepilnību, lai nokļūtu atbilstošā komplementārā sistēmā. Arī šis domāšanas veids — prāta iedzīšana strupceļā, lai atklātu jaunu Patiesību, — nav Bora un viņa līdzbiedru atklājums. Šī metode jau sen pazīstama orientālajā filozofijā un visspožāko virsotni sasnie­gusi japāņu dzenbudistu domāšanas sistēmā.

48. DZENBUDISMS UN KOANU PARADOKSI

Dzenbudisms ir sinkrēra reliģiski filozofiska skola. Pamatos tā ir mahājanas budisma novirziens, ko uz Japānu jau 6. gs. atnesa ķīniešu budistu mūki. Bet budisms Ķīnā lielā mērā transformējās, asimilējot sevī daudzus ķīniešu daoisma elementus — ari iņ un jan pretmetu filozofiskās kategorijas. Japānā šis daoisma cauraustais budisms savukārt pārveidojās tālāk, ietverdams sevī gan japāņu pirmatnējās reliģijas — sintoisma — elementus, gan japāņu mentalitātei tik raksturīgo saikni ar dabu, estētiku un poēziju. Tādā kārtā dzenbudismā, kas ziedu laikus sasniedza 15. gadsimtā, sadzīvoja visas trīs lielās Austrumu kultū­ras — Indijas, Ķīnas un Japānas kultūra.

Dzenbudisms cieši saistīts ar Japānas ainavu parkiem, akmensdārziem (67. att. 3. piel.), budistu svētnīcām, filozofiskām ainavu gleznām (79. att. 4. piel.), ar ikebanu — puķu sakārtošanas mākslu (17. att. 1. piel.), tējas cere­moniju un haiku poēziju. Dzenbudisma triju kultūru sintētisko apvienojumu varbūt vislabāk simbolizē burvīgais Kinkakudzi (Zelta Paviljona) templis Kioto. Tas uzcelts 1397. gadā. Trijos stāvos apvienoti Indijas, Ķīnas un Japānas arhitektoniskie elementi (sk. 51. eseju un 77. att. 4. piel.).

Dzenbudisma filozofiskās domas visspilgtākā izpausme ir dialogu formā veidota saruna starp dzenbudistu meistaru un mācekļiem. Dialoga forma kā filozofiskās domas virzītāja pazīstama jau Senajā Grieķijā. Platona darbos aprakstīti Sokrātā dialogi ar mācekļiem. Arī Galilejs veiksmīgi izmantojis dia­logu savu filozofisko un fizikālo ideju izpausmei. Tomēr koanas ir īpaša veida dialogi. Meistars, uzdodams jautājumus, iedzen mācekli loģiskā strupceļā, nostādīdams to šķietami neatrisināma paradoksa priekšā. Negaidītais para­doksa atrisinājums tad arī noved mācekli pie apskaidrības — satori. Būtībā šāda dialoga tehnika palīdz «izlēkt» no ierastās «gēdeliskās» domāšanas sistē­mas un atrast pilnīgi jaunu, pārsteidzošu skatījumu uz lietām un parādībām. Piemēram varam minēt kādu tipisku koanu: «Divu plaukstu sasitiens ir skaņa. Kas ir vienas plaukstas skaņa?»

Jautājums liekas absurds. Meklētā atbilde ir netriviāla. Vienas plaukstas skaņa ir klusuma skaņa. Sākotnēji šāda atbilde var šķist tikai poētiska metafora. Bet tās saturs ir dziļāks. Par klusuma skaņu var saukt skaņu, kura mūsu uztverē kļuvusi par klusuma sastāvdaļu. Dzenbudistu tempļu dārzos mēdz būt nelieli čalojoši ūdenskritumi vai arī īpaši bambusa svērteņi pie strautiņa aizsprostiem. Kad svērteņi piepildījušies ar ūdeni, tas tiek pārliets ar īpatnēju klikšķi no vienas tvertnes otrā. Šīs ūdenskrituma čalas vai svērteņa ritmiskie klikšķi tad arī kļūst par apkārtējā klusuma sastāvdaļu, ar savas ritmiskās skaņas pretmetu klusumam uzsverot klusuma būtību. Šādi skaņas un klusuma pret­meti veido fonu dzenbudistu filozofiskajām meditācijām.

Japāņu haiku dzejas klasiķis Macuo Basjo atstājis vienu no burvīgākajām filo­zofiskas ievirzes haikām — 17 zilbju vārsmu (haiku veido tieši 17 zilbes) [209]:

Vecais dīķis. Klusumā ielec varde. Ūdens šļakstiens.

Japāniski tas skan šādi:

Furu ike ya kaivadzu tobikomi Midzu no oto

Šī impresionistiskā aina izsaka klusuma un skaņas iņ un jan pretmetu pāra poētisko filozofiju. Ūdens šļakstiens tieši izceļ klusuma burvību, kuru bez tā mēs varbūt nebūtu pamanījuši.

Un vēl kāda filozofiski dziļdomīga koana. Trīs mūki skatās uz vējā plīvo­jošu karogu. Pirmais saka: «Karogs kustas.» Otrais: «Nē, vējš kustas.» Trešais mūks: «Mūsu doma kustas.» Te ietverta gan kustības relativitātes ideja, gan objekta un subjekta attiecību duālisms.

Kā jau minējām, Nilss Bors bija dialogu meistars. Viņa dialogi bija koaniski gan pēc satura, gan pēc formas. Jebkuras diskusijas vadmotīvs — neizvairīties no paradoksiem. Apspriežot seminārā kādu jaunu ideju, Bors vispirms apjautājās, vai tā ir pietiekami «traka», t. i., nekonvencionāli «izlecoša» no esošo sistēmu ietvariem.

Arī gadu desmitiem ilgā Bora un Einšteina diskusija bija savā dziļākajā būtībā koaniska. Einšteins visiem spēkiem mēģināja iziet no kvantu fizikas loģiski nepieņemamajiem paradoksiem. Bet Bors izmantoja tieši šos paradok­sus, lai Einšteinu atkal un atkal iedzītu strupceļā. Tā bija gēdeliski un negēde- liski domājošu prātu titāniskā cīņa. Einšteins izmisīgi pūlējās pierādīt, ka viņa ieteiktās deduktīvās domāšanas sistēmas ir pilnīgas un perfektas. Bet Boram vienmēr izdevās «uzspridzināt» šīs sistēmas no iekšienes.

Kā jau redzējām, deduktīvo sistēmu «Ahilleja papēdi» matemātiski atklāja Gēdels. Fizikālās mikrosistēmās to izdarīja Heizenbergs un Bors. Šai sakarībā interesanti atgriezties pie Hofstetera grāmatas «Gēdels, Eshers, Bahs» [72]. Katru nodaļu autors nobeidz ar kuriozu Ahilleja, Bruņurupuča un Vēža sarunu. Sarunā «Contracrostipunctus» Bruņurupucis pavēsta: viņš saderējis ar Vēzi, ka iespējams tāds mūzikas ieraksts, kas sagrauj atskaņotāju. Vēzis sākumā iegādājās visvienkāršāko atskaņotāju, un tiešām — atskaņojot Bruņurupuča doto skaņuplati, atskaņotājs sašķīda gabalos! Vēzis meklēja arvien komplicētākus atskaņotājus, bet Bruņurupucis piedāvāja arvien jaunus mūzikas ierakstus, kas tos sagrāva. Viss triks bija tai apstākli, ka Bruņurupuča ieskaņotā mūzika saturēja dotā atskaņotāja pašrezonanses pašfrekvenci. Un, iesvārstot pašfrekvencē, kā zināms no bēdīgas pieredzes, var sagraut par vissta­bilāko tiltu, kur nu vēl atskaņotāju! Ir zināms, ka dziedātājs ar spēcīgu balsi var iesvārstīt rezonansē stikla glāzi un to saplēst.

Šī ir lieliska vizuāla analoģija ar Gēdela teorēmu! Jebkura deduktīva sis­tēma ir nepilnīga, un tai piemīt savs «Ahilleja papēdis». Sistēmas iekšienē nepierādāmais apgalvojums ir tā sagraušanas «rezonanses frekvence».

49. EIKLĪDA UN NEEIKLĪDA ĢEOMETRIJA

Par vienu no visskaistākajām un perfektākajām deduktīvajām sistēmām gadsimtiem ilgi uzskatīja Eiklīda ģeometriju. Par to kā par pašu pilnību jūs­moja visi filozofiskā racionālisma piekritēji no Platona līdz Dekartam un Paskālam. Bet jau 19. gs. matemātiķi atrada Eiklīda ģeometrijas «Ahilleja papēdi». Tā ir t. s. paralēļu aksioma — apgalvojums, ka caur punktu ārpus taisnes var novilkt tikai vienu dotajai paralēlu taisni (plaknē par paralēlām sauc taisnes, kas nekrustojas). Bet šis apgalvojums nav pierādāms pašas Eiklīda ģeometrijas ietvaros, tā pamatā ir vienkārši ticība, ka šis apgalvojums ir patiess. Tas nozīmē, ka uz Eiklīda ģeometriju pilnā mērā attiecināma Gēdela teorēma. Citiem vārdiem, Eiklīda ģeometrija ir nepilnīga deduktīva sistēma. Ja mēs no šā apgalvojuma atsakāmies, tad «izlecam» no eiklīdiskās sistēmas un varam radīt citas jaunas neeiklīda ģeometrijas. Nozīmīgākā no tām ir t. s. Rīmana ģeometrija, kuru 19. gs. piecdesmitajos gados izstrādāja vācu matemātiķis Bernhards Rīmans. Šīs ģeometrijas pamatā ir aksioma, ka caur punktu ārpus dotās taisnes nevar novilkt nevienu dotajai paralēlu taisni.

Kura tad no šīm geometrijām ir «pareizā»? Atbilde — abas, tikai dažādās lietojamības jomās. Eiklīda ģeometrija labi apraksta situāciju homogēnā plaknē. Balstoties uz Eiklīda paralēļu aksiomu, viegli pierādīt, ka plaknē trīsstūra iekšējo leņķu summa līdzinās diviem taisniem leņķiem: 2d = 180° (72.a att. 199. lpp.). Savukārt, uz sfēriskas virsmas, kur taišņu lomu spēlē sfēras lielie loki (ģeodēziskās līnijas), adekvāta ir Rīmana ģeometrija — šajā gadījumā trīsstūra iekšējo leņķu summa ir lielāka par 2d, tā var līdzināties, piemēram 3d = 270° (72.Ł att. 199. lpp.). Rīmana ģeometrijas principus uzskatāmi ilus­trē meridiānu tīkls uz Zemeslodes (72.c,«/att. 199. lpp.).

Eiklīda ģeometriju var droši lietot ikdienā, piemēram, mērniecībā (uzska­tot, ka mērāmais laukums ir plakans); ar tās palīdzību var noteikt Ēģiptes piramīdu tilpumu utt. Rīmana ģeometriju savukārt izmanto vispārīgajā rela­tivitātes teorijā un kosmoloģijā, aprakstot liektas fizikālas telpas īpašības. Tātad tās abas ir komplementāras Lielās Patiesības.

Otra veida neeiklīda ģeometrija, ko izveidoja 19. gs. divdesmitajos gados krievu matemātiķis Nikolajs Lobačevskis, balstās uz apgalvojumu, ka caur punktu ārpus dotās taisnes var novilkt bezgaldaudzas paralēlas taisnes (tās nekrustojas arī bezgalībā). Lobačevska ģeometrija ir piemērota

ieliektām virsmām — tādā gadījumā trīsstūra iekšējo leņķu summa ir ma­zāka par diviem taisniem leņķiem.

Rīmana ģeometriju pieņemts saukt par eliptisko — tajā paralēlās taisnes konvergē,, bet Lobačevska ģeometriju par hiperbolisko — tās ietveros paralēlās taisnes diverģē. Būtībā Eiklīda ģeomet­rija ir neeiklīda ģeometriju speciālgadī- jums, gluži tāpat kā Ņūtona mehānika ir Einšteina vispārīgās relativitātes teo­rijas speciālgadījums.

72. att. Eiklīda un neeiklīda (Rīmana) ģeometrijas shematisks attēlojums: a — Eiklīda ģeometrijas vienādsānu trijstūris plaknē; b — Rīmana ģeometrijas vienād­sānu trijstūris uz sfēriskas virsmas; c, d — Rīmana ģeometrijas principu ilustrācija uz zemeslodes virsmas.

īpašs Rīmana vispārīgās eliptiskās ģeometrijas gadījums ir sfēriskās ģeometrijas modelis, kuru visuzska­tāmāk raksturo zemeslodes virsma (72,c,d att.). Ja Eiklīda ģeometrijā īsākais attālums starp diviem punktiem ir taisne, tad sfēriskajā Rīmana ģeomet­rijā īsākais attālums starp diviem punktiem ir nevis taisne, bet ģeodēziskā līnija [23]. Uz zemeslodes virsmas ģeodēziskās līnijas, kas ir da|a no sfēras lielā loka (sfēras lielie loki ir līknes, kas veidojas, ške|ot sfēru ar plaknēm, kuras iet caur sfēras centru) veido arī meri­diānus un ekvatoru. Kā redzams 72.c attēlā, meridiāni ir perpendikulāri ek­vatora līnijai. Eiklīda ģeometrijā divas taisnes, kas perpendikulāras trešajai, ir paralēlas. Tādas nav ģeodēziskās līnijas uz sfēras virsmas — tās krustojas Zie­meļu un Dienvidu polā. Uz sfēras nevar eksistēt divas taisnes vai, pareizāk, kvazitaisnes — lielā loka sastāvdaļas —, kuras nekrustotos! Tieši tāpēc, pie­mēram, lidojot no Stokholmas uz To- kiju, īsākais ceļš nav vis pa «taisni» — pāri Maskavai, Kazahstanai, Mongoli- jai un Ziemelkīnai —, kā tas varētu šķist uz plaknē projicētās Zemes kartes, bet gan pa lielā loka ģeodēzisko līniju, kas lidojumu novirza aiz polārā loka.

Kā interesants vēsturisks kuriozs jāmin fakts, ka 19. gs. izcilākais matemā­tiķis, arī fiziķis un astronoms vācietis Karls Fridrihs Gauss bija daudz domājis par Eiklīda ģeometrijas «paralēlu» aksiomu. Gauss saprata, ka, atsakoties no «paralēlu» aksiomas, veidosies jaunas — vispārinātas neeiklīda ģeometrijas. Bet viņš, kā pats atzinies kādā vēstulē draugam, baidījās no ortodoksāli noskaņoto matemātiķu sagaidāmajiem uzbrukumiem, kas varētu iedragāt viņa autoritāti. Kā redzam, «ticības jautājumos» zinātnē un reliģijā ir līdzīgas prob­lēmas.

Gausam pietrūka Jana Husa, Džordāno Bruno vai Mārtiņa Lutera drosmes apšaubīt ortodoksālo matemātiķu «vienīgās patiesības» un reformēt un papla­šināt tradicionālo ģeometriju. Būdams lietišķās matemātikas entuziasts ar pieredzi astronomijā un ģeodēzijā, Gauss izšķīrās pārbaudīt empīriski uz Zemes virsmas Eiklīda ģeometrijas apgalvojumu, ka trīsstūra iekšējo leņķu summa ir 2d = 180°. Viņš netālu no Getingenes, savas dzīves un darba vietas, izvēlējās kādu kalna virsotni, no kuras bija tālumā redzamas vēl divas virsot­nes. Tās veidoja savstarpēji saistītu trīsstūra sistēmu; ar ģeodēzijā pazīstamo triangulācijas metodi Gauss izmērīja trīsstūra iekšējo leņķu summu un ar pārsteigumu konstatēja, ka tā tiešām bija nedaudz lielāka par 180°! Bet Gauss bija arī kļūdu teorijas speciālists un konstatēja, ka šī novirze nepārsniedz kļūdas robežas [23]. «Vienīgās patiesības» važās sasaistīts, Gauss nav izšķīries šos datus publicēt. Bet, kā norāda Karnaps [23], tas bija nozīmīgs solis zināt­niskajā metodoloģijā. Gauss pirmais nopietni mēģināja saistīt abstrakto Eiklīda telpu ar pasaules fizikālo telpu. Kā zināms, to vēlāk veica Alberts Ein­šteins, vispārīgajā relativitātes teorijā parādot, ka Rīmana ģeometrija patiešām ir Visumā liektās fizikālās telpas ģeometrija.

Ironizējošu gleznu par zinātnieku, kas aizrāvies ar primitīvo Eiklīda ģeometrijas figūru apjūsmošanu, redzēju izstādē «Dvēsele un miesa zinātnē un mākslā» («L'dme et le corps») Parīzē. Tās autors — jau pieminētais angļu mistiķis, dzejnieks un gleznotājs Viljams Bleiks. Alegoriskajā gleznā redzams vientuļš, sevī iegrimis vīrs (prototips, visticamāk, bijis Izaks Ņūtons), kas sēd zem ziedoša koka burvīgā dārzā, bet kā apmāts redz tikai sev priekšā pie kājām smiltīs iezīmētu aplī ievilktu trīsstūri… Ņūtona laikabiedru vidū Viljams Bleiks ir bijis viens no asākajiem mehāniskā determinisma kritizētājiem. Bleiks uzskatījis, ka ārpus Ņūtona Universa ir palicis Dievs, Cilvēks un Dzīvība — pamatvērtības, kuru dēļ ir vērts dzīvot [29a]. Tāpēc Bleiks Ņūtonu līdz ar angļu empīriskās filozofijas iedibinātājiem Bekonu un Loku nodēvējis par «velnišķo triādi», pretstatot viņus angļu literatūras «dievišķajai triādei» — Coseram, Šekspīram un Miltonam [29a].

50. ĢEOMETRIJA UN TĒLOTĀJA MĀKSLA

Uzskats, ka ģeometrijas principi visvairāk ietekmējuši tieši renesanses meis­tarus, ir pamatots [140, 196, 108] un lielā mērā saistīts ar to, ka renesanses laika mākslinieki — kā Leonardo da Vinči un Mikelandželo — bija ne vien gleznotāji, bet arī skulptori un arhitekti, Leonardo arī talantīgs inženieris. Tāpēc viņiem tēlotāja ģeometrija, kas izmanto projekcijas, lai attēlotu telpas figūras un ķermeņus plaknē, bija pazīstams un ierasts darbarīks.

Ģeometriskie principi netieši visspilgtāk izpaužas renesanses meistaru kompozīcijās. Gleznas figūru izvietojums vienmēr veido kādu ģeometrisku motīvu — visbiežāk tas ir trijstūris vai piramīda. Piramidāla uzbūve ir, piemē­ram, tēlu kompozīcijai Leonardo gleznā «Madonna grotā» (80. att. 4. piel.). Raksturīgu trīsstūra kompozīciju var saskatīt četros žestikulējošo apustuļu grupējumos viņa «Svētajā Vakarēdienā». Tāpēc dažkārt apgalvo, ka renesanses glezniecība gan pēc gara, gan formas ir vistuvākā ģeometrijai. Tomēr vistiešākā ģeometrijas principu izpausme realizējas renesanses meistaru gleznu perspek­tīvā. Ģeometriskā perspektīva, t. i., plaknē attēloto objektu šķietamās lielumu, kontūru un krāsu izmaiņas atbilstoši attālumam no noteikta skatpunkta, ir raksturīgs renesanses glezniecības jaunievedums [140, 196], Perspektīvas prin­cipi bija pilnīgi sveši, piemēram, Senās Ēģiptes mākslā. Tā ēģiptiešu kapeņu zīmējumā «Saules dieva Atona pielūgšana» (4. att. 26. lpp.) tēla izmērus nosaka personas vieta sabiedriskajā hierarhijā: vislielākie augumā ir faraons un viņa sieva, jau mazāki — galminieki, bet vismazākās ir salīkušo vergu figūras.

Perspektīvas principu lietošanu Leonardo zinātniski pamatojis «Traktātā par glezniecību» [196]. Tie balstījās uz viņam labi pazīstamiem ģeometriskās optikas principiem. Cilvēka aci viņš uzskatīja par optisku instrumentu. Leonardo bija pārliecināts, ka glezniecībai jābalstās uz tikpat stingriem prin­cipiem kā matemātikai. Perspektīvas tehniku viņš meistarīgi izmantojis jau divdesmit gadu vecumā vienā no savām pirmajām gleznām «Pasludināšana» 1472. gadā.

Lai ilustrētu veidu, kā ģeniālais mākslinieks praktiski izmantoja ģeomet­riskās perspektīvas principus, 73. attēlā (3. piel.) parādītas Leonardo perspek­tīvas studijas gleznai «Austrumu gudrie pielūdz Kristus bērnu» («Adoration of the Magi», 1481). Tajā lieliski atainota gleznas fona ģeometriski lineārā per­spektīva. Visas paralēlās taisnes konverģēvienā punktā, kas centrēts iecerētās gleznas labajā pusē. Šī racionāli izveidotā ģeometrizētā bāze tālāk kalpoja par

ietvaru, kurā mākslinieks lāva brīvi darboties radošai iracionālai iztēlei, veido­jot — līdzīgi kā «Svētajā Vakarēdienā» — dinamiskas, pielūgsmē žestikulē­jošas cilvēku grupas ar Dievmāti un Kristus bērnu centrā.

Leonardo ir apbrīnojams kā universāls harmonisks ģēnijs, kurā līdzsvaroti apvienotas dvēseles racionālās, analītiskās un iracionālās puses, viņš ir reizē izcils zinātnieks un talantīgs mākslinieks. Jāuzsver, ka perspektīvas principa, viena noteikta skatpunkta vērojuma ieviešana glezniecībā izomorfi atbilda jaunajai renesanses paradigmai — indivīda dominantei subjektivizētā pasaules uztverē.

Līdzīga paradigmu maiņa, kā redzēsim, vēlāk notiek arī mūzikā. Objektivi- zēto, Dieva pielūgsmei iecerēto polifonisko mūziku aizstāj subjektivizētā harmoniskā mūzika, kas piemērojas cilvēka skaņas uztveres aparāta īpatnībām. Tāpat kā perspektīvā glezniecība piemērojas cilvēka acij, tā harmoniskā mūzika — cilvēka ausij (sk. 59. eseju).

Un vēl viena intriģējoša perspektīvās glezniecības iezīme. Kā redzams 73. attēlā (3. piel.), «paralēlās» taisnes strauji konverģē vienā punktā gleznas aizmugurē. Tātad ģeometriskā perspektīva ir formāli radniecīga uz plaknes projicētai neeiklīda ģeometriskajai telpai. Tieši tāpēc perspektīvas ieviešanu tēlotājā mākslā var uzskatīt par jaunu paradigmu, kas nebija sastopama agrākajā glezniecībā, kaut gan būtībā perspektīva jau ir iekodēta cilvēka sub­jektīvajā pasaules uztverē, ko nosaka mūsu redzes aparāta ģeometriski optiskās īpatnības. Mēs taču pašu acīm redzam, ka paralēlās dzelzceļa sliedes krustojas kaut kur pie — vai aiz — horizonta!

Tradicionāli pievēršoties Austrumu problemātikai, mūs atkal gaida kārtējais pārsteigums. Izrādās, ka 8. gs. dzīvojušais ķīniešu gleznotājs un glezniecības teorētiķis Vang Vejs par perspektīvas principiem izteicis uzskatus, arī apsvēru­mus, kas līdzīgi tiem, kādus septiņus gadsimtus vēlāk Leonardo ietvēris savā «Traktātā par glezniecību» [108, 158, 7]. Tātad bieži paustais uzskats, ka per­spektīvas glezniecība sākās tikai ar Eiropas renesansi, ir nedaudz pārspīlēts.

Tiesa gan, perspektīvas princips ķīniešu glezniecībā ir attīstījies diametrāli pretējā virzienā nekā Eiropā. Ķīniešu gleznotāji izmanto t. s. apgriezto perspek­tīvu. Iedomātas paralēlas līnijas nevis konverģē, bet diverģē. Rezultātā tuvākie objekti it kā samazinās, bet tālākie kļūst izmēros lielāki. īpaši efektīga šī metode ir ainavu glezniecībā. Tālākajā plānā esošie kalni kļūst lieli un gran­diozi, bet tuvplānā attēlotie cilvēki — niecīgi uz to fona. Mēs skatāmies uz ainavu it kā no putna lidojuma. Tas uzsver Austrumu filozofijā paustos uzska­tus par cilvēka niecību salīdzinājumā ar Dabas varenību.

Šo ķīniešu glezniecības principu ilustrējam ar Cinu dinastijas laika (17. gs.) nezināma meistara ainavu «Pavasara svētki» ([7], 74. att. 3. piel.).

Kā redzams, šajā gleznā dominē ķīniešiem raksturīgās asimetriskās līnijas ritmi. To it īpaši uzskatāmi parāda gleznai pievienotais shematiskais zīmējums.

Līniju kopaina (pattern) un ritmiskā saspēle radniecīga ķīniešu hieroglifu ab- strahētajai kaligrāfijai. Apgrieztās perspektīvas līniju divergence paplašina skata lauku un dod iespēju gleznu vērot dažādos dziļumos, izceļ tuvplāna un tālplāna kontrastus. Visu gleznu nav iespējams uztvert vienlaicīgi, putna lidojuma skatpunkti nepārtraukti mainās, un skatījumā tiek ietverta laika dimensija. Ja Leonardo perspektīva balstās uz ģeometriskās optikas likumiem, tad apgrieztā perspektīva it kā koriģē šos likumus, padarot tālākos objektus lielākus, nekā tie ir īstenībā.

Kā zināms no vizuālās uztveres mehānismu pētījumiem, cilvēka smadzeņu vizuālie centri koriģē uz acs tīklenes projicētā attēla objektu izmērus atkarībā no to atrašanās attāluma [40]. Uz tīklenes projicētā attēla lielums atbilstoši ģeometriskās optikas likumiem samazinās proporcionāli attālumam. Šī mērogu skalas transformācija tātad ir nevis optisks, bet psihisks process. Ja šāda mēroga skalas transformācija smadzenēs nenotiktu, tad, piemēram, aktieris no skatuves pēdējā rindā sēdošos cilvēkus redzētu reizes desmit mazā­kus nekā pirmajā rindā sēdošos.

Apgrieztā perspektīva ķīniešu gleznās šo psihisko mērogu skalas transfor­māciju vēl pastiprina, un rezultātā iegūst brīnišķīgo putna lidojuma ainavu ar grandioziem kalnu masīviem tālumā.

Interesanti, ka «paralēlo» līniju diverģence apgrieztajā perspektīvā ir formāli radniecīga, izomorfa Lobačevska hiperboliskajai ģeometrijai. Tādā kārtā, kā redzam, visas trīs šķietami abstraktās ģeometrijas ir atradušas lietojuma sfēras gan reālajā pasaulē, gan tēlotājā mākslā. Bet vai šīs ģeometrijas var izmantot sarežģītu veidojumu, it īpaši dzīvās pasaules objektu aprakstam? Diemžēl gan ļoti ierobežoti. Kā kuriozs jāmin, ka visdrosmīgāk to mēģinājuši darīt nevis matemātiķi, bet mākslinieki. Eiklīda ģeometrijas elementu izmantošanā cilvēka un citu dzīvās dabas objektu atveidojumos viskonsekventāk ir darbojušies savulaik avangardiskā mākslas virziena kubisma pārstāvji. Šis kādreiz «moder­nais» virziens — viens no citiem «ismiem» — jau savā nosaukumā tīri seman­tiski izcēla Eiklīda ģeometrijas dominanti. Tas bija meklējums dabas plas­tiskās, neregulārās formas vispārinātā veidā attēlot ar vienkāršotām ģeometris­kām figūrām — daudzšķautņainām plaknēm, cilindriem, konusiem, piramī­dām un, protams, kubiem. Lai gan kubismā savu radošo ģēniju demonstrēja tādi izcili mākslinieki kā Pablo Pikaso, Žoržs Braks, Fernāns Ležē, daļēji arī Pols Sezans, virziens kā tāds eksistēja tikai līdz I pasaules karam (1907-1914).

Par vistipiskāko un vienlaicīgi viseiklīdiskāko kubisma stila mākslasdarbu var uzskatīt Pikaso darināto d'Ambruāza Volāra portretu (1910), kurā gan modeļa seja, gan fons sastāv tikai no daudzšķautņainām eiklīdiskām plaknēm un citām vienkāršām, regulārām ģeometriskām figūrām.

Vēl iezīmīgāks ir Pikaso portrets «Sieviete ar bumbieriem» {«Femme aus poires (Fernande)», 1909, 75. att. 4. piel.). Modelis šķiet salikts no regulārām ģeometriskām figūrām (kubiem, piramīdām) un nošķeltām plaknēm. Tikai bumbieriem atstāts zināms plastiskums.

Tomēr kubisms savu māksliniecisko svaigumu ātri vien ir izsmēlis, un tālākā radošā evolūcijā gadsimta ģēnijs Pikaso ieiet rezonansē ar jauno 20. gs. zinātnes paradigmu. Portretā «Sieviete» («Femme», 1937), kurā redzama Pikaso draudzene Dora Māra, modelis tiek attēlots no vairākiem skatpunk- tiem (76. att. 4. piel.), aplūkots pat it kā no iekšienes. Tā jau ir pilnīga un galīga atkāpšanās no kopš renesanses valdošajiem principiem — gan no perspektīvas (skatījuma tikai no viena skatpunkta), gan no gaismēnas tehnikas, gan no tradicionālās objekta vairāk vai mazāk naturālās atveidošanas. Mākslasdarbs satur brīvi izdomātas plastiskas «zīmes» vai simbolus, ko var salīdzināt ar metaforām dzejā.

Tā jau ir konceptuāli jauna estētiska filozofija, jauna paradigma, kas garīgi radniecīga 20. gs. zinātnē valdošajām relativitātes, kvantu fizikas un dzīļu psiholoģijas paradigmām un tikpat radniecīga jaunajām paradigmām citās kultūras jomās — atonālajai divpadsmittoņu polifoniskajaiā mūzikai (Arnolds Sēnbergs) un apziņas asociatīvās plūsmas attēlojumam literatūrā (Džeimss Džoiss, Marsels Prusts).

Pikaso gleznotais portrets «Sieviete» (76. att. 4. piel.) patiesi atzīstams par «polifonisku», daudzdimensionālu, paradigmatiski radniecīgu Šēnberga poli­foniskajai mūzikai. Tā ir mūsu laikmeta paradigmai atbilstošā atteikšanās no «viena skatpunkta» subjektivizētā skatījuma. Gleznas «polifoniskums» to objektivizē, padara neatkarīgu no skatītājam uzspiesta rakursa. Par šādu poli­fonisku portretu viens no jaunās paradigmas iedibinātājiem literatūrā Marsels Prusts raksta: «Cilvēka seju varētu salīdzināt ar Dieva seju kā Austrumu teogo- nijā — patiesībā tā ir vesels ķekars seju, kas pretstatītas dažādās plaknēs un nekad nav redzamas vienlaikus.»

51. DAŽĀDU ARHITEKTŪRAS STILU KOMPLEMENTARITĀTES PIEMĒRI AUSTRUMOS UN RIETUMOS

Pagātnes kultūras paradigmu un ar to saistīto mākslas stilu mainas vis­spilgtāk atainojas dažādu laikmetu arhitektūras pieminekļos. Šajās paradigmu maiņās vērojamas divas diametrāli pretējas tendences: tolerance pret iepriek­šējā laikmeta paradigmas lieciniekiem, meklējot kopējo vai komplementāro starp jauno un veco paradigmu stiliem, un kategoriska neiecietība pret pagātnes mantojumu, cenšanās iepriekšējā laikmeta lieciniekus pakļaut, izmainīt vai iznīcināt. Tolerance vairāk raksturīga Austrumiem, neiecietība un negācija — Rietumiem.

Japānā var atrast labi saglabātus un, galvenais, nesakrop|otus un nepārvei­dotus sakrālās arhitektūras pieminekļus no 7. gadsimta līdz pat jaunajiem laikiem. Kioto tāds ir gan Asukas perioda vissenākais, 622. gadā būvētais Korjudzi templis, kurā glabājas 7. un 8. gs. Būdas statujas, to vidū burvīgais Miroku Botsasu (33. att. 2. piel.), gan Naras perioda 8. gs. svētceltnes Horjudzi, Muromači perioda 15. gs. arhitektūras pērles — Kinkakudzi un Ginkakudzi templi (77. att. 4. piel. un 145. att. 7. piel.), gan 17. gs. Edo perioda apvieno­tās Japānas varenības apliecinājums — greznais Tošogu templis Niko, kas stilistiski tik tuvs Eiropas barokam Luija XIV laikā.

Par japāņu reliģisko toleranci liecina gadsimtiem ilgā abu reliģiju — sinto- isrna un budisma— mierīga un draudzīga līdzāspastāvēšana. Nilss Bors, kā jau minējām, runā par šo abu reliģiju komplementaritāti: gan tradīcijās, gan izpausmes formās tās papildina viena otru, un daudzi japāņi ir vienlaicīgi abu šo konfesiju piekritēji. Abu reliģiju sakrālā arhitektūra ir izteikti atšķirīga un tieši tāpēc komplementāra. Vienā svētceltņu kompleksā kopā sadzīvo gan grandiozie budistu templi, gan arhitektoniski vienkāršās sintoistu svētnīcas. Tā Narā blakus grandiozajam Todaidzi templim, kurā atrodas Daibutsu — Lielā Būdas Avatamsaka («Pasaules Gaismas») tēls, atrodas necilā Kasugas svētnīca ar stilistiski burvīgi vienkāršiem ieejas vārtiem, sauktiem tori, ar daudzām simboliskām akmenī veidotām laternām un svētajām stirnām. Dzenbudisms ir sinkrētiska reliģiski filozofiska skola, kuras pamatus veido mahājanas budisma novirziens — to uz Japānu jau 6. gs. atnesa ķīniešu budistu mūki. Bet budisms, ieplūstot no Indijas, zināmā mērā pārveidojās, uzņemdams sevī daudzus Senķīnas daoisma elementus. Savukārt Japānā šis daoisma caurstāvotais budisms pārveidojās tālāk, asimilējot gan japāņu senākās reliģi­jas — sintoisma elementus, gan japāņu mentalitātei tik tuvo saikni ar dabu, estētiku un poēziju. Tādā kārtā dzenbudismā simbiotiski iemiesojas visu triju lielo Austrumu kultūru — Indijas, Ķīnas un Japānas kultūras — sastāvdaļas.

Triju kultūru apvienojumu dzenbudismā visspilgtāk simbolizē 1397. gadā celtais Kinkakudzi (Zelta) templis Kioto. To var uzskatīt par unikālu dažādu arhitektūras stilu komplementaritātes piemēru (77. att. 4. piel.).

Tempļa celtnieki, īstenojot sjoguna un vēlākā budistu mūka Jošimitsu iece­res, celtnē harmoniski apvienoja «trīs dzīles» — budisma, daoisma un dzen­budisma strāvojumus. Apakšējais stāvs veidots Heianas perioda (8.-9. gs.) arhitektonisko tradīciju stilā, kas veidojies laikmetā, kad dominēja sākotnējā, no Indijas pārnākušā budisma gaisotne. Vidējais stāvs atspoguļo Kamakuras periodu (13.-14. gs.) —jau ķīniešu arhitektūras dominanti. Templi vainago augšējais japāņu dzenbudistu stilā veidotais stāvs un jumts ar zeltītu fēniksu, kas izpletis spārnus lidojumam. «Citi putni lidoja gaisā, bet šis zelta fēnikss pleta spārnus un lidoja laikā, mūžībā. Laiks sitās pret viņa spārniem, un viņa spārnu vēdas lika laikam plūst atpakaļ.» Tā par zelta fēniksu raksta japāņu dzej­nieks, rakstnieks un dramaturgs Jukio Mišima grāmatā «Zelta templis» [122].

Tempļa arhitektūra nebūt nav eklektiski mehānisks stilu savietojums. Virzībā uz augšu dažādo laikmetu stili organiski pāraug viens otrā, veidojot sinkrētu vizuāli simbolisku triju kultūru komplementaritāti. Tempļa atšķirīgo stāvu nosaukumi ir poētiski un dziļi simboliski. Apakšējo stāvu sauc par «Ticī­bas ūdeņu templi», norādot uz Indiju kā budisma izcelsmes avotu. Otrais stāvs nes «Paisuma līča» nosaukumu. Tas ir paisums, kas jau 6. gs. atnesa budismu Japānā. Un, beidzot, trešais stāvs — «Augstāko ideālu virsotne» — simbolizē dzenbudisma filozofiskās domas lidojumu ar fēniksa zelta spārniem pretī Mūžībai, pretī satori. Kā brīnišķa asociācija iekrīt prāta Verdi «Nabuko» leģendārās kora dziesmas vārdi «Lido, doma, zelta spārniem». Un būtiskākais — Kinkakudzi templis atbilstoši dzenbudistu tradīcijām ir organiska apkārtējās dabas ainavu parka sastāvdaļa. Templis izvietots tipiskā japāņu ainavas dīka krastā. Tā spoguļattēls ūdenī rosina skatītāju filozofiskai apcerei par realitātes un ilūzijas pretmetiem.

Kopš Jošimitsu nāves visus šos gadsimtus templis ir viena no nozīmīgāka­jām dzenbudistu svētnīcām Kioto un iekļauts Japānas vēsturisko pieminekļu zelta fondā.

Cetrarpus gadsimtus pēc Zelta tempļa uzcelšanas, mūsu gadsimta piec­desmitajos gados, to mēģināja nodedzināt psihiski nelīdzsvarots jauns budistu mūks, tempļa kalpotājs. So dramatisko notikumu un tā cēloņus psiholoģiski ievirzītā romānā «Zelta templis» [122] atveidojis viens no izcilākajiem japāņu rakstniekiem Jukio Mišima.

Lai vēstījumu padarītu reljefāku, romāns rakstīts pirmajā personā. Midzo- guči, nabadzīga provinces budistu priestera dēls, cieš no iedzimtas stostīšanās, kas saasina mazvērtības kompleksu, izraisot vēlēšanos pašapliecināties. Tā reizēm izpaužas sadistiskā postīšanas kārē.

Tēvs Midzoguči ir mācījis, ka «visā pasaulē nav nekā skaistāka par Zelta templi». Bet, pirmo reizi to skatot, rodas vilšanās. Kad mūks jau kalpo templī, viņu pārņem gan izbrīns par tā skaistumu, gan dusmas, ka skaistais templis eksistējis gadsimtiem ilgi pirms viņa, Midzoguči, un neapmierinātība, ka tas paliks vēl ilgi pēc viņa. Zelta templis viņam kļūst par skaistuma, bet arī par laika simbolu. «.. man bieži likās, ka Zelta templis ir brīnišķīgs kuģis, kas pār­peldējis laika jūru.. Es iedomājos šo celtni kā kuģi, un dīķis tam apkārt kļuva par jūras simbolu. Zelta templis bija atnācis cauri bezgalīgai naktij. Ceļojums nekad nebeidzās. Dienā šis brīnišķīgais kuģis, enkuru izmetis, nelikās ne zinis par ziņkārīgo pūli, bet naktī, smēlies spēku no apkārtējās tumsas, tas likās pacejam buras un dodamies ceļā.» [122]

Midzoguči slimīgā iztēlē iedomājas, ka Zelta templis ir iznācis no nebū­tības un tam arī jāpazūd nebūtībā. Jo tāds skaistums nevar eksistēt mūžīgi. Viņā briest dēmoniska doma nodedzināt templi. Kādu nakti viņš apakšējā stāvā sanes salmus, tos aizdedzina un pats pa šaurajām kāpnēm metas uz augšu, uz «Augstākā ideāla virsotnes» zelta folijām izdekorēto telpu, lai tur noindētos un sadegtu kopā ar templi. Bet šo plānu izjauc nejaušība. Trešā stāva durvis ir noslēgtas. Viņš izmisis dauzās, mēģina tās uzlauzt, bet veltīgi. Smakdams dūmos, viņš impulsīvi maina savu nodomu un metas pa kāpnēm lejā, izbēg no tempļa un aizskrien kalnos. Tur sēdot, viņš noraugās degošā tempļa dūmu mutuļos un debesīs kāpjošajās liesmās. Tad viņu pārņem doma, ka jādzīvo.

Mišimas romāna antivaronis ir paša autora traģiskās dzīves pretmets. 1970. gadā rakstnieks piedalījās militāra apvērsuma mēģinājumā ar mērķi atjaunot senās samuraju tradīcijas un tikumus. Apvērsums neizdevās, un Mišima beidza dzīvi ar samuraju nežēlīgo pašnāvības veidu — harakiri.

Japānas nacionālais lepnums, skaistums un kultūras daudzveidības simbols — Zelta templis ātri vien tika atjaunots un tāpat kā senās dienās līdzīgi brīnišķam kuģim turpina peldēt mūžīgajā laika jūrā.

Viduslaiku Eiropas sakrālajā arhitektūrā dominēja divi atšķirīgi celtniecības stili — romānika un gotika. Senākā no tām ir romānika, kas Rietumos, it īpaši Francijā, valdīja no 10. līdz 13. gs., kad pakāpeniski pārsvaru guva tās pret­mets — gotiskā baznīcu arhitektūra. Te jāsaka, ka romānika nav Romas arhi­tektūras turpinājums, lai gan tajā saglabājušās vairākas raksturīgas klasiskās arhitektūras iezīmes, piemēram, pusaploces arka un kolonnu elementi [147, 108]. Romānikas pirmsākumi vairāk izriet no tuvējo Austrumu tradīcijām (Sirijas, Mazāzijas, Mezopotāmijas), no turienes tā aizguvuši celtņu plānojumu, struktūru un dekoratīvo plastiku. No šiem pirmsākumiem izveidojās pilnīgi jauns arhitektūras stils, kas nebija ne tīri klasisks, ne austrumniecisks. Tā bija jauna paradigma, kurā īstenojās Rietumu radošais ģēnijs [108].

Pastāvīgās nedrošības un nemitīgo karu pēc baznīcas tiek celtas līdzīgi cietokšņiem ar masīvam sienām un velvēm, un šaurām ailām. Rietumu vidus­laiku gars izpaužas romāniskās arhitektūras vienkāršībā un monumentālajā noslēgtībā.

Romāniskās baznīcas arhitektūras vietā 12. gs. sāk izplatīties gotiskā, par kuras radītājiem tiek uzskatīti Ildefransas celtnieki. Tā Eiropas baznīcu celt­niecībā dominē līdz par 14. gs. Tā kā gotikas pirmsākumi meklējami Francijā un visiespaidīgākās šā stila baznīcas sastopamas tieši šajā zemē, gotisko baznīcu celtniecības stilu varētu saukt arī par franču viduslaiku arhitektūru [108].

Interesanti, ka šim cildenajam viduslaiku kristietības arhitektūras stilam, kas vēl šodien pārsteidz ar savu grandiozo varenību un vienreizību, renesanses laika gleznotāji un arhitekti (Rafaels, Vazari u. c.) deva nicinošu epitetu — barbariskais, t. i., «gotu», stils.

Gotiskās katedrāles raksturo simboliskā vertikālā trauksme pret debesīm un ēku gaisīgais vieglums. Salīdzinājumā ar romānikas laikmeta smagnējām tradīcijām gotikas gars parādās apzinātos arhitektonisko konstrukciju mek­lējumos. Jaunā konstruktīvā sistēma radusies, funkcionāli sadalot ēkas struk­tūru. Velvju svars ar ribu stiegrām tiek koncentrēts velves stūros uz stabiem, bet sānu spriegumu uztver kontrforsi un pretbalstu arkas. Šī jaunā konstruk­tīvā sistēma dod iespēju pārvarēt vislielākos augstumus un pārsegt visplašākos plānus. Līdz ar struktūru rodas jauns formu ritms, kas izpaužas stingru līniju vertikāli kāpjošā spraigumā. Gotikas celtņu stila vienotība izriet no visu citu mākslu pakļaušanas arhitektūrai. Arhitekts noteic ne tikai ēkas plānu un kon­strukciju, bet arī visu māksliniecisko veidojumu — skulptūras, logu vitrāžas un mēbeles [108].

Renesanse nāca ar jaunu paradigmu, ar savu arhitektūras stilu kā pretmetu gotikai, un visspilgtākais piemineklis — grandiozā Pētera bazilika Romā. Renesanses un vēlāk baroka meistariem nepiemita tolerance pret iepriekšējās paradigmas arhitektūras meistardarbiem. Tā bija Rietumiem — atšķirībā no Austrumiem — tik raksturīgā savas vienīgās patiesības atzīšana un pie­ņemšana.

Renesanses klēpī jau 16. gs. dzima baroka arhitektūra, kas nāca ar jaunu paradigmu kā pretmetu gan viduslaiku gotikai, gan klasiskās tradīcijas atjau­notājai — renesanses arhitektūrai. Par baroka stila iedibinātājiem uzskata abus lielos renesanses dižmeistarus Mikelandželo un Rafaelu [108]. Šis savdabīgais stils dominēja Eiropas arhitektūrā līdz pat 18. gs.

Vazari, raksturodams Mikelandželo arhitektūras īpatnības, lietojis itāliskos apzīmējumus — cappriccioso, stravagante, bizzaro un nuovo, t. i., patvaļīgi kaprīzs, ekstravagants, dīvains un jauns [108]. Jaunā stila apzīmējums — baroks— arī parasti tiek skaidrots kā dīvains un iregulārs [140]. Loģistikas leksikā epitetu «baroko» bieži lieto nievājoši — apzīmējot kaut ko veselam saprātam nepieņemamu. Arī vēlāk, pēc 18. gs., mākslas vēsturnieki dažkārt runājuši par baroka stila «kroplajām formām» [108], Šī jaunā paradigma bija vairāk iracionāli emocionāla nekā racionāli saprātīga. Te jāuzsver, ka baroka baznīcas arhitektūra bija visspilgtākais pretmets tieši gotikai un, uzspiežot savu stilu, baznīcu pārbūvēs bieži vien tika varmācīgi izkropļotas tīri gotiskā stila celtnes. Visbiežāk tas saistījās ar ugunsnelaimēs un karos nopostītiem diev­namiem. Šajās stihiskajās nelaimēs parasti visvairāk cieta torņi. Tad bieži vien baroka laika celtnieki nevis atjaunoja agrāko slaido, vertikālai dominantei pakļauto gotisko torni, bet tā vietā uzcēla kupolveidīgu, piezemētu un dažkārt pompozu baroka stila torni. Tā neveidojās sinkrēta stilu vienība, bet radās drīzāk dīvains dažādu stilu, dažādu paradigmu hibrīds. Raksturīgs piemērs ir Sv. Vita katedrāle Prāgā. Tā kā katedrāles divi savā vienkāršībā tik skaistie go­tiskie torņi laika gaitā bija saglabājušies, baznīcu paplašinot, tika nolemts uzcelt virs gotiskās Vaclava kapelas trešo torni. Baroka laika celtnieki, aizbildi­nādamies, ka agrākie būves zīmējumi nozuduši, uzcēla izskaistinātu vairāk- pakāpju kupolu — tipisku baroka stila torni, kas kontrastēja ar stilistiski izturētajiem gotiskajiem torņiem.

Gotikas pamatelements ir taisnas, pret debesīm vērstas vertikāles, bet barokā dominē līklīnijas, piezemēts apaļīgums. Vienkāršās, stilistiski skaidrās līnijas vietā izplatījās izsmalcināti ekstravagantu izrotājumu buķete, regulari­tātes vietā — iregulāri veidojumi. Ja gotikā var saskatīt donkihotisku askē­tismu un ezotērisku ideālismu, tad barokam raksturīgs Sančo pikniskais kor­pulentais, pragmatiskā reālismā piezemētais tēls.

Pārveidojot gotiskās baznīcas, baroka perioda celtnieki ne tikai uzlika tām kupolveida torņu «cepures», bet bieži vien izkropļoja arī interjeru. Vienkāršās sarkano kiege]u sienas pārklāja ar «kosmētisku» apmetumu, kanoniskos, kokā grieztos svēto tēlus aizvietoja ar plastiskiem amoriņveida ķerubiem. Baroka meistariem nepiemita ne pietāte, ne tolerance pret anonīmajiem gotisko kated­rāļu celtniekiem. Pavisam citāda attieksme pret romānikas stilā celtajām baznīcām bija gotiskās arhitektūras meistariem. Viņi, cik zināms, nepārveido­ja esošās romāniskās baznīcas, bet cēla jaunas. Tāpēc Eiropā ir saglabājušās gan viduslaiku romānikas, gan gotikas sakrālās celtnes. Te gan jāpiebilst, ka gotiskie celtniecības konstrukciju principi tik būtiski atšķīrās no romāniska- jiem, ka tāda pārbūve diezin vai būtu tehniski iespējama.

Par franču t. s. dižās gotikas izcilāko pērli uzskata Šartras (Chartres) kated­rāli. Šī patiesi grandiozā celtne būvēta 13. gs. (1200.-1260. g.) — gotikas ziedu laikos. Bet tieši šajā celtnē dižgotikas arhitekti — vai nu apzināti, vai neapzi­nāti — iemiesojuši abus viduslaiku sakrālajā celtniecībā dominējošos šķietami pretrunīgos stilus: romānisko un gotisko. Tieši Šartras katedrāli, manuprāt, var uzskatīt par šo abu stilu sinkrētas komplementaritātes paraugu (78. att. 4. piel.). Lai gan katedrāle būvēta gotiskās celtniecības tehnikā un tās iekšbūves pro­porcijās dominē gotikai raksturīgā vertikālā tendence, un gaismas krēslaino burvību veido vitrāžu logi, celtni bagātīgi kuplina romānikas stila arhitek­toniskie elementi. Pašu centrālo rietumu fasādi rotā plašie romāniskā stila logi [140], virs kuriem izvietots apaļais vitrāžu rozes logs (78.a att. 4. piel.). Šis cen­trālais rozes logs atdala asimetriski izvietoto kreiso — gotisko torni no labējā — romāniskā torņa. Asimetriskais rietumu fasādes veidols piešķir Šartras kated­rālei īpašu burvību, tas ir it kā protests pret Rietumos valdošo simetriskā skaistuma ideālu.

Visspilgtāk abu arhitektūras stilu sinkrētiskā komplementaritāte izpaužas katedrāles aizmugures fasādē (78.Ł att. 4. piel.). Kad Francijas apmeklējuma laikā mans draugs profesors Zaks Simons— izcils fizikokīmikis un daiļo mākslu pazinējs — mani aizveda uz Šartru un burvīgās katedrāles laukumā stāstīja par baznīcas celtniecības vēsturi, par to, ka abi torņi — romāniskais un gotiskais — celti vienlaicīgi, lai apliecinātu abu viduslaiku arhitektūras stilu iekšējo radnie­cību, man tas šķita interesanti, bet ne pilnīgi pārliecinoši: ko gan mākslas vēsturnieki visu neizdomā, lai mākslasdarbu iekļautu kādā teorētiski izdomātā šablonā! Taču, kad ieraudzīju katedrāles aizmugures fasādi, pārņēma vienlai­cīgi šoks un apbrīna (78. Ł att. 4. piel.) Abi šķietami pretrunīgie arhitektūras stili bija redzami tīri un neizkropļoti. Kreisajā pusē izvietota masīvi smagnējā romānikas stilā veidotā piebūve ar tipiski plašo logu un rotondveida tornīšiem. Kā pretmets — labējā gotiski gaisīgā piebūve ar raksturīgajiem šaurajiem, vertikāli virzītajiem logiem. Tik atšķirīgi un reizē saderīgi, viens otru papil­dinoši arhitektūras stili. Viens piezemēts, otrs traucas pretim debesīm. Abu būtība iezīmēta tik skaidri kā cilvēcisko arhetipu — Dona Kihota un Sančo — abstrahētie tēli Pikaso grafikā (23. att. 59. lpp.).

Tā manā iztēlē Kinkakudzi (Zelta) templis Austrumos un Šartras katedrāle Rietumos kļuva par Lielo Patiesību komplementaritātes idejas arhitektoniska­jiem simboliem.

Izcilais franču skulptors Ogists Rodēns vienmēr esot apbrīnojis un dievi­nājis gotiskās katedrāles. Tieši gotikas meistardarbiem viņš veltījis vienu no saviem skaistākajiem simboliskajiem darbiem, kas saucas «Katedrāle» (1908, 78.c att. 4. piel.) Tās ir divas akmenī kaltas rokas, kuru plaukstas un pirksti veido varena dievnama sienas, kontrforsus un arkas. Šajā alegoriskajā metaforā jūtams gotikas formu ritms, kas izpaužas slaido pirkstu stingro līniju vertikāli kāpjošajā spraigumā. Starp plaukstām saskatāma katedrāles plašā lūgšanu telpa ar augstajām gotikas velvēm. Tukšumu kā skulptūras sastāvdaļu Rodēns vairākkārt izmantojis arī citos filozofiskas ievirzes darbos, bet «Katedrālē» tam ir īpaši nozīmīgs skanējums. Dievnama sienas ir cilvēka roku darinātas, bet

iekštelpa ir svētvieta Dieva godināšanai, lūgšanām, sakrālām dziesmām un ērģeļu mūzikas polifonijai.

Šai kontekstā atkal gribas atgriezties Austrumos, lai par tukšumu citētu Laodzi filozofisko traktātu ([101]; XI):

Trīsdesmit spieķu saistīti vienā rumbā, Ratu vieglumu nosaka tukšums starp tiem. Podnieki mīca mālu, lai veidotu traukus, Lietojams tikai trauku iedobums. Namdariem, ceļot māju, jāatstāj logi un durvis, Tikai mājas iekšējais tukšums ir apdzīvojams. Esamība ir manta, bet lieto neesamību.

52. FILOZOFISKAS IEVIRZES GLEZNIECĪBAS PARAUGI AUSTRUMOS UN RIETUMOS. SESJU UN LEONARDO DA VINČI

Aplūkosim salīdzinoši divus izcilākos 15. gs. filozofiskās ievirzes gleznotā­jus: Austrumos japāņu ainavistu Sesju un Rietumos — renesanses meistaru Leonardo da Vinči.

Abi gleznotāji — Sesju un Rietumos renesanses meistars Leonardo da Vinči, kā redzams, bija laikabiedri un tiek uzskatīti par pašām augstākajām virsotnēm 15.—16. gs. tēlotājā mākslā atbilstoši Austrumos un Rietumos. Filozofiskā aspektā Sesju pārstāv dzenbudisma meditatīvās ainavas skolu, bet Leonardo darbos nav grūti saskatīt neoplatoniski kristietisko ideju iemie­sojumu.

Leģendāra slava apvij Sesju 1495. gadā gleznoto filozofiski abstrahēto ainavu (79. att. 4. piel.), kuras oriģināls glabājas Tokijas Nacionālajā muzejā. Ainava gleznota monohromā melnbaltā tušas zīmējuma tehnikā, kas raksturīga dzenbudistu filozofiskajām ainavām [191, 130, 185]. Zīmējums nav naturāls dabas attēlojums, bet vispārināts skatījums, kurā atmests viss mazsvarīgais un nejaušais un atstāts tikai būtiskākais. Tas it kā atrodas aiz jutekliskās uztveres robežām un paver neredzamo gara pasauli, kurā saskaramies ar Absolūto īstenību [130]. Dzen ainavas, tāpat kā dzen akmensdārzi, rosina meditatīvām pārdomām par Pasaules eksistences mīklām, par mirkļa un mūžības pretme­tiem, tās rāda prātam ceļu uz apskaidrību — satori.

Ainavas priekšplānā abstrahēti koku un krūmu silueti — ne reāli koki, bet drīzāk koku idejas. Aizmugurē mijkrēslī tinas varenu kalnu masīvu kontūras. Šo ainavu Sesju dāvina savam māceklim un pavadrakstā skaidro, ka viņš pirms trīs­desmit gadiem devies uz Ķīnu, lai apgūtu ķīniešu glezniecības pamatprincipus [191]. Bet vēlākajos gados viņa galvenā skolotāja bijusi un palikusi Daba, aiz kuras daudzveidības viņš iemācījies saskatīt dziļāko, garīguma apdvesto būtību.

Melnais tušas zīmējums un neaizpildītie baltie laukumi saskaņā ar ķīniešu glezniecības principiem, pauž iņ un jan pretmetu mijiedarbību: «tukšums un aizpildījums gleznā dzemdē viens otru» [149]. Ja gleznā attēlo pilnmēnesi, tad jāizjūt arī tā otra — neredzamā puse.

Tieši neaizpildītie laukumi, gleznas šķietamā nepabeigtība rosina skatītāja iz­tēli un padara viņu par radošu līdzautoru. Tukšumam, asimetriskajam aizpildīto un tukšo laukumu sadalījumam ir visbūtiskākā nozīme dzen filozofiskajā ainavā [149]. Ja viss gleznas laukums ir aizpildīts, tas zaudē meditatīvo, iztēli rosinošo jēgu. Pēc dzen estētiski filozofiskajiem principiem nepabeigtība ir tā, kas padara mākslasdarbu atvērtu — skatītāja iztēli rosinošu un meditatīvi stimulējošu. Turklāt dzen ainava jātver kopskatā, holistiski — vienlaicīgi gan aizpildītie, gan tukšie laukumi. Ja skatītājs sāk analizēt zīmējuma detaļas, viņš zaudē tukšuma pretmetu.

Sesju ainavā baltais fons ir laika gaitā nedaudz nodzeltējis [131]. Bet japāņu skatītājā tas pastiprina estētiski emocionālu pārdzīvojumu. Japāņus īpaši uzrunā senas lietas: apsūnojis akmens, koka templis, vecs, saplaisājis tējas trauks, apsūbējis sudrabs, nodzeltējusi ainava. Tas saistās ar īpašu estētisko kategoriju sabi. Laika gaitā radušās iezīmes dēvē par sabi, kas burtiskā tulko­jumā nozīmē — rūsa. Sabi ir neviltota rūsa, arhaiska nepilnība, tā ir senatnes smarža, laika zīmogs [133].

Dzenbudisma filozofiski reliģiskās domas strāvojumos 15. gs. un to izpaus­mē tēlotājā mākslā var saskatīt līdzību ar atbilstošām renesanses laika ievirzēm Rietumos. Renesanse patiesi bija atdzimšana pēc viduslaiku sastingušajām dogmām, kanonizētās tēlotājas mākslas un teoloģiskās sholastikas, kas balstījās uz Svētā Akvīnas Toma un Aristoteļa filozofisko racionālismu. Filozofijā tā bija atgriešanās pie neoplatoniskā iracionāli mistiskā pasaules skatījuma, pie Svētā Augustīna, pie pirmkristiešu gnosticisma un to pirmavota — Platona filozofiskā ideālisma. Gara struktūrā šāda pieeja tuvojās dzenbudisma filozo­fiskajām nostādnēm — gan ar renesansei raksturīgo indivīda pašvērtības apliecinājumu.

Visu triju tā laika ģeniālāko mākslinieku — Leonardo, Mikelandželo un Rafaela — darbos iezīmējas filozofiskas domas vadmotīvs. Kosmoloģiskā filo­zofija caurauž Mikelandželo gigantisko «Pasaules radīšanas» ciklu Siksta kapelā (19. att. 1. piel. un 131. att. 7. piel.). Rafaels vienā no Vatikāna pils sienas lielajām freskām attēlo leģendāro «Atēnu skolu» ar tās filozofijas patriar­hiem Platonu un Aristoteli. Mākslinieks tīri vizuāli parāda tos kā filozofiskās domas pretmetus: Platons norāda uz debesīm, Aristotelis — uz zemi. Tie ir Rietumu filozofijas pirmavotu pretmeti — iracionālisms un racionālisms, ideālisms un reālisms, kas dažādās formās un izpausmēs pārmaiņus dominē vēlākajā Rietumu filozofijā. Taču par filozofiski vissaturīgāko un tai pašā laikā visenigmatiskāko pamatoti uzskata Leonardo gleznu «Klinšu Madonna» [44], kas pazīstama arī ar nosaukumu «Madonna grotā» ([108], II, Glezniecība). Gleznai ir divi varianti. Pirmo, kas glabājas Parīzē, Luvrā, Leonardo gleznojis 1483. gadā trīsdesmit viena gada vecumā kā altārgleznu Sv. Franciska kapelai Milānā. Otrais variants, kas nebūt nav pirmās gleznas kopija, bet gan saturā, gan izpildījuma tehnikā ir krasi atšķirīgs, tapis pēc gadsimta ceturkšņa — 1506. gadā, Leonardo ģēnija pilnbrieda laikā. Sī unikālā glezna glabājas otrā

Eiropas mākslas templī — Londonas Nacionālajā galerijā (80.a un 80.Ł att. 4. piel.). Divdesmit piecu gadu intervāls liecina, ka «Klinšu Madonnas» tēmu Leonardo nav aizmirsis visu mūžu. (Interesanta sakritība: Sesju savu meistar­darbu darinājis 1495. gadā — viduspunktā starp Leonardo pirmās un otrās gleznas tapšanu.)

Man bija iespēja apbrīnot abus manas vismīļākās gleznas — Leonardo «Klinšu Madonnas» — variantus ar vienas nedēļas intervālu Parīzē un Lon­donā 1997. gada rudenī. Sesju meistardarbu atceros no Tokijas Nacionālā muzeja apmeklējuma 1985. gadā. Tikai daudz vēlāk man atausa apskaidrība par šo darbu konceptuālo garīgo līdzību. Tāpat arī doma par Kinkakudzi (Zelta tempja) un Šartras katedrāles arhitektonisko stilu idejisko komplemen- taritāti (sk. 51. eseju).

«Klinšu Madonna» ir dīvainas mistikas un iracionālas noslēpumainības apdvesta, tā ir pilna gan ar filozofiski reliģiskiem simboliem, gan ar neskaid­riem zemteksta mājieniem, kas uztverami tikai meditatīvā saskarsmē.

Gleznas personāžs nav «no šīs zemes», tas ir dievišķas izcelsmes. Centrālā figūra ir Dievmāte Marija, kas ar vienu roku apņēmusi savas māsas Elizabetes mazuli, vēlāko Jāni Kristītāju, bet ar otru svētī savu dēlu Jēzu Kristu. Gleznas kompozīcijā Leonardo izmantojis renesanses meistaru iemīļoto ģeometrisko principu: tai ir izteikti piramidāla pamatforma, kuras virsotni veido Dievmāte. Ceturtā gleznas figūra ir bērnu sargeņģelis.

Luvras variantā visas četras figūras savstarpēji saistītas ar izteiksmīgiem žestiem, kas gleznai piešķir neparastu psihisku dinamiku. Tā ir burvīga roku saspēle — žesti, kas dievina, aizstāv, aizsargā, svētī vai apsola. Eņģelis norāda uz Jāni Kristītāju, kas pirmais sludinās Kristus atnākšanu, bet pats Jānis Kris­tītājs pastiepis roku pret Kristus bērnu, it kā pauzdams vēlāk teiktos vārdus: «Kāds spēcīgāks nekā es nāks pēc manis, kam es neesmu cienīgs noliecies atrai­sīt viņa kurpju siksnas.» (Marka evaņģ. 1:7.) Bet pats Kristus bērns pacēlis rokas divus pirkstus it kā zvērestam, ka Viņš pildīs Tēva uzticēto misiju un uzņemsies visas cilvēces grēku nastu.

Londonas variantā saglabājusies iepriekšējā sasaikne, tikai eņģeļa loma būtiski mainījusies. Viņš ir it kā atslēdzies no notikušā un atgriezies savā iekšējā skatījumā, gara pasaulē. Uzskata, ka šā eņģeļa sejā Leonardo beidzot sasniedzis savu skaistuma ideālu [196]. Tas ir platoniskais garīguma skaistums, kas staro no iekšienes.

Gleznas Parīzes variantā vēl dominē ierastais renesanses kvatročento stils, bet Londonas variantā jau sasniegts t. s. «dižās renesanses» — činkvečento — stila apogejs. Lineāro elementu, kam bija tik liela loma Leonardo laikabiedru Botičelli un Girlandajo audeklos, aizstāj gaismēna, viļņotās maigās kontūras izplūst, to vietā runā formas, kuru krēslainā gaisma, daudzinātais sfumato, apvieno lielās masas, liekot kā akcentiem izcelties nedaudziem izgaismotiem laukumiem ([108], II, Glezniecība, 120. lpp.). Gleznā gaismēnas un sfumato organiski savienojas ar tikai Leonardo rokai raksturīgo plastisko portreta zīmējumu.

«Klinšu Madonnai» ir vēl ļoti nozīmīgs aizmugures — otrais plāns, tā ir maģiskā ainava: masīvās, škautņainās klintis, dīvainie augi, mistiskā gaisma un ūdeņi, kas paveras caur grotas atvērumiem. Tieši ar šo ainavu, manuprāt, Leonardo pauž savas filozofiskās idejas.

Atcerēsimies, ka Leonardo labi pazina Platona un neoplatonistu, it īpaši Plotīna darbus. Tieši Platona un Plotīna filozofisko darbu sējumi līdz ar Eiklīda ģeometriju un latinizēto Bībeli ir to desmit grāmatu vidū, kuras Leonardo pavada uz viņa pēdējo mājvietu Ambuāzas pilī Francijā [196].

Plotīns pasaules būtību saskata pretmetos. Tos veido gars un matērija, dvēsele un miesa, dievišķais un cilvēciskais [94], Tikai gremdējoties savā dvēselē, atbrīvojoties no ārējās pasaules mainīgajiem iespaidiem, cilvēks var ieraudzīt «mūžīgo gaismu», visu lietu un parādību avotu — Vienoto. No Vienotā dzimst Gars— Nūss (no grieķu vai. vārda nūs— prāts, gars).

Savu filozofisko apcerējumu apkopojumā — «Enneadās» — Plotīns runā par Gara un Vienotā attiecībām: «Gars, kas dzimst no Vienotā, ir it kā no viņa izplūstoša gaisma, turklāt viņš pats no tā nemaz nemainās un paliek miera stāvoklī līdzīgi tam, kā saule, kas pastāvīgi visur izplata gaismu, no tā nepa­visam nenonāk kustībā..» (Citēts pēc [94], 197. lpp.) «Dvēsele paliek bez gais­mas, ja tai liegta Dieva klātbūtne, bet tad, kad Dievs to apgaismo, tā sasniedz to, ko ir meklējusi.» ([94], 201. lpp.)

Plotīns uzskata, ka mākslas uzdevums ir saskatīt aiz ārējām, mainīgām parā­dībām mūžīgo, Gara — Nūsa izstaroto gaismu. Pasaule ir dievišķi skaista. Jau Platons ir teicis, ka Daba ir noslēpumaina dzeja. Bet Pasaule ir skaista tāpēc, ka Gars to ir darinājis pēc nemirstīgu ideju parauga. Tāpēc arī māksla ir nozīmīga tikai tad, ja tai ir izdevies atainot objektīvi pastāvošo Pasaules dievišķo skais­tumu. Šim Plotīna skaistuma ideālam visvairāk ir pietuvojies Leonardo.

Renesanses gars atklājas tieši šādā neoplatoniskā pasaules skatījumā. Rene­sanses reliģiozitāte, kā īpaši redzam Leonardo «Klinšu Madonnā», izpaužas dievišķās pilnības identificēšanā ar dabas skaistumu. 15. gs. tieši Florence kļuva par renesanses neoplatonisma atdzimšanas centru. Leonardo tur pavadīja jaunības un mācību gadus. Viens no ietekmīgākajiem Florences aristokrātiem mecenāts Mediči nodibināja Platona akadēmiju. Ievērojamākais renesanses neoplatonisma atjaunotājs ir Florences filozofs, Leonardo laikabiedrs Marsilio Fičīno. Fičīno ir pārliecināts, ka starp neoplatonismu un kristietību nevar būt pretrunu — ir tikai jāsaskaņo kristietības teoloģija ar neoplatonisma kosmo- loģisko pasaules skatījumu [94], Fičīno, tāpat kā Asīzes Francisks, uzskata, ka daba ir Dieva gara izpausme. Cilvēks ne vien ierauga Dievu lietu un parādību pasaulē, bet arī redz, cik tā dievišķi skaista. Komentāros par Platona «Dzīrēm»

Fičīno raksta: «Skaistums ir kāds akts vai stars no turienes, kas iekļūst visur: vispirms eņģeļu prātā, otrkārt — visas pasaules dvēselē un pārējās dvēselēs, treškārt — dabā, ceturtkārt — ķermeņu matērijā. [..] Līdzīgi tam, kā viens saules stars apgaismo četrus elementus — uguni, ūdeni, zemi un gaisu —, viens dievišķais stars apskaidro prātu, dvēseli, dabu un matēriju. Un, kā tas, kurš raugās uz šo gaismu, šajos četros elementos saskata pašu saules staru un caur to ierauga saules augstāko gaismu, tā ari tas, kurš vēro un mīl skaistumu katrā no četriem rangiem — prātā, dvēselē, dabā un ķermeni —, vēro un mīl tajos Dieva mirdzumu un tāda veida mirdzumā vēro un mīl pašu Dievu.» (Citēts pēc [94], 236. lpp.)

Renesanses cilvēka izpratnē jebkurš mākslasdarbs var būt tikai dižā Meis­tara — Dieva vāja atblāzma, taču, cenšoties tuvināties pilnībai, mēs tuvo­jamies tās avotam — Dievam [94],

Tieši «Klinšu Madonnā», manuprāt, Leonardo ir lieliski izdevies iemiesot renesanses domātāju ideālus un burvīgi sintezēt kristietības idejas ar neoplato- niskās filozofijas ievirzēm. Priekšplānā dievišķais četrinieks pauž cēlāko un būtiskāko, ko cilvēcei devusi kristietība, aizmugures plāna dabas alegorija ir Platona un neoplatonistu ideju caurstrāvota. Nav grūti iedomāties, ka grota simbolizē Platona alu un tās atvērumi paver skatu uz gara ideju pasauli, uz absolūto īstenību.

Agrīnajā Luvras gleznā ārpusgrotas pasauli, šķiet, izgaismo rītausmas saule, kalnu grēdas un ūdeņi vēl krēslā tīti. Arī dievišķā četrinieka sejas it kā izgaismo rīta blāzma. Leonardo ģēnija pilnbriedumā veidotajā Londonas variantā jau jūtama novakara gaisotne. Kalni un ūdeņi atmirdz zili zaļā spožumā, un lielā četrinieka sejas izstaro sniegbaltu dievišķu gaismu. Varam piekrist, ka tieši eņģeļa sejas veidolā Leonardo sasniedzis dižās renesanses ideālu — gleznie- cisku dievišķā skaistuma piepildījumu. No četrotnes tieši eņģelis jau atgriezies aizgrotas garīguma pasaulē. Mākslinieks to uzsver, aizstājot eņģeļa apmetnī sarkano, dzīvi apliecinošo krāsu ar zilo — mūžības krāsu.

«Klinšu Madonnā» Leonardo netieši apliecina, ka atbalsta pitagoriešu un neoplatonistu sludināto tetraktijas (četrkārtības) jeb kvaternitātes principu (sk. 77.3. eseju). Pitagoriešiem skaitlis četri ir svēts un simbolizē pilnību — vienību starp Debesīm un Zemi. Tas izskan pitagoriešu sakrālajā zvērestā: «Viņš, kurš mūsu dvēselē iedēstīja skaitli četri, kas ir mūžīgi plūstošās radīšanas avots un saknes.» [103] Tā kā Leonardo gleznas pamatmotīvs ir tieši vienība starp Debesim un Zemi, nav jābrīnās, ka viņš savā darbā iemūžināja četrinieka simbolu. Cet rus veido divi no Zemes (Jānis un Marija) un divi no Debesīm (Jēzus un eņģelis). Līdzīgu četrinieka motīvu Leonardo izmanto vēl vienā no savām pēdējām gleznām — «Svētajā Annā». Tajā četrinieku veido Marijas māte Anna, Marija un abi mazuli — līdzīgi kā «Klinšu Madonnā» Jēzus un Jānis Kristītājs. Šī Leonardo vismīļākā glezna palikusi nepabeigta, tās oriģināls

2I(> glabājas Luvrā, bet krīta zīmējuma tehnikā veidots uzmetums — Londonas Nacionālajā galerijā. Šie Leonardo darbi tieši ar savu nepabeigtību ir tuvi Austrumu glezniecības principiem. Ārēji — gan sižetiski, gan izpildījuma tehnikā — Leonardo «Klinšu Madonna» un Sesju «Ainava» šķiet tik atšķirīgi, pat nesalīdzināmi darbi. Bet tieši to filozofiskā ievirze, garīgā infrastruktūra ir dziļi līdzīga. Tie ir viena un tā paša laikmeta garīguma simboli Austrumos un Rietumos. Tajos ir līdzīgi pieskārieni Mūžībai.

53. DABAS FRAKTĀĻU ĢEOMETRIJA

Pēdējos gados ir radusies jauna ģeometrijas nozare — fraktāļu ģeometrija. Tajā klasiskās Eiklīda ģeometrijas taišņu, trīsstūru, kubu un piramīdu vietā pētījumu objekts ir līkloču līnijas, to sazarojumi visfantastiskākajās figūrās, kādas vien sastopamas dabā. Un tiešām, fraktāļu ģeometrija spēj aprakstīt vis­sarežģītākos telpiskos veidojumus — upju kontūras, padebešus, galaktikas, bet — pats galvenais — arī dzīvās dabas objektus no papardes lapas līdz cilvēka asinsrites, elpošanas ce|u un nervu sistēmai. Fraktāļu ģeometrija radusies ciešā sasaiknē ar moderno haosa teoriju, jo tieši fraktāļu dinamika spēj aprakstīt robežjoslu starp haosu un pašorganizējošām, regulārām struktūrām. Kā trāpīgi definējis fraktāļu ģeometrijas pamatlicējs amerikāņu matemātiķis un fiziķis Benuā Mandelbrots, fraktāli ir dabas ģeometrija ([46], 122. lpp.). Bet jau Gali- lejs tika teicis, ka «lielā Dabas grāmata ir rakstīta matemātiskā valodā», piebilz­dams, ka «tās burti ir trīsstūri, apli un citas ģeometriskās figūras, bez kurām būtu veltīgi jāmaldās tumšā labirintā» (citēts pēc [46], 123. lpp.). Tomēr, kā uzsver Mandelbrots [109], eiklīdiskā standarta ģeometrija nespēj aprakstīt, piemēram, mākoņu formas, kalnus un kraujas, jūras krasta līnijas, zāli un kokus vai zibens trajektoriju. Jo mākoņi nav lodes, kalni nav konusi, krasta līnijas nav loki, koku miza nav gluda un zibens nepārvietojas pa taisni. Daba demonstrē ne tikai augstāku, bet būtiski atšķirīgu kompleksitātes pakāpi. Eiklīda ģeometrija šīs sarežģītās dabas parādības uzskatīja par «bezformu» veido­jumiem ar «amorfu» morfoloģiju, kas nav piemērota zinātniskam, ģeometri- zētam aprakstam.

54. FRAKTAĻU IEDĪGĻI. GEORGA KANTORA

«PARADĪZES PUTEKĻI»

Pamatoti uzskata, ka fraktāļu ģeometriju iedibinājis Benuā Mandelbrots mūsu gadsimta septiņdesmitajos gados [109, 46], Bet pats Mandelbrots no­rāda, ka tās iedīgli parādījušies jau 20. gs. sākumā un vienlaicīgi ar relativitātes teoriju un kvantu fiziku iezīmējuši modernās matemātikas dzimšanu. Fraktāļu ģeometrija bija tās pašas paradigmas sastāvdaļa, kurai bija lemts aizstāt kā Ņūtona mehānisko determinismu, tā Eiklīda klasisko ģeometriju. Visnozī­mīgākais šāds iedīglis bija Georga Kantora atklātā kopu teorija, ko nosauca viņa vārdā. Kantora laikabiedrs, izcilais matemātiķis Dāvids Hilberts šo teoriju nosauca par vārtiem uz paradīzi, no kuras neviens mūs vairs nevarēs izraidīt.

Citādās domās bija franču matemātiķis Anrī Puankarē. Viņš uzsvēra, ka «kantorisms ir slimība, no kuras matemātika nekad neatveselosies» ([166], 187. lpp.). Šī «slimība» iezvanīja jaunās matemātiskās paradigmas dzimšanu; to vēlāk nosauca par fraktāļu ģeometriju.

Ir zināms, ka saskaņā ar Eiklīda ģeometriju taisnei ir viena dimensija (D = 1), bet matemātiskam punktam — nulles dimensija (D = 0). Kantors sāka manipu­lēt ar taisnes nogriezni slēgtā intervālā starp 0 un 1 [0, 1], Viņš izgrieza no šā taisnes segmenta vienu trešdaļu (starp 1/3 un 2/3), pēc tam to atkārtoti turpināja katram palikušajam segmentam. Atkārtojot šo operāciju, varēja intuitīvi sagaidīt, ka beidzot tiks sasniegts stāvoklis, kad paliek punktu kopa ar nulles dimensiju (D = 0). Rezultāts bija pārsteidzoši atšķirīgs no gaidītā un, pēc paša Kantora vārdiem, pilnīgā pretrunā ar plaši pieņemtajiem uzskatiem par matemātisko bez­galību! Proti, galarezultātā veidojās bezgalīga nesanumurējama fraktālā kopa no sava veida punktu «putekļiem». Izrādījās, ka šo punktu kopas fraktālā dimensija DH līdzinās 0,63 — vērtībai, kas atrodas starp 0 un 1. Tātad Kantora «putekļi» ir ar daudz lielāku fraktālo dimensiju nekā tikai viens punkts (D = 0), bet ar daudz mazāku nekā taisne (D = 1) [166]. Šāda daļskaitļa dimensija piemīt, kā vēlāk redzēsim, visiem fraktāļiem, un Kantora atklātie punktu «putekļi» tiešām ir frak­tāli. Vēlāk po(u matemātiķis Vaclavs Serpiņskis parādīja, ka līdzīgi Kantora tipa «putekli» veidojas arī uz plaknes vai telpā. Uz plaknes to fraktālā dimensija līdzi­nās 1,58, t. i., «vidū» starp taisnes (D = 1) un plaknes (D = 2) dimensijām [166]. Diemžēl daudzi matemātiķi šos veidojumus uzskatīja par «patoloģiskiem» un ironiski nosauca par «monstru galeriju». Neviens pat neiedomājās, ka šādām struktūrām varētu būt kāda loma dabas parādību aprakstā vai skaidrojumā.

55. MANDELBROTA FRAKTĀĻI — JAUNA ĢEOMETRIJAS PARADIGMA

Benuā Mandelbrots uzsver, ka Daba ir izspēlējusi joku ar matemātiķiem [109]. 19. gs. matemātiķiem vienkārši pietrūcis iztēles, bet Dabai tās netrūkst. Tās pašas «patoloģiskās» struktūras, kuras matemātiķi izgudroja, lai atbrīvotos no 19. gs. naturālisma, izrādījās jau iemiesotas apkārtējā mums pazīstamajā dabā.

«Tas apstiprina,» saka Mandelbrots, «Blēža Paskāla apgalvojumu, ka cilvēka iztēle nobāl dabas daudzveidības priekšā.» Un to apgalvojis Paskāls, kas tā ticēja Eiklīda ģeometrijas visvarenībai!

Strādājot 1975. gadā pie esejas par jauno ģeometriju, Mandelbrotam bija jāatrod tai piemērots vārds. Atceroties pazīstamo latīņu teicienu «Nomen est numen» — dot vārdu nozīmē zināt, Mandelbrots izvēlējās nosaukumu «fraktālis» no latīņu vārda «fractus». Šis vārds nozīmē akmens lausku — nolauztu un neregu­lāru [109]. Fraktāļiem piemīt ģeometriskas formas, kas atšķirībā no Eiklīda ģeometrijas formām ir izteikti neregulāras. Fraktāļu ģeometrijas tapšanā neno­liedzami visnozīmīgākā loma ir bijusi personālajiem datoriem (PQ. Tā kā Benuā Mandelbrots strādāja IBM Pētniecības laboratorijā, viņam bija pieejami tai laikā vismodernākie datori. Fraktāļu ģeometrijas būtiskākā īpatnība ir tā, ka tos var vizuālizēt uz PCdispleja, aizstājot analītiskās izteiksmes iterācijas procesā ar tiešu vizuālu fraktāļa attēlu, kurā visa fraktāļa kopa tiek sadalīta uzskatāmos fragmen­tos, ko var tā sauktajā skeilinga (sealinģ) procesā atbilstoši gan palielināt, gan samazināt praktiski neierobežotā diapazonā. Tas dod iespēju gluži kā mikroskopā aplūkot fraktāļu ainas vissīkākajās detaļās. Interesanti, ka etimoloģiski fraktālis ir algebras pretmets (vārds «algebra» cēlies no arābu vārda «jabara», kas nozīmē — sasaistīt kopā). Algebra, kā zināms, ir analītisks aritmētikas vispārinājums. Analītiskajā ģeometrijā (kuras pamatlicējs bija Renē Dekarts) no uzskatāmām ģeometrijas formām pāriet uz vispārinātām analītiskām izteiksmēm. Arī Laplass darbā «Debesu mehānika» izvairījās no jebkuras vizuālas ilustrācijas! Fraktāļu ģeometrija turpretim iet pretējo ceļu — no analītiskām izteiksmēm uz to vizuali- zāciju un sadalīšanu uzskatāmos fragmentos, kas projicējas uz datora displeja.

Benuā Mandelbrots uzskata, ka jāturas pie principa «redzēt nozīmē ticēt» {«to see is to believe», [109], 21. lpp.). Šis ir atkal jauns piemērs daudzkārt pieminētajam komplementaritātes principam, kurā kā pretmeti parādās vizuālā un analītiskā pieeja. Kā vēlāk redzēsim, šie ir divi visbūtiskākie domāšanas un izziņas komplementārie modeli.

56. FRAKTĀĻI UN DETERMINISTISKAIS HAOSS

Fraktāļu ģeometrija ir cieši saistīta ar moderno haosa teoriju. Haoss un frak­tāli kā izpētes objekts savukārt ir saistīti ar citu modernās zinātnes nozari — nelineāro sistēmu dinamiku. Tās ietvaros tiek pētītas sistēmas, kas uz ārēju stimulu reaģē nelineāri: tajās neliels impulss var izraisīt gigantiskas novirzes; nelineārās sistēmās nelielas kļūdas sākumstāvoklī var novest pie eksponenciāli pieaugošām novirzēm sistēmas turpmākajā evolūcijā. Uzskatāms piemērs tam ir jau aprakstītais «tauriņa efekts» («butterfly effect»). Ja šādas sistēmas dinamika sākotnēji ir strikti determinēta (ņūtoniska), tad nelineāro efektu rezultātā tā var pāriet uz nesakārtotu, haotisku stāvokli, kura aprakstam jālieto statistiskās varbūtības teorijas metodes. Reālā dabā visbiežāk sastopams t. s. determinis- tiskais haoss.

Te jāuzsver, ka nelineāro dinamisko sistēmu deterministiskais haoss nav identificējams ar totālu nesakārtotību, pilnīgu neprognozējamību un pakļau­šanos tikai stohastiskiem gadījuma likumiem. Zināmā mērā tas ir determinēts, gadījuma procesu loma tajā ir ierobežota. Tieši deterministiskā haosā realizējas iepriekš pieminētais Hākena formulētais sinerģētikas pamatpostulāts: «Gadī­jums un nepieciešamība — reālā pasaulē vajadzīgi abi (Chance and necessity — reality need both).»

Gan nedzīvajā, gan dzīvajā dabā pārsvarā sastopamas tieši šādas dinamiski nelineāras sistēmas ar augstu kompleksitātes (sarežģītības) pakāpi. Tajās komplementāri līdzdarbojas gan gadījums, gan nepieciešamība, t. i., gan deter- minisma, gan indeterminisma princips. Šeit svarīgi norādīt, ka topoloģiskam šādu nelineāru, haotisku sistēmu aprakstam izmanto tieši fraktāļu ģeometriju. Visur, kur dabā haotisku procesu rezultātā veidojas struktūras, piemēram, jūras krasta līnijas, ģeoloģiskie noslāņojumi, kalnu veidojumi, mākoņi, ūdens virpuli, — šīs struktūras veido fraktāļus. Fraktāļu daba ir gan jūras krasta līni­jai, gan kalnu konfigurācijām, gan mākoņu formām un turbulentām ūdens plūsmām. Vēl izteiktāk fraktāļu daba piemīt dzīvās dabas veidojumiem — augiem, kokiem, cilvēku un dzīvnieku orgāniem. Visi šie veidojumi ir ļoti sarežģīti. Puskvantitatīvu, vizuāli uzskatāmu kompleksitātes novērtējumu ieteicis Marejs Gells-Manns grāmatā «Kvarks un jaguārs» («The Quark and the Jaguar», [52]) ar trāpīgo apakšvirsrakstu «Piedzīvojums Vienkāršajā un Sarežģītajā» («Adventures in the Simple and the Complex»). Autors parāda, ka gan ideāli regulārās, gan totāli nesakārtotās, pilnīgi haotiskās sistēmās ir daudz zemāka kompleksitātes pakāpe nekā sistēmās, kas atrodas starp tām, t. i., ir tikai da|ēji sakārtotas, haotiskas ar struktūras domēniem, un ko dinamiskā aspektā var raksturot kā deterministiski haotiskas ([52], 28. lpp.). Pati nozīmī­gākā šo sistēmu īpašība ir to augstākā adaptivitātes spēja. Tā sevišķi raksturīga dzīvajām sistēmām un būtībā ir dzīvības pamatā.

57. BRAUNA KUSTĪBA KĀ DETERMINISTISKĀ HAOSA

PROTOTIPS

Vispirms aplūkosim vienu no vienkāršākajiem deterministiskā haosa piemē­riem — Brauna kustību. Tā ir ar mikroskopu novērojama ūdenī vai gāzē «iekarinātu» sīku dalinu haotiskā kustība, ko izraisa vides molekulu termisko kustību triecieni. Šo parādību pirmais novēroja angļu zinātnieks Roberts Brauns 1827. gadā, ar mikroskopu pētot ūdenī «iekarinātu» ziedputekšnu tra­jektorijas. Tipiska šādas daļiņas trajektorija parādīta 81. attēlā (224. lpp.). Kā redzams, šī trajektorija šķiet esam pilnīgi haotiska. Tomēr var saskatīt arī noteiktu likumsakarību, proti, distance starp sekojošiem triecieniem mainās samērā šaurās robežās. Praktiski nav iespējams prognozēt daļiņas kustības virzienu, bet katrā solī noietā distance ir determinēta samērā šaurās robežās. Tāpēc varam teikt, ka haoss šajā gadījumā ir deterministiski ierobežots, te parādās gan gadījuma, gan nepieciešamības elementi. Kā Brauna kustības «sadzīvisko» analogu var minēt dzērāja streipulošanu, kuras haotisko dabu (krieviski — «cnyMafiHoe 6jiyjKflenne») nosaka atbilstošie juceklīgie procesi organisma līdzsvaru regulējošajos smadzeņu centros.

Marejs Gells-Manns izsaka interesantu ideju ([52], 27. lpp.), ka haosu var uzskatīt par mehānismu, kas kvantu fizikai piemītošo indeterminismu «pastip­rina» makroskopiskos līmeņos. Citiem vārdiem, «iedēsta» indeterminismu makro- pasaules deterministiskajās sistēmās.

Interesanti, ka 20. gadsimta sākumā veiktie A. Einšteina un M. Smoluhovska Brauna kustības teorētiskie pētījumi apstiprināja molekulāri kinētiskās teorijas pareizību un veidoja pamatus jaunai fizikas nozarei — statistiskajai fizikai. Savukārt, balstoties uz franču fiziķa Ž. Perēna un zviedru fiziķa T. Svedberga eksperimentālajiem Brauna kustības mērījumiem, varēja noteikt tādus svarīgus

dabas universālos pamatlielumus kā Bolcmana konstanti k (sk. (6) formulu) un

23 1

Avogadro skaitli, (t. i., molekulu skaitu vielas molā) N = 6,022 x 10 mol" .

81. att. Da|ipas Brauna kustības zigzaga trajektorija, ko var aprakstīt detcrministiskā haosa teorijas ietvaros.

58. HAOSS, TROKŠŅI, «BALTĀ», «BRŪNĀ»

UN «ROZĀ» MŪZIKA

Nelineāras dinamiskas sistēmas haotiskuma pakāpi vislabāk raksturo tajā noritošo procesu izraisīto trokšņu daba. Turklāt termins «troksnis» šajā gadī­jumā neapzīmē akustisku parādību. Mēs varam runāt par atomu un molekulu haotiskās svārstības raksturojošo troksni, par elektronu radīto troksni elek­triskās kontūrās u. c. Haotiskie trokšņi veido t. s. fonu, kas var traucēt mūs interesējošo signālu uztveri. Tāds fons ir, piemēram, šņākoņa radiouztvērējā un ekrāna mirgošana tālrādi. Dažādas haotisma pakāpes trokšņus uzskatāmi atveidojis Manfrēds Šrēders grāmatā «Fraktāli, haoss, likumības» («Fractals, Chuos, Poiver Latus», [166], 109. lpp.).

Totālu, absolūti neprognozējamu haosu raksturo t. s. baltais troksnis (82.A att. 227. lpp.). Baltais troksnis ir līdzīgs baltai gaismai, tajā pārstāvētas visas iespējamās frekvences. Tāpēc tā jaudas spektrs ir konstants, neatkarīgs no frekvences, t. i., \/f° = 1. Baltā trokšņa muzikālajā atainojumā (82.a att. 227. lpp.) ikvienam «tonim» var sekot jebkurš gadījuma tonis ar jebkuru skaņas ilgumu. Šāda «mūzika» ir pilnīgi atonāla, tās nākamās frāzes attīstība ir absolūti neprognozējama.

Molekulu Brauna kustībai raksturīgais troksnis parādīts 82.B attēlā (227. lpp.). Tam dots nosaukums brūnais troksnis (vārdu sjiēle: angļu vai. brown— brūns). Brūno troksni raksturo otrās pakāpes \lf jaudas spektra atkarība no frekvences f. Šī atkarība nosaka, ka brūnajā troksnī dominē «skaņu» secība ar nelielām frekvences (vai skaņas ilguma) izmaiņām; lielas izmaiņas (vai lēcieni) ir stipri mazāk varbūtīgi. Brūnā trokšņa «muzikālā» aina attēlota 82.b zīmējumā (227. lpp.). Kā redzams, brūnā Brauna «mūzika» ir izteikti monotona, garlaicīga, katru nākošo «toni» var zināmā mērā prognozēt, skaņas frekvence, tāpat ilgums, mainās nelieliem lēcieniem. Šī muzikālā aina uzskatāmi parāda, kā fizikāli izprast Brauna kustības deterministisko haosu. Varam teikt, ka Brauna brūnā mūzika ir uzskatāma deterministiskā haosa metafora. Dažādas šā «ierobežotā» haosa formas ir jo plaši sastopamas daudzās augstas kompleksitātes pakāpes nelineārās dinamiskās sistēmās, it īpaši dzīvajā dabā, jo tieši šā tipa haosā komplementāri sadarbojas gadījuma un nepieciešamības, determinisma un inde­terminisma sinergētiskās kategorijas. Reālā komponistu radītā un cilvēka ausij estētiski pieņemamā mūzika atrodas starp šīm abām galējībām. Tā ir vistuvāk t. s. rozā troksnim (82. C att. 227. lpp.), kura jaudas spektrs ir atkarīgs no frekvences pirmās pakāpes, t. i. l/f Šis rozā haoss vistuvāk atbilst amerikāņu matemātika Džordža Deivida Birkhofa «estētisko vērtību teorijai». Saskaņā ar Birkhofa teoriju mākslas darbs ir estētiski patīkams un interesants, ja tas nav pārāk regulārs un iepriekš prognozējams, taču nav arī pārblīvēts ar pilnīgi negaidītiem pārsteigumiem vai risinājumiem. Abus šos robežgadījumus rak­sturo brūnais un baltais troksnis. Turpretim rozā troksnis var būt muzikāli tīri interesants — ne pārāk daudz noteiktības, ne pārāk daudz patvalas.Viss plašais trokšņu spektrs var tikt ietverts trokšņu jaudas spektra frekvences pakāpes inter­vālā/ a no a = - 2 (brūnais troksnis) līdz a = 0 (baltais troksnis).

Kā analīzē atklāja Ričards Voss un Džons Klārks [195], lielāko dalu muzi­kālo kompozīciju var aprakstīt ar hiperbolisko \lf frekvences izmaiņu atka­rību, t. i., tie it kā iekļaujas rozā trokšņa kategorijā. Tā, piemēram, Baha Pirmais Brandenburgas koncerts gan pēc frekvenču intervālu spektra, gan pēc skaņas intensitātes variācijām (oti tuvu seko homogēnajam \lf pirmās pakā­pes (a = -1) likumam [195]. Kā trāpīgi teicis van der Pols, Baha mūzika «ir liela tāpēc, ka tā ir pietiekami determinēta (a < 0), bet tai pašā laikā pietie­kami bagāta ar pārsteigumiem (a > -2)» ([166], 109. lpp.). Tātad, ja Baha mūziku vairāk raksturo tās rozā spektrs (a ~ -1), tad Šēnberga modernā atonālā mūzika jau stipri vairāk tuvojas baltā trokšņa spektram. Tā redzams, cik cieši mūzikas estētiskā teorija saistīta ar moderno haosa teoriju.

Visus trīs trokšņa (vai mūzikas) paveidus var raksturot ar korelācijas jeb sasaistes faktoru. Brūnie trokšņi jeb brūnā mūzika ir strikti korelēta. Katrs nākošais virzības solis laikā ir cieši saistīts ar iepriekšējo un nosaka nākamo — mūzikas valodā tas nozīmē, ka nākamais tonis vai tā garums ir saistīts ar iepriekšējo (82.B un 82.b att. 227. lpp.). Korelācija ļauj prognozēt virzību laikā. Tieši šā apstākļa dēļ brūnais troksnis (jeb brūnā mūzika) raksturīgs sistēmām, kas attīstās deterministiskā haosa apstākļos. Kā jau minējām, deter- ministiskais haoss dominē daudzās dabas parādībās, kuras var aprakstīt frak­tāļu ģeometrijas ietvaros. Tajās var ierindot gan molekulu Brauna kustību (81. att. 224. lpp.), gan augu un dzīvnieku morfoģenēzi (sk. 65. eseju).

Baltais troksnis jeb baltā mūzika ir absolūti nekorelēts un neprognozējams. Katrs solis virzībā ir pilnīgi neatkarīgs no iepriekšējā un sekojošā sola. Muzi­kāli tā ir pilnīga kakofonija, totāls haoss (82.A un 82.a att. 227. lpp.). Balto troksni imitē gadījuma skaitļu elektroniskie ģeneratori vai — vienkāršāk — metamais spēļu kauliņš vai rulete. Tā spēļu kauliņa uzrādītais skaitlis ir pilnīgi gadījuma rakstura un nav saistīts ne ar iepriekšējā, ne ari ar nākamā metienā iegūto skaitli.

Visinteresantākais ir rozā troksnis un tam atbilstošā rozā mūzika, kas rak­sturo jaudas spektra 1//atkarību no frekvences (82.Cun 82.c att. 227. lpp.). To var uzskatīt par ierobežotā haosa izpausmi, tajā ir gan noteiktības, gan

82. att. Baltais (A), brūnais (B) un rozā (C) troksnis un tiem atbilstošā «baltā» (a), «brūnā»(b) un «rozā» (c) mūzika tradicionālajā nošu pierakstā [1661.

pārsteiguma elementi. Tieši tāpēc, kā pierādījuši muzikālās akustikas pētnieki [166, 51]), rozā troksnis ir vistuvākais komponistu radītai mūzikai. Interesanti, ka Mf tipa rozā trokšņi parādās daudzos mainīgas regularitātes periodiskos dabas procesos. Tā britu ģeofizikis Dž. Hērsts, kas gandrīz visu dzīvi veltījis Nīlas ūdenslīmeņa ikgadējo korelāciju pētījumiem, konstatējis, ka tās notiek pēc 1 tf tipa rozā trokšņa likuma [3, 51]. Tā kā šīs izmaiņas ir ierobežoti hao­tiskas, tās var ar zināmu varbūtības pakāpi prognozēt. Iespējams, ka tieši šī likumsakarība ļāva Jēkaba dēlam Jāzepam, kā to vēsta Bībele un tēlaini apraksta Tomass Manns aizraujošajā vēsturiskajā romānā «Jāzeps un viņa brāli», iz­tulkot faraona sapņus un paredzēt Ēģiptē septiņus pārpilnības un septiņus bada gadus.

Rozā troksnis ar Mf frekvences atkarību konstatēts daudzos kosmiskos procesos, piemēram, Saules plankumu izmaiņās (tie nosaka magnētiskās vē­tras un ilgstošas klimata izmaiņas uz Zemes), Zemes ass svārstībās, globālajās temperatūras izmaiņās, kvazāru starojuma intensitātes maiņās un daudzos citos dabas procesos [3, 51]. Šos ierobežotam haosam raksturīgos rozā procesus var patiesi nosaukt par polifonisku musica mundana (kosmisko mūziku).

Rozā trokšņi raksturīgi arī bioloģiskām sistēmām. Tā, piemēram, biomem- brānu strāvas ir ar jaudas spektra Mf atkarību no frekvences [51].

Benuā Mandelbrots piemin interesantu faktu: cilvēka perifērajā nervu sis­tēmā, kas kontaktē ar apkārtni, signālu daba tuvojas baltā trokšņa spektram. Bet, novadīts līdz smadzenēm, troksnis tiek atfiltrēts un tuvinās 1 lf tipa rozā troksnim [51]. Tas vēlreiz apstiprina pašlaik plaši izplatīto uzskatu, ka cilvēka smadzenes funkcionē ierobežotā haosa režīmā. Šis process ir svarīgs nosacījums jaunrades procesiem.

59. PARADIGMU MAIŅA MŪZIKĀ. NO BAHA UN MOCARTA LlDZ ŠĒNBERGAM UN KEIDŽAM

Mūzikā, tāpat kā cilvēces kultūras aktivitāšu jomās, iezīmējas izteiktas, laik­metam raksturīgas paradigmu maiņas.

Ilgu laiku — no 9. gadsimta līdz pat 18. gadsimta vidum — mūzikā domi­nējošā ir polifoniskā baznīcas mūzika. Tās aizsākumus iezīmē viduslaiku un renesanses polifoniskās motetes, bet kulmināciju tā sasniedz baroka sakrālās mūzikas lielmeistara Johana Sebastiāna Baha kanonos un fūgās [1], Šī Dieva godināšanai veltītā mūzika ir polifoniskajā struktūrā izomorfa gotiskām un baroka katedrālēm, kuru velvēs tā skanēja un kuru daudzveidīgo arhitektoniku bieži vien salīdzina ar akmenī sastindzinātu mūziku. Polifoniskās mūzikas no­rietu iezīmē Johana Sebastiāna Baha nāve 1750. gadā. Par polifonijas visaugstāko sasniegumu uzskata J. S. Baha pēdējo meistardarbu «Fūgas māksla» {«Die Kunst der Fuge», 1749.-1750. g., [1]). Tas satur divdesmit fūgas un kanonus, kuros, izmantojot vienu pamattēmu, ilustrētas kontrapunkta tehnikas daudzveidīgās polifoniskās iespējas. Nosaukums «kontrapunkts» cēlies no latīniskā termina con- trapunctus vai, precīzāk, punctus contrapunctum, — tas nozīmē: «noti pret noti» vai — plašākā izpratnē — «melodiju pret melodiju». Var teikt, ka tas ir sinonīms vārdam «polifonija» [1]. Polifoniskais kontrapunkts dziļākajā būtībā iemieso komplementaritātes principu — melodijas harmoniski papildina viena otru, veidojot vienotu veselumu. J. S. Baha «Fūgu mākslas» pēdējās nepabeigtās fūgas partitūras pēdējā lappuse parādīta 83. attēlā (230. lpp). Šis fūgas nobeigumā parādās jauna tēma, kuru muzikāli veido komponista uzvārda burti B—A— C-H vācu nošu apzīmējumā. Šis tēmas aizsākšana, kuru komponists gribēja tālāk at­tīstīt fūgas nobeigumā, beidzās traģiski. Uz nepabeigtās fūgas manuskripta Johana Sebastiāna Baha dēls Kārlis Filips Emanuēls uzrakstījis: «N. B. Kompo­nējot šo fugu, vietā, kur notīs parādās vārds B-A-C-FI kā kontrapunkts, kom­ponists nomira.» [72] Būdams akls, viņš vēl pirms nāves sacerēja dziļa traģisma caurstrāvotu korāli «Kad dziļā izmisumā esam» (« Wenn wir in hdchsten Noten sein»), Duglass Hofsteters [72] šo traģisko notikumu izskaidro ar skaņu kopas B-A-C—H izraisīto rezonansi komponista dvēseles stīgās, kuru pašfrekvences emocionālā amplitūda pārsniegusi kritisko un sagrāvusi viņu fiziski.

«Fūgu mākslu» sākotnēji uzskatīja par teorētisku paraugmācību padziļinātā kontrapunkta tehnikā; šobrīd tā tiek vienprātīgi atzīta par izcilāko muzikālās mākslas meistardarbu [11.

83. att. Baha «Fūgu mākslas» nepabeigtās pēdējās fūgas partitūras pēdējā lappuse. Sīs fūgas nobeigumā parādās jauna tēma, kuru muzikāli veido komponista uzvārda burti B-A-C-H vācu nošu terminoloģijā. Šī tēma, ietverta melnā četrstūrī, bija komponistam liktenīga [72).

Kā polifoniskās mūzikas pretmets no 1750. gada līdz pat mūsu gadsimta sākumam dominē homofonā harmoniski melodiskā mūzika. Tās augstākās virsotnes sasniedza t. s. Vīnes klasicisma pārstāvji Mocarts, Haidns, Bēthovens un Šūberts. Mocarta «Mazā naktsmūzika» («Etne kleine Nachtmusik», 84. att. 232. lpp.) ir melodiski harmoniskās mūzikas tīrradnis un etalons. Šo burvīgo opusu — minisimfoniju stīgu orķestrim — komponists sacerējis jaunrades pilnbriedā 1787. gadā 31 gada vecumā. «Mazā naktsmūzika» izceļas ar har­monisku vienkāršību un graciozām melodiskās līnijas variācijām, tā ir pretmets J. S. Baha fūgu komplicētajai arhitektonikai. Šai kontekstā atcerēsimies Alberta Einšteina teikto, ka viņš pasauli vēlētos redzēt tik harmonisku kā Mocarta mūzika, bet tā diemžēl vairāk līdzinoties Baha polifoniskajām fūgām. Mūsu gadsimtā — atbilstoši laikmeta jaunajām paradigmām — polifonija kļuva par savdabīgu daudzveidības, daudzdimensionalitātes un kultūras norišu diver- sitātes simbolu. Tā bija polifoniskās mūzikas renesanse un atgriešanās pie Baha, kas homofonās mūzikas ziedu laikos tika ignorēts un gandrīz vai aizmirsts.

Austriešu komponists Arnolds Šēnbergs iedibināja jaunu polifonijas stilu, ko pazīst kā divpadsmittoņu jeb sēriju tehniku. Šo jaunā stila mūziku bieži vien dēvē par atonālo, jo tajā tiek noliegti klasiskajā mūzikā valdošie tonali­tātes un harmonijas pamatprincipi. Visi divpadsmit hromatiskās skalas toņi tiek uzskatīti par ekvivalentiem, jebkura toņa oktāvas pozīcija var tikt brīvi mainīta.Līdz ar to jaunajam mūzikas stilam raksturīga pilnīga atteikšanās no t. s. tonāliem centriem, harmoniski labskanīgiem trijskaņiem; mūzika kļūst atonāla vai — klasisko harmoniju cienītāju uztverē — kakofoniska, t. i., jucek­līgs, haotisks skaņu sablīvējums, kas vairāk līdzinās bezjēdzīgam troksnim.

Laikmeta paradigmai atbilstoši formulējot, Šēnberga radītie neprognozē­jamie skaņu viesuļi (85. att. 233. lpp.) būtībā ir dabas parādību haosa modeļa izomorfs atveids mūzikas valodā — gluži kā haosa paradigmas modeļa atspoguļojums Kandinska (87. att. 4. piel.) un it īpaši Polloka (89. att. 5. piel.) audeklos vai arī Džeimsa Džoisa romāna «Uliss» varones Mollijas apziņas hao­tisko asociāciju plūsmas aprakstā (sk. 86.4. eseju).

Šie piemēri uzskatāmi ilustrē mūsu laikmeta dominējošās paradigmas vie­noto kultūrslāni. Jaunās polifoniskās divpadsmittoņu mūzikas nozīmi laikmeta raksturojumā apliecina tas, ka šai tēmai Tomass Manns veltījis savu mūža darbu — romānu «Doktors Fausts» [112].

Romāna galvenais varonis komponists Adriāns Leverkīns ir izdomāta per­sona, kuras prototips — divpadsmittoņu mūzikas iedibinātājs. Romānā daudz­pusīgi analizēta Šēnberga polifoniskās divpadsmittoņu mūzikas tehnika un teorētiskās nostādnes un vairākkārt uzsvērta homofonās harmoniskās mūzikas antropoloģiskā subjektivitāte pretstatā polifoniskās mūzikas objektivitātei ([112], 67. un 75. lpp.).

Harmoniski melodiskā mūzika, kas pamatā centrēta uz «labskanīgu» trij- skaņu tonalitātes dominanti, būtībā pielāgojas klausītāja subjektīvajiem skaņas

H4. att. Fragments no V. A. Mocarta «Mazās nakts mūzikas» partitūras.

uztveres mehānismiem, ko nosaka cii- Bchanberg. smte op. zs vēka auss akustiskās uztveres īpatnības. Tā mažora skaņkārtā (gammā), kuras pamatā ir mažora (lielais) trijskanis, visi pamattoņu virstoni un starpībtoņi iz­vietojas naturālo skaitju rindā. Šī ideālā skaņu harmonija rada klausītājā pilnības un nobeigtības izjūtu, gaišu, optimis­tisku pārdzīvojumu. Turpretim minora skaņkārtā, kuras pamatā ir minora (ma­zais) trijskanis, daļa toņu regulāri «izkrīt» no naturālo skaitļu rindas. Tas klausī­tājā izraisa disharmonijas, nesasniegtas pilnības izjūtu un rada skumju, melan­holisku noskaņu. Tieši šādā izpratnē homofono, melodiski harmonisko mū­ziku var uzskatīt par subjektīvu.

Senie polifonijas meistari mūziku komponēja Dieva godināšanai, nevis cilvēka patikai. Viņi strikti sekoja mate- matizētam kanonu un fūgu mākslas formālismam un, gluži tāpat kā gotisko katedrāļu celtnieki, pirmām kārtām do­māja par Dievu, nevis par cilvēku. Šādā aspektā polifonisko mūziku var uzskatīt par objektīvu. Tāpēc gan Tomass Manns, gan pats Šēnbergs atzina, ka polifoniskā divpadsmittoņu mūzika nozīmē atgrie­šanos pie mūzikas objektivitātes. Pat neņemot vērā to, ka klausītājam varbūt nav pieņemama tās atonālā daba. Šeit saskatāma pilnīga analoģija ar paradigmu maiņām tēlotājā mākslā.

85. att. Fragments no Arnolda Šēnberga svītas <iOpus 25» partitūras.

Renesanses gleznotāju ieviestā viena skatpunkta perspektīva ir izteikti indi­viduāli subjektīva. Tam piemērs — Leonardo perspektīvas studijas (73. att. 3. piel.) un to izmantošana izcilākajos darbos — tādos kā «Klinšu Madonna» (80.rf un 80. Ł att. 4. piel.). Turpretim Pikaso savos vēlīnākajos darbos, līdzīgi Šēnbergam mūzikā, objektivizē tēlotāju mākslu, viena skatpunkta perspektīvu aizstājot ar vairākdimensionālu skatījumu — kā, piemēram, sievietes portretā «Sieviete» (76. att. 4. piel.). Šādā aspektā šo Pikaso gleznu patiešām var dēvēt

par «polifonisku». Polifonijas tehniku modernajā literatūrā lieliski izmanto ari angļu rakstnieks Oldess Hakslijs romānā «Kontrapunkts» («Point Counter Point»).

Tomass Manns «Doktorā Faustā» aizsāk vēl vienu interesantu netriviālo tēmu — par mūzikas pieraksta vizuālo skaistumu. Adriāna Leverkīna mūzikas profesors Krečmārs runā par partitūras vizuālo veidolu un apgalvo, ka liet­pratējam pietiekot uzmest skatienu notīm, lai gūtu pareizu priekšstatu par kompozīcijas saturu un vērtību [112ļ. Šis ir lielisks vizuāli holistiskās uztveres piemērs (sk. 83. eseju). Krečmārs lekcijā izsaka domu, ka ievingrinātai acij brīnišķīgu baudījumu var sniegt Mocarta partitūru optiskais veidols — dis­pozīcijas skaidrība, atsevišķo instrumentu grupu lieliskais izkārtojums, melo­diskās līnijas asprātīgi mainīgais veids. Pat kurlais, kam sveša skaņa, — apgal­vo Krečmārs, — priecātos par šo daili (84. att. 232. lpp.). Polifonijas tehnikā savukārt svaidītais nevarētu vien nopriecāties par notīs atspoguļotajiem nīder- landiešu polifonijas stila meistaru nebeidzamajiem kontrapunktu trikiem un pitagoriskajiem skaitļu jokiem, kas domāti drīzāk acij nekā ausij [112].

Šī interesantā Tomasa Manna doma lieku reizi apstiprina mūzikas vizuālā pieraksta un akustiskā skanējuma strukturālo izomorfismu, formālo atbil­stību. Līdzīgi mēs varam priecāties par japāņu kaligrāfijas vizuālo skaistumu, neizprotot jēgsaturību (31. att. 2. piel.). Tieši šie apsvērumi mudina pie­vērst uzmanību dažu stilistiski atšķirīgu komponistu darbu vizuālajiem fragmentiem.

Jaunu muzikālo paradigmu aspektā nevar nepieminēt amerikāņu avangar­da mūzikas pārstāvi — paradoksāli ekscentrisko komponistu Džonu Keidžu [179]. Jau būdams nobriedis komponists, viņš četrdesmito gadu beigās stu­dēja Kolumbijas universitātē pie slavenā Daisetsa Suzuki dzenbudisma filo­zofiju. Orientālās paradoksu filozofijas ietekmē Keidžs sāka izmantot kompo­zīcijā nejaušības vai gadījuma elementus, tā radot t. s. stohastiskās mūzikas stilu, kurā lietotas nejaušības jeb aleatorikas metodes (no latīņu vārda alea — spēļu kauliņš). Tā Keidžs komponējot izmantoja senķīniešu «Idzin» (Pārvēr­tību grāmatā) aprakstīto stohastisko metodi (sk. 10. eseju) un ar spēļu kauliņu starpniecību noteica muzikālās domas tālāko attīstību. Viņu vairāk saistīja pats mūzikas radīšanas process nekā pabeigtais darbs. Reizēm viņš, apgriežot otrādi visas Rietumu muzikālās tradīcijas, pierakstīja partitūru tikai pēc izpildījuma, nevis pirms tā [179]. Keidža mūzikai nav noteiktas, nemainīgas un pabeigtas formas. Tipisks fragments no viņa «Koncerta klavierēm un orķes­trim» parādīts 86. attēlā. Šī partitūra izskatās netradicionāla, lai arī tajā izman­tota parastā pieclīniju sistēma. Koncerts ir izpildāms minimuma (nekas netiek spēlēts) un maksimuma (viss tiek spēlēts) robežās [179].

Pats oriģinālākais un paradoksālākais Keidža opuss radies 1952. gadā. Tā nosaukums ir «4'33"», t. i., četras minūtes un trīsdesmit trīs sekundes, kas

skaitliski līdzinās absolūtajai temperatūrai 273 grādi pēc Kelvina, t. i., istabas temperatūrai. Šis opuss ir pilnīgi mēms skaņdarbs klavierēm, kura laikā pianists precīzi 273 sekundes sēd pie klavierēm, kustinādams rokas trijos plašos laika intervālos un šķietami radīdams iespaidu par trim darba dalām. Šīs mēmās kompozīcijas doma bija atveidot klusuma skaņu, slavenās dzenbudistu koanas vienas plaukstas piesitiena skaņu. Kaut gan darbs bija domāts, lai klausītājā izraisītu filozofiskas pārdomas par para­doksālo klusuma skaņu, nepieradinātie klausītāji gaidītās meditācijas vietā iz­teica savu sašutumu ar skalu svilpšanu un kāju dauzīšanu.

Abi mūsu gadsimta izcilie komponisti novatori — austrietis Šēnbergs un ame­rikānis Keidžs — ienesa mūzikā laikme­tam raksturīgās paradigmas: priekšstatu par haosa un nejaušību lomu dabā un cilvēka dzīvē.

Šēnberga un viņa sekotāju (Albāns Bergs, Antons fon Vēberns) atonālie skaņdarbi ir daudz tuvāki baltā trokšņa haosa mūzikai nekā Baha vai Mocarta tradicionālā mūzika. Savukārt Keidža skaņdarbos var saskatīt deterministiskā haosa brūnās mūzikas elementus (86. att.). Ja Pauls Hindemits Kepleram veltītās simfonijas trešajā daļā «Pasaules mūzika» (Musica Mundana») mēģi­nāja atainot Keplera Pasaules harmonijas meklējumus, tad Džons Keidžs «Pasaules mūzikas» radīšanai izmantoja iemīļoto aleatorikas metodi. Tā skaņ­darbs «Ekliptikas atlants» («Atlas Eclipticalis»), kas sacerēts 1961. gadā, savu nosaukumu guvis no zvaigžņu kartēm. Keidžs uzlika uz kartēm caurspīdīgu šablonu un zvaigžņu vietas iezīmēja ar punktiņiem, kurus pēc tam pārvērta spēlējamo nošu zīmēs. Šī «kosmosa simfonija» līdzīgi daudzām dabā sasto­pamām struktūrām un parādībām arī, domājams, veidojās deterministiskā haosa brūnās mūzikas ietvaros.

Sekojot Keidžam, aleatoriski patvaļīgu pieeju partitūrām līdz galējībai noveda vācu komponists Karlheincs Štokhauzens. Tā viņa darbā «No sep­tiņām dienām» {«Aus den Sieben Tagen»), kas pārstāv tā dēvēto «intuitīvo mūziku», nošu vispār nav — tas sastāv no poētiskās frāzēs paustu norādījumu virknes.

86. att. Fragments no Džona Keidža «Koncerta klavierēm un orķestrim» partitūras [179].

Keidža attieksmi pret klusumu kā mūzikas elementu tālāk izvērsa Mortons Feldmens, kura klavieru skaņdarbi ir jau pie dzirdamības zemākās robežas [179]. Klusuma skaņas burvīgā skaņdarbā «Balsis» («Voices», 1991) atveidojis

talantīgais latviešu komponists Pēteris Vasks. Trīsdaļīgās stīgu simfonijas pir­majā daļā, kas saucas «Klusuma balsis», dzirdamās skanas lēni un nemanāmi iznirst no nesadzirdamā klusuma, no nakts zvaigžņoto debesu bezgalīgā miera un tikpat nemanāmi saplūst ar šo klusumu. Šajā fdozofiskas noskaņas caur­strāvotajā kompozīcijā, manuprāt, visreljefak atainota skaņas un klusuma pret­metu komplementaritātes dziļākā būtība.

Keidža opusā «4'33» parādīta tikai viena puse — absolūts klusums. Tur­pretim Vaska «Klusuma balsīs» ir abas iņ un jan papildinošās puses: klusums un skaņa. Tā ir daoiska pilnība.

60. MŪZIKAS UN HAOSA ELEMENTI ABSTRAKTAJĀ MĀKSLĀ

Raksturīgi, ka tēlotāja māksla dažādos laikmetos vairāk vai mazāk cieši saistīta ar kādu citu cilvēka gara radošo sfēru. Tā renesanses glezniecības geometrizētajās kompozīcijās, kā redzējām, jūtama arhitektoniska domāšana. Daudzi no šā laikmeta gleznotājiem bija vienlaicīgi arī izcili arhitekti. Nīder- landiešu un krievu gleznotāju audumos dominē literāri un sadzīviski sižeti, nav noliedzams to tuvums literāram vēstījumam. Mūsu gadsimta abstraktajā (nereprezentatīvajā) glezniecībā savukārt bieži vien dominē krāsu mūzika un vienlaicīgi — mūzikai piemītošie haosa elementi.

Manuprāt, mūzikai izomorfi visvairāk pietuvojies viens no modernā abstrakcionisma pamatlicējiem, krievu izcelsmes gleznotājs Vasilijs Kandinskis. Viņa kolorītajos audeklos mūzika, krāsu zieds, iespējams, sasniedz visaugstākās virsotnes un līdz ar Šēnberga kompozīcijām un Džeimsa Džoisa romāniem var kalpot par mūsu gadsimtā valdošās paradigmas etalonu. Šo domu ilus­trēsim ar vienu no skaistākajām Kandinska gleznām «Melnās līnijas» («Lignes noires», 1913), kas glabājas Solomona Gugenheima muzejā Ņujorkā (87. att. 4. piel.) Tā ir burvīga muzikāla krāsu kompozīcija, kurā haosa elementus ienes melno līniju daudzveidīgais raksts.

Vizuālu polifoniskās mūzikas izomorfo atveidu lieliski atainojis izcilais latviešu filozofiskās glezniecības meistars Kurts Fridrihsons akvarelī «Fūga» (88. att. 5. piel.). Haosa būtību vizuāli visspilgtāk un adekvātāk attēlojis amerikāņu gleznotājs Džeksons Polloks. Audeklā, kas glabājas Nacionālajā modernās mākslas muzejā Parīzē un saucas vienkārši «Gleznojums» («Peinture», 1948), alegoriski attēlots totāls haoss (89. att. 5. piel.). Tā radīšanā izmantoti tikai gadījuma faktori: krāsa vienkārši mesta uz audekla, nekas nav deter­minēts vai noteikts. Šis gleznojums patiešām spēj vizuāli simbolizēt Pirmat­nējo Haosu, no kura varēja — saskaņā ar modernās sinergētikas un Prigožina nelīdzsvaroto sistēmu termodinamikas priekšstatiem — veidoties sakārtotā Pasaule (sk. 20. un 27. eseju). Glezna jāuztver filozofiski kā vispārināts vizuāls haosa attēls.

Turpat Parīzē, Žorža Pompidū centrā, glabājas kāda cita — šķietami diametrāli pretējas ievirzes glezna, kas arī, domājams, iecerēta filozofisku pārdomu rosināšanai. Tas ir Iva Kleina monotoni zilais audekls, kas saucas «Monohromija» («Monochromie», 1960, 90. att. 5. piel.). Var pieņemt, ka šī monohromā glezna pretstatā Polloka Pirmatnējam Haosam simbolizē sākot­nējo «Lielo Tukšumu» («Great Void»), no kura radusies Pasaule. Bet, kā jau apcerējām esejā par haosu, kosmisko tukšumu un fizikālo vakuumu (sk. 32. eseju), Lielais Tukšums jeb fizikālais vakuums nebūt nav Nekas. Senkīniešu prātnieku traktējumā tas ir pilns ar či, vitālo enerģiju, vai — mūsdienu kvantu fizikālā vakuuma teorijas ietvaros — aizpildīts ar t. s. nulles enerģiju, kas spēj kondensēties lietu formās vai, atbilstoši, virtuālās elementārdaļiņās.

Tādējādi abas gleznas — pirmā simbolizē haosu un otrā Lielo Tukšumu — nav savstarpēji izslēdzošas, bet papildina viena otru kā vienas monētas divas puses. Haoss un Lielais Tukšums jāuztver kā iņ un jan Lielo Patiesību kom­plementārie pretmeti. Rietumu mākslā Pasaules haosa elementu atainojums parādās tikai 20. gs. kā jaunās paradigmas izpausme, bet Austrumos, it īpaši dzenbudisma dzimtenē Japānā, nejaušību, haosa un asimetrijas elementi jau kopš 15. gadsimta dominē gan dārzu arhitektūrā, gan tēlotājā un lietišķajā mākslā. īpaši spilgti tas izpaužas japāņu keramikā dzenbudistu tējas ceremoni­jām veidotajās tasēs. Nejaušības elementus un asimetriju ienes jau pats tases veidošanas process: podnieks to darina ar rokām, nevis uz rotējošas ripas. Un arī apdedzināšanas process ir tāds, lai tases glazūrā veidotos haotisks plaisu zīmējums kā iedvesmas avots filozofiskām pārdomām tējas ceremonijas laikā. Šāda dzenbudistu sino keramikas stila 17. gs. tējas ceremonijas tase parādīta 91. attēlā (5. piel.). Plaisu rakstā un neregulārajā tekstūrā dzenbudismā svaidī­tais spēj saskatīt Pirmatnējo Haosu, no kura veidojušās lietu formas.

61. DAŽAS FRAKTĀĻU ĪPAŠĪBAS

Pēc šā īsā ekskursa mūzikas un tēlotājas mākslas domēnos atgriezīsimies atkal pie fraktāļu īpašībām. Apskatot mikrodaļiņas Brauna kustības trajektoriju (81. att. 224. lpp.), varam pārliecināties, ka tai ir daļskaitļa dimensija — lielāka nekā taisnei (D = 1). Bet, tā kā šī trajektorija neaizpilda visu plakni, tās dimensija ir mazāka nekā plaknei (D = 2). Tātad saskaņā ar definīciju daļiņas kustības trajektorija ir fraktālis. Un tas atkal ir uzskatāms piemērs, kā ar frak­tāļu ģeometriju var aprakstīt haotiskus procesus. Vēlreiz jāuzsver, ka haosā var veidoties kārtība, gadījuma procesi var novest pie ģeometrisku struktūru — fraktāļu veidošanās. Haosa teorija principiāli ierobežo prognozēšanas iespējas, taču (auj arī atrast cēloniskas sakarības tur, kur agrāk neviens neiedomājās tās meklēt. Tās ir deterministiskam haosam piemītošā komplementārā pāra gadī­jums un nepieciešamība saspēle.

Dabas veidotās ģeoloģiskās fraktāļu struktūras visuzskatāmāk ilustrē Nor­vēģijas krastu līnijas kontūras [166]. Kā redzams, daudzie līči un fjordi (92. att. 240. lpp.) veido tik sarežģītu krasta līniju, ka principā nav iespējams runāt par tās garumu. Tā vietā var uzrādīt citu lielumu — līnijas fraktālo dimensiju.

īpaši «paparžveida» fraktāļi sastopami daudzās ķīmiskās un bioloģiskās sistēmās. Šādi fraktāli veidojas, piemēram, pie t. s. difūzijas ierobežotās agregā- cijas (DIeA). Tipiski DIeA fraktāļi attēloti 93. zīmējumā (241. lpp.) ([46], 131. lpp.). Atšķirībā no ierastā kristalizācijas procesa, kas parasti norit termo­dinamiska līdzsvara apstākļos, difūzijas ierobežotā «kristalizācija» notiek izteikti nelīdzsvarotos sistēmas stāvokļos. Fraktāļu augšana (jeb agregācija) DIeA režīmā notiek šādi ([166], 194. lpp.). Ja apskatāmā vidē stohastiski klejojoša (random walk) molekula savā haotiskajā, neprognozējamā kustībā nejauši saduras ar jau augošā fraktāļa atzaru, tā «pielīp», tādējādi paplašinot fraktāļa «koku». Šāda veida fraktāļus dažkārt nosauc par atraktīviem (pievelkošiem) gadījuma frak­tāļiem. To struktūra atgādina gan elektriskās caursites izlādes (t. s. Lihten- berga figūras) uz izolatora virsmas, gan zibens izlādes, gan — vēl izteiktāk — daudzu bioloģisko sistēmu augšanas struktūru ainas. Šīs struktūras veido savda­bīgus skujveida dendrītu «rakstus» (pattern), tās atdala «fjordiem» līdzīgi vei­dojumi dažāda lieluma mērogos (93. att. 241. lpp.). Šādu fraktāļu struktūru veidošanos DIeA apstākļos nosaka tas, ka stohastiskā difūzijā klejojošās

2V)

<)2, att. Norvēģijas krasta līnijas kontūras, kas ilustrē dabas veidotās ģeoloģiskās fraktāļu struktūras [166].

molekulas ar daudz lielāku varbūtību «pielīp» fraktāļa zaru «smailēm», bet mazāk varbūtīgi iekļūst dziļāk «fjor­du» iekšienē. Šos apsvēru­mus apstiprina gan analītiski aprēķini, gan datorizētās mo­delēšanas dati. Tie parāda, ka dažādos fraktāļa punktos ir atšķirīgas «augšanas» var­būtības. Tās ir vislielākās dendrītu «smailēs», vismazā­kās — «fjordu» iekšienē. Dendrītu «smailes» darbojas kā savdabīgi klejojošo mole­kulu «atraktori» (pievilkša­nas punkti). Runājot difūzi­jas procesu terminoloģijā, tas nozīmē, ka pie dendrītu «smailēm» ir vislielākais di­fūzijas lauka gradients, ko veido «no spēles izejošās» mo­lekulas.

Aprakstītā atraktīvā gadī­juma fraktāļu veidošanās (93. att.) var kalpot par ti­pisku piemēru, kā pilnīgā haosā termodinamiski nelīdz­svarotos apstākļos var veido­ties deterministiski haotiskas struktūras ar daudz augstāku kompleksitātes pakāpi. Kā sta­tistiski determinējošs faktors

93. att. Difūzijas ierobežotās agregācijas (DieA) paparž- veida fraktālis. Šādas fraktāļu struktūras veidojas dau­dzās ķīmiskās un bioloģiskās reakcijās [46].

šajā gadījumā darbojas nehomogēnais difūzijas gradienta lauks, kas padara fraktāļa dendrītu «smailes» par klejojošo molekulu «atraktoriem». Un, lai gan veidotā fraktāļa struktūrai ir statistisks gadījuma raksturs un tā konkrēto mor­foloģiju nav iespējams prognozēt, tomēr visiem difūzijas ierobežotās agregāci- jas veidotajiem fraktāļiem ir kaut kas kopējs, līdzīga izomorfa metastruktūra\ tie veido noteiktas kategorijas haotisko fraktāļu kopu vai, sekojot bioloģiskai analoģijai, fraktāļu «sugu». Te der atcerēties vācu filozofa Leibnica viedīgos vārdus, ka ikvienam kokam katra lapa ir atšķirīga. Tas jau izklausās — atšķirībā

no viņa laikabiedra Ņūtona deterministiskā pasaules uzskata — pēc modernās haosa teorijas iedīgļa. Un tomēr katras sugas koku lapām ir kopīga metastruk- tūra vai metamorfologija. Kļavai ir klaviska un ozolam — ozoliska lapa, lai arī katra vienreizēja un neatkārtojama. 93. zīmējumā (241. lpp.) attēlotajiem fraktāļiem ir tipiska fraktāļu dimensija: difūzijas ierobežotās agregācijas tel­piskajiem fraktāļiem raksturīgā dimensijas vērtība ir DH = 2,5, t.i., tie ierindo­jami vidū starp plaknes (D = 2) un telpas (D = 3) dimensijām.

Iespaidīgi dabas fraktāļi redzami 94. attēlā (5. piel.) — zibens izlādes haotiskie zigzagi, kas tomēr ir zināmā mērā determinēti. To sākums — elektriski lādētajos negaisa mākoņos, bet nobeigums — Kalifornijas kalnu masīva kokos.

62. LEDUSPUĶU FRAKTĀĻI TOMASA MANNA SKATĪJUMĀ

Fraktāļu daba piemīt ari šķietami fantastiskajiem leduspuķu veidojumiem uz aizsalušām logu rūtīm. Pie šis problēmas laikā, kad neviens vēl nedomāja un nerunāja par fraktāļiem kā dabas ģeometriju, pārdomās kavējās izcilais vācu rak­stnieks Tomass Manns grāmatā «Doktors Fausts» [112]. Viens no grāmatas varoņiem, komponista Adriāna Leverklna tēvs Jonatāns, vaļas brīžos nododas īpatnēju dabas parādību apcerei, filozofiskai «stihiju» analīzei. «Jonatāns vēroja ledus puķes, un ziemas dienās, kad šie kristāliskie ziedi klāja lauku mājas zemo logu rūtis, viņš stundām ilgi vai nu ar neapbruņotu aci, vai palielināmo stiklu mēdza pētīt to struktūru. Jāsaka, viss būtu labi un viņš drīz vien pievērstos saviem ikdienas pienākumiem, ja šie veidojumi stingri saglabātu pienācīgo ftgurālo simetriju, matemātiski pareizas un kārtnas formas. Bet tas, ka ledus puķes it kā nekautrīgā mānestībā atdarināja augu valsti, brīnum skaisti imitēja paparžu lapas vēdekļus, zāles stiebrus, ziedkausus un ziedlapiņas, ka tās ledū diletantiski kopēja organisko pasauli, lūk, tas satracināja Jonatānu, un par to viņš ne bez nosodījuma, lai arī apbrīnodams, nemitējās grozīt galvu. Vai šīs fantasmagorijas, viņš sev jautāja, ir augu valsts formu p irmv eidi vai arī tikai atkārto tās? Ne viens, ne otrs, viņš droši vien atbildēja sev; šīs parādības ir paralēlas. Radoši sapņainā daba kā šeit, tā tur sapņo to pašu, un, ja nu ir runa par atdarināšanu, tad tikai abpusēju. Vai par pirmparaugiem jāuzskata īsti pļavu ziedi tikai tādēļ, ka tiem piemīt dziļi or­ganiska esamība, kamēr ledus puķes ir tikai šķietamība? Šī šķietamība taču rodas ne mazāk komplicētu matērijas savienojumu rezultātā, kā augi. Jonatānu, ja pareizi sapratu, nodarbināja dzīvās un tā saucamās nedzīvās dabas vienības problēma, viņš domāja, ka pēdējai mēs nodarām pāri, novilkdami starp abām pārāk stingru robežu, jo būtībā tā nemaz tik cieša nav un faktiski nav arī tādu elementāru funkci­ju, kas raksturotu vienīgi dzīvās būtnes un neatklātos biologam, pētījot nedzīvo dabu.» ([112], 31. lpp.)

Šis ir uzskatāms piemērs, kā mākslinieka patiesi ģeniālā intuīcija spēj uztvert un izprast saikni, kas mūsdienu dabaszinātņu izpratnē visciešāk sasaista nedzīvo un dzīvo dabu. Jo tieši leduspuķu dzīvo dabu imitējošā fraktā- liskā iedaba pārmet tiltu starp nedzīvo un dzīvo, un raksturīgi, ka tieši ūdens (FĻO) molekulas, kuru veidojumiem (ūdenim un ledum) piemīt virkne anomālu īpašību un kuras arī kalpo par «dzīvības matricu» [40], spēj veidot fantastisko ledus ziedu fraktāļus.

63. FRAKTĀĻI DZĪVAJĀ DABĀ. HAOSS UN ADAPTIVITĀTE

Vislielāko apbrīnu izraisa tieši bioloģisko veidojumu deterministiskā haosa ietvaros radītā fraktāļu pasaule. Atcerēsimies Mandelbrota teikto, ka fraktāļu ģeometrija ir dabas ģeometrija. Un — pats svarīgākais — visām dzīvajām sistē­mām raksturīga augsta adaptivitātes pakāpe. Bet adaptīvas var būt tikai haotis­kas sistēmas. Visas strikti determinētās sistēmas ir neadaptīvas, tās nespēj mainīties ne ārējās iedarbības, ne iekšējo dinamisko procesu rezultātā.

Kā dzīvās dabas fraktāļu prototipu parasti min paparžu lapu vēdekļus. Varbūt tieši tāpēc, ka tie morfoloģiski ir visradniecīgākie gan DIeA veidotiem fraktāļiem (93. att. 241. lpp.), gan leduspuķēm. Dabas fraktāļu raksturiezīmes visizteiksmīgāk parādās tieši augu valstī. Tā, piemēram, tipiski fraktāļu veido­jumi ir gan koku sakņu tikls zem zemes, gan lapotnes vainagi pret debesīm (arī savdabīgi, visai augu valstij kopēji, dziļi simboliski ir pretmeti ar Zemes virsmu kā simetrijas plakni. Saknes barojas no Zemes, lapotne — no Saules stariem). Līdzīgi dabas fraktāļu pretmeti — rozes pumpura ziedlapas un ērkšķi ap tās kātu — arī ir ar dziļi simbolisku, metaforisku zemtekstu. Tāpat daudz­veidīgā kaktusu dzimta (Cacta ceae) pumpurojas kā fraktāļi. Kā dīvainu un neparastu dabas fraktāli Benuā Mandelbrots min ziedu kāpostus (c. Roma- neseo), kuru čemura pumpuri veido dažāda izmēra fraktāļu kopu. Vēl fantas­tiskākus dzīvās dabas fraktāļus veido Malaizijas rifu krāsainie koraļļi (95. att. 5. piel. un [46]).

Fraktāļu struktūra dominē ne vien dzīvās dabas daudzveidīgajās ārējās formās. Arī daudziem dzīvnieku un cilvēka iekšējiem orgāniem ir raksturīga fraktāļu daba un uzbūve. Tā, piemēram, cilvēka bronhu sazarojumi plaušās embrionālās attīstības gaitā iziet caur deterministiskā haosa fāzi, veidojot rak­sturīgu fraktāļu struktūru [55]. Kā redzams attēlotajā modelī, bronhi un bronhu ceļi veido «kokus» ar daudziem jo daudziem dažāda izmēra atzarojumiem (96. att. 245. lpp.). Turklāt elpošanas ceļu struktūra samazinātā mērogā atkārto lielāka izmēra struktūras veidojumus. Šī ir viena no fraktāļu pamat- pazīmēm, ko sauc par autosimilaritāti (jeb pašlīdzīgumu). Tas nozīmē, ka frak­tāļos vieni un tie paši struktūras elementi atkārtojas dažādos mērogos [109, 136, 166, 46, 55, 104], Tātad autosimilaritāte ir nemainīgums (invariance) attiecībā pret mēroga resp. izmēru maiņu (to sauc ari par «skeilinga invarianci»). Autosimilaritāte ir viens no visnozīmīgākajiem Visuma uzbūves simetrijas

96. att. Cilvēka plaušu bronhiālā «koka» fraktālā struktūra [55].

elementiem. Sī simetrija nodrošina invarianci un stabilitāti dažādos iz­mainu procesos — autosimilārās struktūras šādās izmaiņās saglabā savu identitāti. Pie autosimilaritātes principa un tā nozīmīguma atgriezī­simies 71. esejā.

Tipisku fraktāļu struktūru veido arī cilvēka sirds un asinsvadu sistēma (97. att. 5. piel.) [55]. Resnie asins­vadi sazarojas arvien sīkākos un tie savukārt pavisam sīkos kapilāros. Arī šajā gadījumā uzskatāmi redzama autosimilaritātes principa īstenošanās. Nervu šūnām — neironiem tāpat piemīt fraktāļu daba. No nervu šūnas ķermenīša atzarojas t. s. dendrīti, kas tālāk sadalās arvien smalkākās šljied- riņās (98. att.) [62]. Divu nervu šūnu dendrītu kontaktpunktos veidojas t. s. sinapses, kas darbojas kā nervu sistēmas elektrisko signālu «slēdžu» elementi. Un, tā kā cilvēka nervu sistēmas paši pamatelementi, t. i., nervu šūnas — neironi, ir pēc izcel­smes fraktāli un kā tādi morfoģenēzē veidojušies deterministiskā haosa iet­varos, var secināt, ka visa nervu sis­tēma — arī smadzenes — funkcionē kā visaugstākās kompleksitātes pakā­pes haotiskā sistēma, kurai piemīt augstas adaptācijas un pašorganizē- šanāsspējas. Pie šādiem uzskatiem, kā tālāk redzēsim, ir nonākusi mūsdienu cilvēka smadzeņu radošās darbības pētniecība, kas balstās uz visjaunāka­jiem zinātnes sasniegumiem pašorga- nizējošos sistēmu sinerģētikā [62] un deterministiskā haosa teorijā.

98. att. Cilvēka nervu Sūnu fraktāļa struktūra: a — piramidālās nervu Sūnas; b — Purkinjē Sūnas dcndridu «koks» [62].

Bet vispirms pakavēsimies pie vis­dievišķākā Dabas Brīnuma — sma­dzeņu veidošanās embrionālās attīs­tības gaitā.

64. SMADZEŅU VEIDOŠANĀS CILVĒKA EMBRIJĀ

Augļa attīstība sievietes klēpī ilgus gadus bija «neticamā, neredzamā pasaule» {«unbelievabte, invisible world»). Tikai pirms gadiem desmit zviedru zinātnie­kam — profesionālam fotogrāfam Lenartam Nilsonam, izmantojot vismoder­nāko elektronu mikroskopijas aparatūru un izcilās fotogrāfa iemaņas, izdevās ieskatīties šā maģiskā procesa aizkulisēs. It kā sekojot modernās fenomenolo­ģijas iemīļotajai paradigmai «Redzēt nozīmē ticēt» {«To see, is to believe»), Lenarts Nilsons ieguva patiesi fantastiskas cilvēka embrija attīstības ainas: vispirms olšūnas apaugļošanās momentu (99. att. 5. piel.)» tad pēc 20 stun­dām, kad jau sākusies intensīva apaugļotās olšūnas dalīšanās, tad pēc divām dienām un tālāk pakāpeniski pēc trim, četrām, tad septiņām nedēļām, kad jau izveidojies cilvēkbūtnei līdzīgs aizmetnis ar rudimentāriem orgāniem, jau pulsējošu (-150 reizes minūtē) sirdi, acu iedīgļiem un delfīnveida galvu, kuras iekšienē fantastiskā ātrumā sāk veidoties galvas smadzeņu nervu šūnu masīvs (100. att. 5. piel.). Šīs krāsainās cilvēka embrija attīstības fotogrāfijas minētajā secībā pirmo reizi dienasgaismu ieraudzīja žurnāla «Life» 1990. gada augusta numurā [77].

Kā atceras Lenarts Nilsons, daudzās intervijās, apbalvošanas ceremonijās un viņam veltītajos banketos simtiem, varbūt pat tūkstošiem reižu jautāts: «Jūs, kas esat soli pa solim izsekojis mistiskajai Cilvēkbērna rašanās gaitai, — kurā brīdī sākas cilvēka dzīvība?» Uz to viņš ierasti atbildējis ar sava tautieša, slavenā kinorežisora Ingmārā Bergmaņa vārdiem. Jautāts, no kura brīža sāku­sies viņa kinovaroņa mīlestība uz iecerēto meiteni, Bergmanis atbildējis: «Skatieties filmu, un jūs paši varēsiet izlemt. Tas atkarīgs tikai no jums pašiem.»

Taču Lenarts Nilsons, pirmais cilvēks, kas izsekoja Cilvēkbērna tapšanas gaitai, pietiekami precīzi fiksējis Dzīvības rašanās momentu. Tā ir astotā diena pēc olšūnas apaugļošanās, kad sfēriskā blastula, kuru veido vairāki simti šūnu, implantējas mātes dzemdes sieniņā un, savienojoties ar viņas organisma asins­rites, hormonālo un imūnbioloģisko sistēmu, kļūst par apvienotā organisma dzīvības sastāvdaļu. Šī nostādne ir krasā pretrunā ar agrāk plaši izplatīto uz­skatu, kas embrija dzīvību atzina tikai pēc pirmajām samanāmajām kustībām mātes klēpī, ko parasti novēro trešajā mēnesī.

Tālāk Nilsons jautā, no kura momenta var uzskatīt, ka embrijs kļuvis par cilvēku. Un arī šeit atbilde it diezgan precīza. Tas ir apmēram pēc 50 dienām (vai 7 nedē|ām), kad embrijs jau ieguvis cilvēkveida formu un tā neparasti lielajā galvā sāk fantastiskā ātrumā veidoties smadzeņu nervu šūnas un kon­takti starp tām. Septiņas nedēļas vecs embrijs parādīts 100. attēlā 5. piel. (apakšā), virs tā — veidojošos smadzeņu nervu šūnu masīva mikrogramma. Lieliski saredzama gan smadzeņu šūnu fraktāļa struktūra, gan embrija galvas asinsvadu fraktāļu «raksts». Bet vispārsteidzošākais ir fantastiskais ātrums, ar kādu šīs nervu šūnas veidojas, — vairāk nekā 100 000 (10^) vienā minūtē! Nav grūti novērtēt, ka līdz zīdaiņa piedzimšanai devītajā mēnesī smadzeņu šūnu skaits pārsniedz desmit miljardus (~3xl010 ) — skaitli, kas raksturīgs cil­vēka smadzenēm! Tātad cilvēka apziņas (vai dvēseles) iedīgli embrijā sāk vei­doties jau septītajā nedēļā, un no šā momenta var uzskatīt, ka ir radies cilvēks. $ai aspektā bezgala smagi apzināties, ka daudzajos abortos, kas bieži notiek pēc septītās nedēļas, tiek iznīcināta ne vien jaunā dzīvība, bet vēl nepiedzimis cilvēks ar savu rudimentāro dvēselīti.

Interesantas ir seno filozofu domas par šo problēmu. Tā sengrieķu filozofi­jas autoritāte Aristotelis bija pārliecināts, ka cilvēks top tikai dzimšanas brīdī. Turpretim viduslaiku lielākā filozofijas autoritāte Sv. Akvīnas Toms domāja, ka vīrieša dvēsele savienojas ar augli četrdesmitajā dienā, bet sievietes — sešdesmitajā dienā pēc apaugļošanās. Katoliskās tradīcijās iesvaidītais Akvīnas Toms nepalaida garām izdevību, lai arī šajā nozīmīgajā cilvēka dvēseles «iedēs- tīšanas» aktā mazliet diskriminētu sievieti… Bet pats interesantākais, ka Nilsona pētījumos atklātais piecdesmit dienu periods, no kura sākas cilvēka dvēseles veidošanās, ir aritmētiski vidējais no Akvīnas Toma prognozētajiem skaitliskajiem lielumiem.

65. EMBRIJA MORFOĢENĒZE DETERMINISTISKĀ HAOSA IETVAROS.

DĪVAINIE ATRAKTORI

Tikko aprakstītais dzīvā organisma morfoģenēzes process ir visapbrīno­jamākais un tai pašā laikā mistiski visnoslēpumainākais process Dieva pasaulē; tajā visspilgtāk realizējas sinerģētisko kategoriju— gadījuma un nepiecieša­mības— komplementārā mijiedarbība. Kā daudzus procesus dzīvajā dabā, organisma morfoģenēzi var aprakstīt deterministiskā haosa teorijas ietvaros.

Visbrīnumainākais no mūsdienu informācijas teorijas viedokļa ir pats fakts, ka dažus desmitus mikronu lielās apaugļotās olšūnas 46 hromosomās, kas satur vairākus simttūkstošus gēnu, to DNS dubultspirāļu bāzu secībā (tekstā) (14. att. 47. lpp.) ir ierakstīta «astronomiskā» informācija par to, kāds kļūs pieaugušais cilvēks: tā miesas būve, tipoloģija, sarežģīto orgānu funkcionālā arhitektonika (nervu, elpošanas, asinsrites un citas sistēmas), pat tādi indivi­duāli «sīkumi» kā acu un matu krāsa, deguna un ausu forma, tipiskās uzvedī­bas formas un indivīda dvēseliskā mentalitāte. Tas viss, protams, nevar būt pilnīgi determinēts jau olšūnas ģenētiskajā tekstā. Uzskata, ka morfogenēzē visas šīs daudzveidīgās kvalitātes veidojas pakāpeniski, deterministiskā haosa ietvaros, un šis attīstības virzību nosaka daudzi t. s. dīvainie jeb haotiskie atraktori.

Dīvainie atraktori ir visbūtiskāko dinamisko sistēmu haosa teorijas ele­menti. Mēs tos fragmentāri pieminējām, iztirzājot difūzijas ierobežoto frak­tāļu augšanu (agregāciju) (93. att. 241. lpp.). Aplūkotajā gadījuma kā dīvainie atraktori darbojas augošo fraktāļu «smailītes», pie kurām ar lielāku varbūtību «pielīp» difundējošās molekulas, tā paātrinot paparžveidīgā fraktāļa augšanu. Pie dīvainajiem (haotiskajiem) atraktoriem mēs vēl atgriezīsimies, bet tagad — īsi par brīnumaino olšūnas apaugļošanas aktu.

Vīrieša sperma satur vairākus miljonus spermatozoīdu, bet tikai vienam no tiem ir laime nokļūt sievietes olšūnā un to apaugļot. Šī spermatozoīdu miriāde trauksmainā amoka skrējienā, lokano astīšu kustību dzīta, virzās uz sievišķo «atraktoru» — olšūnu. Tikai dažiem desmitiem — visenerģiskākajiem un izturīgākajiem — izdodas šai maratonā sasniegt mērķi (99. att. 5. piel.). Bet te priekšā cits šķērslis. Lai ienestu tēva hromosomās kodēto informāciju olšūnā un tā komplementāri savienotos ar mātes hromosomu ģenētisko «tekstu», vēl jāizlaužas cauri olšūnas apvalkam. Olšūnas apvalks ir sākotnēji mīksts, un spermatozoīds ar savu aso snukīti var to taranēt. Un te nu beidzas statistisko norišu dominante. Līdzko pirmais spermatozoīds ar varbūtību 1:106 ir iekļu­vis olšūnā, ieslēdzas determinēts process. Olšūnas apvalks momentāni sacietē un kļūst par necaurejamu «mūri» ārpusē palikušajiem spermatozoīdiem. Šāda lēcienveida pārslēgšanās no haotiski statistiska stāvokļa uz strikti determinētu stāvokli raksturo visu morfoģenēzes ainu. Kā jau minējām, tā norit determinis­tiskā haosa ietvaros, kas raksturīgs visām augstas kompleksitātes pašorganizē- jošām sistēmām.

Līdz pat astotai dienai, kad apaugļotā olšūna implantējas mātes dzemdes sieniņā un savienojas ar mātes organismu, tā dalās simetriski un veido sfērisku blastulu, kas satur jau vairākus simtus vienādu šūnu. Līdz šim momentam katra jauna šūna satur visu informāciju, kas nepieciešama tālākai organisma morfo- genēzei. Tad iestājas šūnu diferenciācijas fāze. Diferenciācijas procesā šūnas iegūst specifiskas īpašības, kas tās determinēti padara par nervu, muskuļu, kaulu vai asins šūnām. Šajā stadijā veidojas trīs embrija dīgļlapas, no kurām tālāk vei­dojas organisma pamatfunkciju sistēmas. No ārējās dīgļlapas — ektodermas — veidojas visa cilvēka nervu sistēma un āda. (No morfoģenēzes viedokļa cilvēka āda ir dabīga ārēji eksponēta, jutīga nervu sistēmas sastāvdaļa.) No vidējās dīgļlapas — mezodermas— veidojas kauli un muskulatūra, tātad sistēmas, kas nodrošina organisma stabilitāti un mobilitāti. No iekšējās dīgļlapas — endo- dermas — savukārt top organisma izdzīvošanai tik svarīgais barības trakts. Kā jau redzējām, visas funkcionālās sistēmas — nervu, elpošanas, asinsvadu utt. — veidojas deterministiskā haosā kā fraktāļi (96. att. 245. lpp., 97. att. 5. piel., 98. att. 246. lpp.). Pagaidām nav konkrēti zināmi daudzveidīgie haotiskie atraktori, kas nosaka šo sistēmu veidošanos. Zināms tikai, ka šie procesi norit izteikta termodinamiskā nelīdzsvara apstākļos, ka tie ir dinamiski nelineāri procesi un virknē gadījumu varētu būt analogi difūzijas ierobežotās agregācijas (DleA) fraktāļu veidošanās procesiem (93. att. 241 lpp.). Morfogenēzē vis­pārināti runā par dažādu bioloģiski aktīvu savienojumu (hormonu, transmi- toru, enzīmu u. c.) veidotiem difūzijas gradientu laukiem, kas rada fizikālo bāzi lokālai dīvaino atraktoru veidošanai un tādējādi nosaka deterministiskā haosa virzību. Šai jomā vēl daudz neskaidrību, neatminētu mīklu un nepār­baudītu hipotēžu.

Bet embrionālo dīgllapu lomai cilvēka morfogenēzē ir vēl citi ļoti intere­santi aspekti. Kā parādījuši antropoloģiskie pētījumi, cilvēka tipu lielā mērā nosaka tas, kura no embrija dīgllapām kļūst par dominējošo organisma morfogenēzē.

66. EMBRIJA DĪGĻLAPAS UN CILVĒKA

TIPOLOĢIJĀ

Amerikāņu antropologs V. H. Šeldons [170, 171, 172] atklājis, ka gadī­jumā, ja embrija attīstībā dominē ektoderma, izveidojas ektomorfais antropo­loģiskais tips, kam vācu psihiatra E. Krečmera tipoloģijā [91] atbilst astēniskais tips. Šā tipa cilvēkus raksturo trausla miesas būve (kā tautā saka, kauli un āda), tie parasti ir slaidi un kalsni. Ektomorfā resp. astēniskā tipa visraksturīgākais literatūras varonis ir Lamančas «bēdīgā izskata» bruņinieks Dons Kihots (22. un 23. att. 58., 59. lpp.). Astēniskā tipa pārstāvjiem raksturīga sekošana augstākām, bieži vien nereālām idejām, viņi var kļūt par ideoloģiskiem vai reliģiskiem fanātiķiem. Saskaņā ar K. G. Junga tipoloģiju [81] astēniki ir izteikti introverū (uz iekšieni vērsti), parasti atrauti no dzīves, egocentriski auksti un neveikli saskarsmē ar līdzcilvēkiem, darbā mēdz būt akurāti, pat pedantiski. Vēl viens raksturīgs astēniķa tips literatūrā ir Adriāns Leverkīns, Tomasa Manna «Doktora Fausta» galvenais varonis, modernās atonālās mūzi­kas komponists [112]. Astēniķis gatavs ziedot dzīvību idejas vārdā (Jans Huss, Džordāno Bruno), var būt nežēlīgs despots (Robespjērs, Staļins) vai arī romantiķis — mūziķis vai dzejnieks (Šūmanis, Helderlīns, Bodlērs, Poruks, Fricis Bārda).

Ja embrija attīstībā dominē endoderma, veidojas Šeldona endomorfais jeb Krečmera pikniskais tips. To raksturo apaļīgas miesas formas un biezs zemādas tauku slānis, tas ir apsviedīgs, omulīgs, parasti arī labsirdīgs, veselīga humora pārpilns, lieliski komunicē ar līdzcilvēkiem, pēc dabas pragmatikis, dzīves baudītājs, gardēdis, dzīvo ar barības trakta dominanti. Piknika raksturīgākie iemiesojumi literatūrā ir Sančo Pansa (22. un 23. att. 58., 59. lpp.), Falstafs, Kolā Brinjons. Blakus labsirdīgi omulīgajam piknikim nereti sastopams arī despotiski agresīvais piknika tips. No tā parasti veidojas labi karavadoņi vai citi «bosi». Astēniķis oscilē starp psihes stāvokļiem: auksts un rezervēts vai karsts un dedzīgs, bet pikniķis — starp stāvokļiem: omulīgs un jautrs vai drūms un nikns. Pikniki ir izteikti garastāvokļa cilvēki. Junga tipoloģijā tie pieder pie esktravertā (uz ārējo pasauli vērstā) tipa [81].

Būdams psihiatrs, Krečmers psihiatriskajā klīnikā sastapās gan ar astēnisko, gan piknisko tipu. Patoloģijas gadījumā astēniki parasti slimo ar paranoidālo šizofrēniju, bet pikniki — ar maniakālo depresiju.

Ja embrija attīstībā dominē mezoderma, tad parasti veidojas Šeldona mezo- morfais jcb Krečmera atlētiskais tips. To raksturo spēcīgi veidots skelets un labi attīstīta, stingra muskulatūra. Kā idealizētus šo īpašību nesējus var minēt atlētu un kinovaroni Arnoldu Švarcenēgeru un spiegu filmu personāžu Džeimsu Bondu.

Atlētiskais tips parasti gūst labus panākumus sportā un kā vīrietības ideāls arī pie sievietēm. Pēc dabas agresīvs, drosmīgs, vīrišķīgs (tāpēc var būt labs karavīrs), piemīt vadonim nepieciešamās īpašības, labs organizators, vairāk ek- straverts nekā introverts. Šā tipa pārstāvji reti nonāk psihiatriskajā klīnikā, tāpēc arī nav nokļuvuši Krečmera uzmanības lokā. Agresivitātes dēļ viņi drīzāk var nonākt traumatoloģiskajā klīnikā vai cietumā.

Šeldons parādīja, ka tīri Krečmera aprakstītie tipi, it īpaši astēniskais un pikniskais, dzīvē sastopami retāk nekā literatūrā. Parasti ir darīšana ar jaukta tipa pārstāvjiem, kuros vairāk vai mazāk spilgti izteiktas visu triju pamattipu iezīmes. Turklāt Šeldons uz antropoloģisku pētījumu pamata parāda, ka konkrētā cilvēkā kāda tipa anatomiskās iezīmes var dažādās proporcijās parā­dīties ķermeņa atsevišķo daļu — galvas, kakla, torsa, roku vai kāju — uzbūvē. Uz šādas analīzes pamata Šeldons izveidojis 16 tipoloģiskus iedalījumus, no kuriem tīri izteikta ektomorfā, mezomorfā vai endomorfā tipa statistiskais īpatsvars ir visai niecīgs.

67. DĪVAINIE ATRAKTORI HAOTISKĀS

SISTĒMĀS

Bet atgriezīsimies atkal pie dīvainajiem (haotiskajiem) atraktoriem, kuriem pievērsāmies tikai fragmentāri.

Terminu «dīvainais atraktors» pirmais ieviesa beigu fiziķis un matemātiķis Dāvids Riēdls 1971. gadā, aprakstot turbulences veidošanos šķidruma plūsmās. Tomēr vislielāko popularitāti ieguvis t. s. Lorenča dīvainais atraktors. Lorenču pamatoti uzskata par modernās meteoroloģijas izveidotāju, un ideja par haotisko atraktoru viņam radās, izstrādājot matemātiskus modeļus meteorolo­ģiskām prognozēm. Klimatiskie ap­stākļi un to izmaiņas ir vistipiskākais piemērs haotiskajām parādībām dabā, un ar tām mēs sastopamies ik­dienas pieredzē kā ar visgrūtāk prog­nozējamām norisēm. Debesu mehā­nika un meteoroloģija ir visrakstu­rīgākās deterministisko un haotisko parādību izpausmes dabā.

Planētu kustību ap Sauli, to precīzās trajektorijas var prognozēt gadsimtiem uz priekšu. Astronomi cer, piemēram, precīzi prognozēt Saules vai Mēness aptumšošanos, teiksim, pēc divsimt gadiem. To pieprata jau senie ēģiptiešu pries­teri astronomi. Šajā gadījumā de­besu mehānikā trajektoriju aprē­ķini reducējas uz visvienkāršāko gadījumu — divu praktiski sfē­risku ķermeņu pievilkšanos, ko var strikti aprakstīt gravitācijas likumu ietvaros. Tieši šī supervienkāršā divu ķermeņu mijiedarbības aina k|uva par pamatu Ņūtona mehānikas likumīgajam «pirmdzimtam» — filo­zofiskajam determinismam, kas apogeju sasniedza Laplasa darbos.

Taču jau šajā «strikti» deterministiskajā debesu mehānikas ainavā parādījās nepatīkami «monstri». Visupirms — komētas, kuru parādīšanos no bezgalīgās tālēs izstieptām eliptiskām orbītām gan varēja prognozēt, bet, kā uzvedīsies šie «astainie» objekti Saules tuvumā, bija grūti paredzēt: tie varēja vienkārši izjukt! Atklājās, ka viens no Jupitera pavadoņiem, kam ir izteikti neregulāra forma, uzvedas «nekorekti» — met haotiskus, neaprēķināmus «kūleņus». Un visnepatī­kamākie gadījumi bija saistīti ar triju ķermeņu problēmu, piemēram, planētas kustību starp divām līdzīgas masas zvaigznēm. Tādus teleskopi atklāja plašajā Visumā.

Tipiska trīskermeņu orbīta debesu mehānikā parādīta 101. attēlā (253. lpp.) [136]. Tā ir mazas planētas haotiskā kustība starp divām līdzīgas masas zvaigznēm. Kā to jau 19. gs. beigās parādīja franču zinātnieks Puankarē, šādu haotisku planētas kustību nav iespējams aprakstīt deterministiskās Ņūtona mehānikas ietvaros. Uz tādas planētas pat teorētiski nav iedomājama dzīvības eksistence. Tomēr debesu mehānikā šie haotiskās kustības gadījumi ir drīzāk izņēmums, tāpēc Ņūtona mehānika un līdz ar to determinisms kā «viszināt­niskākais» pasaules uzskats saglabāja savu dominējošo stāvokli vairākus gadsimtus.

68. METEOROLOĢISKAIS HAOSS UN LORENČA ATRAKTORI

Uz mūsu pašu planētas Zemes mēs ik dienas sastopamies ar cita veida haosu — grūti prognozējamo meteoroloģisko apstākļu nepārtraukto maiņu. Un, ja planētu kustību trajektorijas var precīzi paredzēt pat gadsimtiem uz priekšu, tad meteoroloģiskos apstākļus, pat izmantojot vismodernākās skaitļo­šanas metodes un ievadot superdatoros vairākus miljonus mērījumu datu no tūkstošiem meteoroloģisko staciju daudzās zemeslodes vietās, gaidāmo laiku vislabākajā gadījumā var prognozēt tikai divām trim nedēļām. Jo laiku nosaka bezgaldaudzi faktori: ciklonu un anticiklonu, zemo un augsto spiedienu frontes un to izmaiņas. Jāņem vērā arī lokālie faktori — Zemes virsmas reljefs, ūdens baseini (upes, ezeri, jūras), vēju virzieni, temperatūras gradienti dažāda augstuma atmosfēras slāņos utt. Izmantojot superjaudīgus datorus, pēc plaša pasaules meteoroloģisko staciju tīkla novērojumiem un satelītu fotogrāfiju datiem var izveidot temporālu modeli un prognozēt laiku uz nedēlu vai divām noteiktā kontinentā — Eiropā, Āfrikā, Dienvidamerikā. Bet šie modeli laika gaitā ir nepārtraukti jākoriģē un jāuzlabo. Visproblemātiskākie un visgrūtāk paredzamie ir laika apstākli kādā noteiktā rajonā, piemēram, Vīnē vai Parīzē. Tāpēc arī meteorologu prognozes mēdz būt diezgan vispārīgas un nenoteiktas, piemēram: «Mainīgs mākoņu daudzums, vietām neliels lietus, pērkona negaiss.» Pilnīgi droši var prognozēt tikai gaidāmo laiku uz zemeslodes poliem — tur nekad nebūs temperatūra +30°C un ziemā Ziemeļpolā nespīdēs saule! Bet no ekvatora uz abām pusēm līdz polārajam lokam un pat pāri tam pār laika apstākļiem valda haosa grūti prognozējamā «uzvedība», kas pakļaujas tikai statistiskām varbūtības teorijas likumsakarībām. Tāpēc dažās zemēs, piemē­ram, Japānā, laika prognozes piepildīšanos vērtē procentuāli. Piemēram, ir ap 70% varbūtība, ka Kioto rīt nelīs lietus. Praktiski neprognozējami ir atmo­sfēras procesi loti izteikta nelīdzsvara apstākļos, kādi veidojas pirms orkāna vai tornado sākuma. Atcerēsimies, ka šajā gadījumā orkāna izraisīšanai pietiek ar niecīgu fluktuāciju, tādu kā tauriņa spārna vēdas (t. s. «butterfly effect»). Tāpat neprognozējams ir lavīnas nobrukuma sākuma moments.

Izstrādājot meteoroloģisko prognožu zinātniskos pamatus, Masačūsetsas Tehnoloģiskā institūta vadošais meteorologs Edvards Lorencs konstatēja, ka šajā gadījumā jāizmanto haosa teorijas atziņas. Viņš atklāja, ka haotiskie

procesi atmosfērā nav pilnigi patvaļīgi, bet tos regulē haotiskais, Dāvida Riēdla par dīvaino nosauktais atraktors. Atmosfēras procesus regulējošā dīvainā atrak- tora trajektorijas fazu telpā atveido divus nenoslēgtus, saistītus ciklus, kas atgā­dina tauriņa spārnus (102. att., [136]). Vēlāk šis meteoroloģiskais atraktors tika nosaukts Lorenča vārdā. Tam piemīt daudz augstāka kompleksitātes pakāpe nekā tā daudz vienkāršākajiem «brālēniem» — punkta vai ierobežotā cikla atraktoriem, kas apraksta determinētus procesus. Pēc definīcijas, atraktors nosa­ka dinamiskas sistēmas uzvedību ilgākā laika intervālā. Sistēmas, kas laika gaitā sasniedz līdzsvara stāvokli, apraksta t. s. punkta atraktors, periodiskus procesus — ierobežotā cikla atraktori, bet haotisku sistēmu uzvedību — dīvainie atraktori.

102. att. Lorenča dīvainais (haotiskais) atraktors, ko izmanto meteoroloģiskā laika modeļa izveidošanai 1136].

Lorenča dīvaino atraktoru iegūst, atrisinot triju nelineāru diferenciālvienā­dojumu sistēmu. Šos vienādojumus Edvards Lorencs ieteica jau 1963. gadā, lai aprakstītu šķidruma plūsmas hidrodinamiskās īpašības. Bet vēlāk šie vienādo­jumi un to risinājumi — Lorenča dīvainie atraktori — atrada visplašāko lieto­jumu tieši meteoroloģijā. Lorenča atraktora dabu nosaka trīs vienādojumos ietvertie parametri a, h un b. Pie jo daudzām šo parametru vērtībām veidojas dažādas formas haotiskie dīvainie atraktori. Bet var atrast arī tādas šo para­metru vērtības, kas dod fiksētu punkta atraktoru. Tātad Lorenča vienādojumi apraksta gan haotiskos, gan strikti determinētos atmosfēras plūsmu stāvokļus. Kā punkta atraktora me­hānisko analogu var minēt bumbiņas trajektoriju pil­tuvē ar izvadu (103.a att. 257. lpp., [26]). Fāzu plak­nē jebkura bumbiņas tra­jektorija beidzas fiksētā punktā (103.Ł att. 257. lpp.). Šī trajektorija ir determi­nēta, bumbiņa vienmēr iz­kritīs caur izvadu. Līdzīgs punkta atraktors apraksta daudzus determinētus pro­cesus dabā, piemēram, pe­riodiski dziestošās fizikālā svārsta svārstības. Šo deter­minēto procesu galaiznā- kums parasti ir saistīts ar sistēmas nonākšanu «glo­bālā» līdzsvara stāvokli.

Nedaudz sarežģītāks ir robcžcikla atraktors. Bet arī

KA

75. att. P. Pikaso. "Sieviete ar bumbieriem'' (1909).

76. att. I'. Pikaso. "Sieviete" (1937).

80. att. l/ionardo da VinCi glezna "Klinšu Madonna" (saukta ari — "Madonna grotā") [ 196]: a agrīnais Luvras variants (apm. 1483. g.); '> — vēlākais Londonas Nacionālās galerijas variants

11 ^itfi ii i

#7. att. V. Kandinska glezna "Melnās līnijas" (1913).

103. att. Bumbiņas trajektorija piltuvē ar izvadu (a) var kalpot par mehānisku punkta atrak­tora modeli. Fāzu plaknē (x, y) jebkura bumbiņas trajektorija beidzas fiksētā punktā (b). Šī

trajektorija ir determinēta [26],

šajā gadījumā trajektorija sasniedz stabilu, fiksētu robežciklu, kas raksturo, piemēram, determinētu periodisku procesu.

Pavisam citāda — daudz komplicētāka iedaba piemīt dīvainam haotiskam atraktoram. Tas raksturo pāreju no vienkāršā uz sareģīto, no strikti determinēta procesa uz deterministisku haosu. Nav grūti saskatīt konceptuālu līdzību starp sakārtotības parametru sinerģētikā (41., 42. att. 93. lpp.) un dīvaino atraktoru haosa teorijā. Taču reizē saskatāmas arī atšķirības — sakārtotības parametrs, kā redzams, realizē sinerģētiskās sistēmas koherenci caur pakļaušanas principu {slavingprinciple), tai pašā laikā atrodot consensus (consensus findinģ) ar apakš­sistēmu brīvības pakāpēm. Šis consensus dod iespēju sistēmai evolucionēt ne pārāk strikta determinisma apstākļos.

Salīdzinājumam atgādināsim, ka dīvainais atraktors nosaka dinamiskas sistēmas uzvedību ilgākā laika intervālā un regulē tās attīstību deterministiskā haosa ietvaros. Abos gadījumos tiek sasniegta augsta sistēmas adaptivitāte un paiorganizējoša attīstība. Jāpiebilst, ka Lorenča dīvainajam atraktoram trīsdi- mensionālā telpā ir bezgalīgi daudz iespēju un stāvokļu — trajektorijas nekad neatkārtojas, tās negaidīti pāriet no viena cikla otrā (102. att. 256. lpp.), tomēr paliekot ierobežotas noteiktā fāzu telpas apgabalā.

Lorenča dīvaino atraktoru var salīdzināt ar divām daivām, kuru struktūra veido nepārtrauktas orbitālas līknes jeb cilpas. Katrs cilpas punkts pārvieto­joties nenovēršami virzās uz daivas centru, tiek šā centra pievilkts, tad atraujas no centra vai aizskrien tam garām, ekscentriski dodoties tālāk un atkal veidojot cilpas. Šā atraktora veidotās trajektorijas nekad nekrustojas un arī nenoslēdzas (kā determinēta ierobežota cikla gadījumā), tās negaidīti pārlec no vienas

laiks, sek FREKVENCE. uz SIRDS SARAUŠANĀS FREKVENCE

minūtĒ

105. att. Sirdsdarbības ritma funkcionālās atkarības veselam cilvēkam (zaļais fons), sirds slimniekam 8 dienas (zilais fons) un 13 stundas (sarkanais fons) pirms letāla infarkta [55]. Kreisajā kolonnā attēlota sirds pulsa biežuma maiņa laikā, vidējā kolonnā — sirds ritma frekvences (Furjē) spektrs, labajā kolonnā — fazu diagramma, kas raksturo atraktora dabu.

106. att. Bifurkāciju kaskāde vienkāršā nelineārā sistēmā; kaskādi veido perioda dubulto­šanās efekts bifurkāciju punktos. Kaskādei attālinoties no līdzsvara stāvok|a, sistēma gala­rezultātā pāriet haosa stāvoklī.

simbolisma pārstāvis Pauls Klē jau 1913. gadā radīja gleznu «Bifurkāciju celi» {«Bifurcation routiere»). Šajā darbā (107. att. 5. piel.) tīri abstrakti vizuālā iztēlē Klē simboliski attēlojis bifurkāciju principu, ko haosa teorijā formulēja pēc vairākiem gadu desmitiem. Tas ir kārtējais piemērs, kad intuitīvais skatī­jums māksliniekam devis iespēju ielūkoties jaunas paradigmas būtībā. Profe­sors Ilmārs Lazovskis rakstā «Haosa teorija un fenomenoloģiska pieeja pacien­tam» [104] atzīst, ka haosa teorija ieņem arvien nozīmīgāku vietu modernajā medicīnā. Cilvēka veselību lielā mērā nosaka organisma dažādo orgānu un funkcionālo sistēmu darbība deterministiskā haosa režīmā, ko, kā jau minē­jām, raksturo augsta adaptivitātes spēja. Ja orgāns vai sistēma iziet no relatīvā līdzsvara stāvokļa, haotiskie atraktori to cenšas atgriezt iepriekšējā vai arī stabi­lizēt jaunā līdzsvara stāvoklī. Ilmārs Lazovskis [104] konstatējis, ka apmēram 85% gadījumu organisms pats bez mediķu un medikamentu iejaukšanās spēj atgriezt sevi normālā haosa stāvoklī. Tomēr dažu slimību iznākums var būt nelabvēlīgs. Pie tādām pieder ļaundabīgie audzēji, kas veicina fiksētu atraktoru izveidošanos. Ja notiek nekontrolējama audu proliferācija ar metastāzēm citās organisma daļās, tad haotiskās sistēmas iziet no dīvaino atraktoru ietekmes un virzās pie fiksētiem atraktoriem, kuru determinētais iznākums nozīmē nāvi.

Sevišķi būtiska loma deterministiskā haosa režīmam ir smadzeņu darbībā, it īpaši jaunrades procesos. Tas ir jauns, fascinējošs haosa teorijas lietojuma lauks, un pie tā vēl atgriezīsimies.

Vissīkāk pēc elektroencefalogrāfijas (EEG) datiem izpētīts smadzeņu deterministiskais haoss dziļa miega stāvoklī ([151], 89. lpp.). To raksturo frak- tāls haotiskais atraktors piecdimensionālā telpā, resp. tas ir atkarīgs no pieciem neatkarīgiem mainīgajiem. Daudz sarežģītāka ir dīvaino atraktoru daba sma­dzeņu aktivitātes periodos nomoda stāvoklī. Te interesanti piebilst, ka atšķirībā no normāli funkcionējošu smadzeņu ļoti neregulārajiem haotiskajiem elek­triskās aktivitātes ritmiem epilepsijas gadījumā iestājas ļoti regulāri elektrisko svārstību ritmi, kas, tāpat kā pirmsinfarkta stāvoklī, liecina par fiksēta atraktora veidošanos. Tātad cilvēka organisms spēj adaptīvi funkcionēt tikai ierobežota haosa apstākļos. Kā strikts determinisms, tā totāls haoss noved pie organisma bojāejas.

70. DĪVAINAIS METAATRAKTORS KĀ PLATONA IDEJAS PROTOTIPS

Determinisma un haosa pretmetu aspektā filozofiskas pārdomas izraisa iepriekš aplūkotā cilvēka embrija morfogenēze (sk. 65. eseju un 100. att. 5. piel.) un tā evolūcija ierobežotā (deterministiskā) haosa apstākļos.

Cilvēka embrijs attīstībā filoģenētiski it kā iziet cauri visām mugurkaul­nieku sugu evolūcijas stadijām no zivsveida un abiniekveida formām līdz cil­vēkveida radījumam. Un vai patiesi septiņas nedēļas vecais cilvēka embrijs vairāk neatgādina delfīnu (100. att. 5. piel.) nekā cilvēku? Tas liek domāt, ka sākotnēji embrija attīstību regulē haotiskie atraktori, kurus pēc tam aizstāj vēlīnākās evolūcijas fāzes atraktori. Un kā beidzamais šajā dīvaino atraktoru kaskādē varētu būt sava veida metaatraktors, kas «programmē» homo sapiens tapšanu.

Katrs jaundzimušais cilvēkbērns būs vienreizējs, atšķirīgs no visiem citiem, bet tam būs visu to nozīmīgāko īpašību kopa, kuras raksturo homo sapiens kā sugu (vertikāla gaita, augsti attīstīta nervu sistēma un smadzenes, spēja veidot artikulētu valodu utt.). No tā var secināt, ka šis dīvainais metaatraktors repre­zentē homo sapiens sugu, ka tam piemīt to vissvarīgāko īpašību kopa, kuras raksturo Cilvēku. Runājot datorzinātnes terminoloģijā, šādu metaatraktoru var uzskatīt par soft loare (programmas nodrošinājumu), kas savukārt morfo- ģenēzes procesā nosaka hard ware— cilvēka ķermeņa (somas), tā orgānu un visu funkcionālo sistēmu (nervu sistēmas, smadzeņu, muskuļaudu, asinsrites un elpošanas orgānu utt.) veidošanos no trim sākotnējām embrija dīgllapām: ektodermas, mezodermas un endodermas.

Filozofiskā aspektā metaatraktors simbolizē Jāņa evaņģēlija sakrālo ievadfrāzi: «Pirmsākumā bija Vārds,» — un: «Vārds tapa Miesa.» ([11], Jāņa evaņģēlijs, 1:1, 1:14.) Šādā skatījumā dīvainais metaatraktors asociējas ar Platona ideju, kuru tad arī varētu uzskatīt par primāro Vārdu, kas nosaka formas un struk­tūras, kādas pieņem materiālā substance — vielas atomu un molekulu «jēlma- teriāls» cilvēka embrija bioloģiskās morfoģenēzes procesā.

Šādā hipotētiskā pieejā varam pieņemt, ka, piemēram, katrai putnu sugai — strazdiem, bezdelīgām — vai katrai koku sugai — priedei, bērzam — ir savs atbilstošs dīvainais metaatraktors, sugas pārstāvja «ideja», kas nosaka galīgās for­mas, kuras tiek sasniegtas šīs sugas pārstāvja morfoģenēzes gaitā. Morfoģenēzes procesa haotiskās attīstības dabu savukārt parāda tas, ka, piemēram, veidojo­ties no sēklas bērzam kā fraktālam objektam, ikviens bērzs būs vienreizējs un atšķirīgs no citiem pasaules bērziem. Vēl jo vairāk, katra bērza lapa būs atšķi­rīga no visām citām lapām (kā to jau bija apcerējis Leibnics). Jo te saspēlējas sinerģētiskās kategorijas — haotiskā nejaušība un deterministiskā nepiecieša­mība, haoss un sakārtotība. Vēlreiz atcerēsimies Hermeņa Hākena ģeniālo frāzi: «Gadījums un nepieciešamība— reālajā pasaulē vajadzīgi abi (Chance and necessity, Reality needs both).» Katra fraktālā bērza detaļa (lapas, zari, saknes) būs atšķirīga, bet morfoģenēzes fināls būs deterministiski nosacīts, atbilstošs bērza sugas dīvainajam metaatraktoram — bērza idejai, bērza «Vārdam».

Filozofiski gnozeoloģiskā aspektā tas nozīmē, ka jebkuras bioloģiskās popu­lācijas raksturojošais vispārinātais jēdziens, piemēram, bērza jēdziens resp. bērza ideja, jau objektīvi eksistē kā bērza dīvainais metaatraktors, kas morfo- ģenēzē «programmē» bērza kā sugas pārstāvja tapšanu. Interesanti, ka pēcplatona filozofijā dominēja divi pamatvirzieni: reālisms, kura pārstāvji uzskatīja, ka Platona «idejas» tiešām reāli eksistē, un nominālisms — uzskats, ka idejām vārdu dod izzinātājs subjekts, t. i., cilvēks, un ka Platona «idejas» ir tikai noumens, vis­pārinātie jēdzieni, vārdi apziņā.

Mūsdienu zināšanu līmenī varam mazliet spekulatīvas hipotēzes ietvaros apgalvot, ka bioloģiskā morfoģenēze modernās haosa teorijas interpretācijā apstiprina Platona sākotnējo domu par «ideju» reālu eksistenci un to primātu dabas daudzveidīgo formu evolūcijā. Ikvienas sugas raksturīgais dīvainais metaatraktors cenšas saglabāt savu struktūru evolūcijas gaitā un tādā veidā nodrošina sugu invarianci (ilgstošu nemainību) evolūcijas procesā. Kādas sugas izmaiņas un jaunu sugu veidošanos, kā zināms, nenosaka ārējo apstākļu ietekme. To var izraisīt tikai plaša apjoma pozitīvas mutācijas sākotnējā DNS tekstā. Rezultātā var izveidoties izmainītas struktūras dīvainais metaatraktors, tādējādi topot par jaunas sugas ideju, tās «Vārdu». Bet nesalīdzināmi biežāk notiek neprognozējamas negatīvas DNS sākotnējā teksta mutācijas, kas var radīt fiksētus atraktorus, evolūcijas strupceļus, kuru galaiznākuma vārds ir Nāve.

71. AUTOSIMILARITĀTES PRINCIPS FRAKTĀĻU STRUKTŪRĀS

Autosimilaritāte (angl. self-similarity) jeb pašlīdzība ir viena no fraktālo objektu pamatīpašībām. Autosimilaritāte ir objekta nemainīgums jeb inva- riance attiecībā pret mēroga vai lieluma mainu, un to parasti dēvē par mēroga invarianci (angl. scaling invariance). Šādu autosimilaritāti demonstrē gan difūzi­jas ierobežotie agregācijas (DIeA) fraktāļi (93. att. 241. lpp.), gan cilvēka organisma fraktālie objekti — plaušu bronhiālais elpošanas ceļu tīkls (96. att. 245. lpp.), sirds un asinsvadu sistēma (97. att. 5. piel.), nervu sistēmas fraktālā struktūra (98. att. 246. lpp.) un daudzi citi [55]. Šajos objektos neatkarīgi no tā, kādā lieluma skalā mēs tos aplūkojam, būtiski saglabājas raksturīgā fraktālā objekta struktūra; viens un tas pats struktūras motīvs atkārtojas katrā mērogā, to pakāpeniski samazinot [55, 26],

Tipisks autosimilaritātes piemērs ir krievu «matrjoška»: visas lellītes ir cita citai līdzīgas, atšķiras tikai to izmēri [104].

Autosimilaritāti var demonstrēt, nostājoties liela spoguļa priekšā un pie­liekot zem acīm pie deguna mazu spogulīti. Tad bezgalīgā spoguļattēlu rindā mēs redzam precīzi pašlīdzīgus spoguļa un savus attēlus arvien mazākā un mazākā mērogā līdz bezgalībai [104],

Šīs esejas autors ar autosimilaritātes efektu sastapās jau agrā bērnībā. Tajā laikā bija pārdošanā sīrups skārda bundžās, uz kurām bija reklāmas attēls ar smaidošu mazu zēnu, kas no līdzīgas bundžas ar karoti laizīja sīrupu. Uz attēlotās bundžas savukārt daudz mazākā mērogā bija redzams tas pats zēns, un tā joprojām līdz bezgalībai. Tas rosināja uz agrīnām filozofiskām pār­domām par bezgalības būtību.

Pazīstamais angļu rakstnieks Džonatāns Svifts, fantastiskā romāna «Gulivera ceļojumi» autors, autosimilaritātes vizuālam attēlojumam veltījis filozofiski ironiskas vārsmas:

So, naturalists observe, a flea Hath smaller flies that him pray, And these have smaller flies to bite'em And so proceed adi nfi n i t u m.

Tā pētnieks atklāj, ka blusai Ir mazākas blusas, kas kož tai, Uz tām vēl mazākas blusas barojas, Un tā tas turpinās adi nfi n i tum.

(Citēts pēc [26], 172. lpp.)

Autosimilaritāte parādās arī organismu augšanas procesos. Tā gliemeža Nautilius pompilius ārējais cietais apvalks ir savērpts un sadalīts kamerās loga­ritmiskas spirāles atveidā. Augot gliemezis atkārto spirāles kameru logarit­misko secību atbilstoši pašlīdzības principam. Arī cilvēka mazulim augot, visi viija orgāni palielinās proporcionāli saskaņā ar autosimilaritātes principu.

Tā kā autosimilaritāte piemīt visiem fraktāļiem objektiem, varam secināt, ka dzīvnieku un cilvēku organismi (un ne tikai to atsevišķās funkcionālās sistē­mas) ir fraktāli pēc savas struktūras un ar zemāku dimensionalitāti, t. i., ar D < 3. Autosimilaritāte parādās ne vien dzīvo sistēmu strukturālajā uzbūvē, bet arī to procesos laikā. Tā konstatēts, ka sirdsdarbības haotiskās neregula­ritātes pašlīdzīgi atkārtojas dažādos laika mērogos un ir autosimilāras attiecīgi 3 minūšu, 30 minūšu un 300 minūšu intervālos [55].

Autosimilaritāte, izrādās, ir viens no būtiskākajiem Visuma simetrijas ele­mentiem. Terminam «simetrija» ir grieķiska cilme, un tas nozīmē — labi būvēts, proporcionāls, labi izkārtots [104]. Tātad simetrija ir zināmā mērā pretmets haosam.

72. AUTOSIMILARITĀTE PAKĀPJU FUNKCIJĀS

Autosimilaritāte piemīt vairākiem universāliem dabas likumiem, kurus apraksta ar t. s. pakāpju funkcijām. Tāds ir Ņūtona gravitācijas likums, ka divu ķermeņu pievilkšanās spēks F ir proporcionāls to masām mj un mi un apgriezti proporcionāls to attāluma rļ2 kvadrātam:

m^m 7i

F= (9 )

r \2

kur G ir gravitācijas konstante, kas Visuma uzbūvē un evolūcijā ir tikpat universāla kā Planka konstante h un gaismas ātrums c [52], Gravitācijas liku­mam piemīt autosimilārā mēroga invariance. Tas vienlīdz pareizi apskata gan divu molekulu pievilkšanos nanometru distancēs, gan Saules un planētu pie­vilkšanos Saules sistēmā, gan ari divu galaktiku pievilkšanos, kuras kosmosa telpā atdala tūkstošiem gaismas gadu attālums (59. att. 3. piel.)

Saskaņā ar populāro leģendu no ābeles krītošs ābols, šī it kā metaforiskā vīzija, izraisīja Ņūtonā pēkšņu apskaidrības uzliesmojumu, (satori dzenbu- distu terminoloģijā), kas viņu noveda pie universālā gravitācijas likuma atklāšanas (sk. 82.2 eseju). Ņūtons tīri intuitīvi uztvēra šā likuma mēroga invarianci, pieņemot, ka Zeme pievelk krītošu ābolu dažu metru attālumā no Zemes virsmas pēc tāda paša likuma, kā tā pievelk Mēnesi, kas atrodas vairāk nekā 380 000 km no Zemes. Cilvēka radošā ģenialitāte izpaužas tieši šādu uz analoģijām dibinātu asociāciju uztverē un intuitīvā interpretācijā. Loģiskie, uz aprēķiniem balstītie slēdzieni seko pēc tam. Leģendu par krītošo ābolu apstip­rina vairāku Ņūtona laikabiedru liecības ([52], 85. lpp.). Šā ģeniālā atklājuma laikā Ņūtonam bija tikai 23 gadi, un ābols krita viņa vecāku mājās Linkolnšīrā, kur jaunais zinātņu bakalaurs pavadīja atvaļinājumu, bēgot no mēra epidēmi­jas Kembridžā. Ņūtona rīcībā nebija datu, pēc kuriem varētu viņa postulēto likumu (9) kvantitatīvi pārbaudīt. To varēja izdarīt tikai vēlāk, pēc atgriešanās Kembridžā. Un aprēķini tiešām apstiprināja intuitīvi formulēto likumu.

Šis ir tikai viens spilgts piemērs, cik neparasti un dīvaini ir ģeniālo atklājumu ceļi. Tikai retos gadījumos pie tiem var nonākt ar deduktīvi loģiskās analīzes palīdzību. Kā tālāk redzēsim, cilvēka smadzeņu jaunrade notiek ierobežotā haosa apstākļos un to lielā mērā nosaka tur darbojošies dīvainie atraktori.

Cits universāls pakāpes funkcijas likums ir elektrisko lādiņu pievilkšanos (vai atgrūšanos) regulējošais Kulona likums. Ari šajā gadījumā lādiņa mij­iedarbības spēki ir apgriezti propor­cionāli attāluma kvadrātam (1/r2 ) starp mijiedarbībā esošajiem lādiņiem. Līdzīgi kā gravitācijas likumā, arī šajā gadījumā ir spēkā mēroga invariances princips. Saskaņā ar Kulona likumu pievelkas gan elektrons pie pozitīvi lā­dēta kodola ūdeņraža atomā, gan divas pretēji lādētas futbola bumbas izmēra metāla lodes laboratorijā.

Mēroga invariantiem pakāpes fun­kcijas likumiem veltīta brīnišķīgā, sti­mulējošā amerikāņu matemātika Man­frēda Šrēdera grāmata «Fraktāli, haoss un likumība» («Fractals, Chaos, Poiuer Larvs», [166]), kā arī saistoša noda]a Mareja Gella—Manna visaptverošajā autobiogrāfisko eseju grāmatā ([52], 92. lpp.).

108. att. Dažāda lieluma kosmisko putekļu un meteorītu parādīšanās varbūtība atkarībā no to diametra [166].

Izrādās, ka, apstrādājot dažādus statistiskos datus, novērojamas empīriskas pakāpju funkciju sakarības, kurām arī piemīt mēroga invariance (autosimila- ritāte). Tā 1930. gadā Hārvarda universitātes lingvists Džordžs Kinslejs Zipfs, analizējot Amerikas pilsētu skaitu atkarībā no to iedzīvotāju skaita, konstatēja, ka to var aprakstīt ar pakāpes funkciju, kas ir invarianta attiecībā pret mēroga izmaiņām. Šis likums pazīstams kā empīriskais Zipfa likums, un tas novērojams visdažādākajos statistisko datu masīvos, piemēram, šim likumam pakļaujas dažāda lieluma kosmisko putekļu un meteorītu parādīšanās varbūtība atkarībā no to diametra (108. att., [166], 104. lpp.). Kā redzams, ar kosmosa kuģi katrā trīsdesmitajā mikrosekundē saduras kosmiskais puteklis 1 mikrona diametrā (jeb 1012 daļiņas gadā); varbūtība Zemei sadurties ar meteorītu 1 m diametrā ir vienreiz gadā, bet ar Arizonas vairāk nekā 100 m diametra meteorītu (paldies Dievam) — tikai pēc katriem 10 000 gadiem! Līdzīgam likumam pakļaujas zemestrīču parādīšanās varbūtība atkarībā no to stipruma Rihtera skalā.

Visnotaļ iespējams, ka arī cilvēka dzīvē mazu un lielu nelaimju vai arī otrādi — mazu un lielu laimes momentu parādīšanās ir pakļauta līdzīgām Zipfa tipa pakāpes funkcijas likumsakarībām. Varbūtība laimēt loterijā auto­mašīnu ir tikpat maza kā iet bojā aviokatastrofā. Bet sīku nelaimju vai laimes momentu parādīšanās biežums var būt ar kārtu dažas stundas vai dienas.

73. AUTOSIMILARITĀTE KĀ UNIVERSĀLS KOSMOSA ELEMENTS

Autosimilaritāte realizējas kā universāls kosmosa simterijas elements, kas ievieš zināmu sakārtotību gan nedzīvajā, gan dzīvajā dabā un darbojas kā deterministisks pretspars tajā valdošajam haosam. Šo komplementāro pretmetu pāra mijiedarbība tad arī acīmredzot veido to evolūciju virzošo dzinējspēku, kuru nosaucām par deterministisko haosu.

Kā jau minēts apskatā par kosmosa attīstību (37. eseja), da|a vadošo kos- mologu uzskata, ka pēc Lielā Sprādziena (Big Banģ) kosmiskā evolūcija noritējusi un arī tagad norit autosimilaritātes principu ietvaros. Saskaņā ar šo hipotēzi kosmosa iedīglī, kad tas vēl bija pingponga bumbiņas lielumā, pirms t. s. «inflācijas» fāzes (57. att. 3. piel.), jau miniatūrā iezīmējās lielā kosmosa pamatstruktūras elementi. Šeit var saskatīt analoģiju ar cilvēka embrija attīstību — jau olšūnā ir iezīmētas tā attīstības vadlīnijas. Šo līdzību uzska­tāmi izsaka izcilā angļu kosmologa Stīvena Hokinga grāmatas metaforiskais nosaukums «Mazulītis Universs» («Baby Universe», [65]). Ja kosmosa evolū­ciju autosimilaritātes principa ietvaros var salīdzināt ar cilvēka embrija kā organisma attīstību, tad — vismaz simboliskā nozīmē — var pieņemt budis- tiskā panteisma tēzi par to, ka Visums ir Dharmakāja — absolūtais Būdas ķermenis — un ka visas būtības pamatā ir kāda mūžīga Būdas esence, Visuma Būdas Prāts ([90], 148. lpp.). Mūžīgā Būdas esence var parādīties (manifestē- ties) caur reinkarnāciju kā dažādie vēsturiskie būdas, viņu vidū arī 563. gadā pirms Kristus dzimšanas Sidarta Gautama — budisma pamatlicējs.

74. FRAKTĀĻU ATVEIDI MĀKSLINIEKU SKATĪJUMĀ

Mēs aplūkojām fraktāļu ģeometriju kā autentisku dabas ģeometriju, ko sep­tiņdesmitajos gados iedibināja Benuā Mandelbrots. Viņš bija ari krusttēvs sugasvārdam «fraktālis»: eseju stilā uzrakstītajai un bagātīgi ilustrētajai grā­matai Mandelbrots ir izvēlējies nosaukumu «Dabas fraktāļu ģeometrija» {«The Fractal Geometrj ofNature», [109]). Cildinošu recenziju par šo burvīgo grā­matu uzrakstījis kādas citas ne mazāk populāras, aizraujošas grāmatas — «Gēdels, Eshers, Bahs» («Godel, Esher, Bach», [72]) — autors, ievērojamais amerikāņu matemātiķis un dabas filozofs Duglass Hofsteters: «Retums: bilžu grāmata par pārgudrākajām pētījumu idejām modernajā matemātikā. Pārstei­dzoši — Mandelbrots parāda fraktāļu ģeometrijas nozīmi praktiski jebkurā zinātnes nozarē.»

Bet Mandelbrots esejās meklē ari šis jaunās matemātikas nozares vēsturis­kās saknes un atrod tās triju izcilu pagātnes mākslinieku darbos [109]. Pirmais ir kāds anonīms franču 13. gs. gleznotājs (109. att. 6. piel.). Šai kontekstā jāuzsver, ka kopš renesanses laikiem kultūrvēsturiskās apcerēs iesakņojies stereotips, ka viduslaiki ir vistumšākais periods cilveces vēsturē. Taču, kā jau norāda Tomass Manns «Doktorā Faustā», tas bija humānisma un renesanses laikmeta pārstāvju vienpusīgais skatījums. Mūsdienās šo daļēji antireliģisko noskaņu veidoto vēsturisko negāciju ir aizstājusi objektīva bezaizspriedumu interese par šo īpatnējo laikposmu cilvēces kultūras vēsturē.

Pēc Mandelbrota domām, var runāt par zināmu stagnāciju filozofijā un dabaszinātnēs, tomēr joprojām nepārspēta un neatvairāma ir viduslaiku arhitektūra un ar to saistītā augstā līmeņa celtniecības inženierija. Vēl šodien vis­lielāko apbrīnu izraisa viduslaiku gotikas šedevri — grandiozās katedrāles Strasbūrā, Ulmā, Ruānā, vienreizējā Parīzes Dievmātes katedrāle ar tās 13. gs. portāliem un kapela «Saint Chapelle» — gotiskās arhitektūras pērle Parīzē ar 1 134 ainām no Vecās un Jaunās Derības 13- gs. vitrāžu tehnikā; dievlgais jauktā romāņu un gotiskā stilā celtais dievnams Šartrā (78.a,b att. 4. piel.) un vēl jo daudzas citas monumentālas viduslaiku celtnes romāņu un gotikas stilā. Šo patiesi grandiozo būvju arhitekti un celtnieki ir palikuši anonimi; parasti tās tika būvētas vairāku paaudžu garumā. Un, tā kā gotiskās katedrāles tika celtas Dievam par godu, to būvētājus nemocīja egoistiska godkāre atstāt savas pēdas vēsturē. Tie varēja un varbūt arī gribēja palikt anonīmi, jo Dievs viņus zināja. Šajā viduslaiku reliģiskā pacēluma gaisotnē dievnamu būvētāji — mūrniekmeistari (master masons) — bija viscildenākās profesijas pārstāvji. Kā liecina to laiku Bībeles ilustrācijas, piemēram, zīmējumi «Bibles Moralisēes illustrees», arī Dievs tika attēlots kā Pasaules Celtnieks ar mūrnieka darbarīkiem. Benuā Mandelbrota Austrijas Nacionālajā bibliotēkā Vīnē uzietais anonīmā mākslinieka zīmējums (109. att. 6. piel.) grezno titullapu leģendārajam «Bibles Moralisees « izdevumam — grāmatai, kas uzrakstīta starp 1220. un 1250. gadu franču Austrumu Šampaņas (Champagne) dialektā. Paraksts zem zīmējuma šāds:

ICICRIE DEX CIEL ET TERRE SOLEIL ETLUNE ET TOZELEMENZ

(Šeit rada Dievs Debesis un Zemi, Sauli un Mēnesi, un visus Elementus)

Reproducējot šo brīnišķo zīmējumu savā grāmatā, Mandelbrots pārfrāzējis parakstu zem zīmējuma:

HERE GOD CREA TES CIRCLES, WA VES AND FRA CTALS

(Šeit Dievs rada Apļus, Viļņus un Fraktāļus)

Mūsdienu skatījumā šis zīmējums ir patiesi pravietisks un dziļi simbolisks. Ārējais aplis simbolizē Eiklīda ģeometrijas perfekto dabu un ar to saistīto deter- minisrnu. Dieva radītais Visums ir galīgs un atbilst mūsdienu kosmoloģijas standarta modelim. Nākamais simboliskais struktūras elements — viļņi — raksturo periodisko koherenci, kas zinātnē ienāca tikai 17. gs. ar Heigensa— Frenela gaismas viļņu paradigmu. Un, beidzot, šķietami vissenākais fraktāļu attēls. Zīmējumā fraktāļi raksturo haosa elementus Dieva radītajā Pasaulē. Apbrīnojami dziļi filozofiska Pasaules uzbūves elementu vispārinājuma vizuālā aina. Satura bagātībā un dziļumā to var salīdzināt ar jan un iņ simbolu Dao filozofijā. Varam tikai pievienoties Benuā Mandelbrota apbrīnam par šā ano­nīmā 13. gs. meistara dievišķo intuīciju.

Interesanta arī cita iezīme. Atbilstoši tā laika tradīcijām Dievs attēlots kā darbīgs Pasaules uzbūves «Arhitekts un Celtnieks». Vienā rokā viņam konstruk­tora darbarīks — cirkulis, ar otru tiek saturēts jaunradītais Visums un tā Pamatelementi. Un atkal savdabīga simbolika — Dievs mēra attālumu no Visuma centra līdz tā apmalei. Tur šķietami ietverta norāde uz mēroga inva- rianci, kas, kā redzējām, ir viens no Visuma simetrijas pamatelementiem — determinējošais faktors Pasaules haosā.

Cik gan atšķirīgs šis darbīgais viduslaiku Dievs — Pasaules Celtnieks — no Mikelandželo Siksta kapelas bargā Pasaules radītāja, kas ar vienu rokas mājienu atdala gaismu no tumsas (19. att. 1. piel.)! Franču meistara Dievam ir ļoti cilvēciska, labsirdīga sejas izteiksme — varbūt tikai mazliet ironiski viltīga. Tas tik burvīgi atbilst Alberta Einšteina ironiski filozofiskajam raksturojumam: «Dievs nav ļauns, bet viltīgs.»

Šī Dieva sejas izteiksme, šķiet, turpina romāņu stila skulptūru tradīcijas, ar kurām mani franču arhitektūras muzejā «Palais des Chaillot» iepazīstināja lieliskais franču kultūras un mākslas zinātnieks, Parīzē dzīvojošais latvietis Juris Staune. Viduslaiku romāņu perioda svēto skulptūrām apbrīnojami cilvē­ciski izteiksmīgas sejas — ironiskas, komiskas, izteikti individuālas. Liekas, ka šie svētie tēlo raksturlomas. Vēlāk, gotikas perioda skulptūrās, svēto sejas jau stipri kanonizētas, zaudējušas individuāli cilvēciskās iezīmes, kļūdamas par vienveidīgām ikonām.

Nākamais Mandelbrota pieminētais fraktāļu attēlotājs ir renesanses dižmeistars Leonardo da Vinči. Leonardo var uzskatīt par renesanses perioda visuniversālāko ģēniju — gleznotājs, arhitekts, zinātnieks, izcils inženieris [196]. Viena no viņa iemīļotajām, liktenīgajām tēmām ir ūdens plūdi — turbulentas plūsmas, kurās dominē dažāda mēroga virpuļu superpozīcija (110. att. 6. piel.). Tas ir tipisks ūdens haotiskās turbulentās plūsmas veidoto fraktāļu ģeometrisks attēls. Un cik salīdzinoši meistarīgi Leonardo ataino abus filozofiskos pretmetus — mieru, harmoniju un līdzsvaru «Klinšu Madonnas» audeklos (80. att. 4. piel.) un dinamisko haosu ūdens virpuļos (110. att. 6. piel.)!

Ūdens plūsmas virpuļstrūklas zinātniskie pētījumi sākās daudz vēlāk un tika matemātiski formalizēti Lūisa Ričardsona darbos mūsu gadsimta div­desmitajos gados. Ričardsons analītiski parādīja virpuļu veidošanās mēroga invarianci turbulentās ūdens plūsmās. Satriecoši, ka Leonardo da Vinči to jau bija vizuālā iztēlē intuitīvi atklājis pirms vairāk nekā trim gadsimtiem! Kā norāda Mandelbrots, Ričardsona pētījumi būtībā reducējās tikai uz jaunu analītisku formulu izvedumiem [109]. Tajās bija izzudusi burvība un vizuālā uzskatāmība, kas piemīt fraktāļu ģeometrijai. Ričardsona analītiskie pētījumi drīz vien apsīka, jo neradīja plašāku interesi zinātnieku vidū.

Mandelbrota vizuālā fraktāļu ģeometrija pēc pusgadsimta izraisīja renesansi turbulento (virpuļveida) haotisko plūsmu teorijā. Tā demonstrēja savas izcilās potences arī daudzās citās zinātnes nozarēs, kurās pētītās struktūras varēja aprak­stīt fraktāļu ģeometrijas ietvaros [109]. Pāreja no analītiskām uz vizuālām dabas aprakstu metodēm — tā bija jaunā fraktāļu ģeometrijas paradigma, diametrāli pretēja tai paradigmai, kuru iedibināja Dekarts, radot analītisko ģeometriju.

Trešais fraktāļu mākslinieks, ko izceļ Mandelbrots, ir viens no japāņu Edo perioda izcilākajiem meistariem Hokusai Kacusika (1760-1849), gleznotājs un gravīras lielmeistars. Viņa gravīra «Lielais vilnis» (111. att. 6. piel.) ir Japānā tikpat populāra kā Leonardo «Mona Liza» Rietumu pasaulē. Šis salīdzi­nājums ilustrē Austrumu un Rietumu atšķirīgo mentalitāti. Japāņiem vienmēr tuva bijusi daba — arī ar savām draudīgajām stihijām.

«Lielā Viļņa» grandiozos apmērus izceļ Fudzi kalns tā fonā un šķietami miniatūrā zvejnieku laiva, ko tūlīt, tūlīt «aprīs» Vilnis. Bet, kā visos japāņu mākslasdarbos, Hokusai gravīrā ir arī slēpta fdozofiska simbolika: Lielais Ūdens vilnis un tā pretmets Fudzijama — Uguns kalns. Taču Mandelbrots tur pirmām kārtām saskatīja sev pazīstamu pasauli — fraktāļus plīstošā Viļņa virsotnē. Bet šī, izrādās, nav vienīgā Hokusai «fraktāļu» gravīra. Lielo meistaru vienmēr esot fascinējuši dažāda veida virpuļi kā haosa prototipi.

Mandelbrots uzskata, ka šie trīs lielie mākslinieki ir jau sen pirms viņa pār­kāpuši fraktāļu ģeometrijas slieksni. Viņiem gribētos pievienot vēl ceturto daiļo mākslu dižgaru — mūsu gadsimta ģeniālo holandiešu grafiķi Mauritsu Esheru [187]. Atšķirībā no Leonardo haotiskajām ūdens virpuļu ainām Eshers virpuli «geometrizē», pakļaujot noteiktiem simetrijas principiem (112. att. 6. piel.). Viņš lieliski atveidojis fraktāļiem piemītošo autosimilaritātes prin­cipu — sarkanās un pelēkās zivis, komplementāri sevi atkārtojot, tiek ierautas viena virpuļa krāterī un izmestas no otra krātera dzīlēm. Šis Eshera virpulis ir savā ziņā izomorfs Mandelbrota fraktāļu tipa piltuvveida virpulim (118. att. 6. piel.). Grafikā «Augu studijas» (113. att. 6. piel.) Eshers savukārt parāda fantastiski daudzveidīgu formu augu valsti, kas lieliski atklāj fraktāļu ģeomet­rijas neierobežotās iespējas dabas evolūcijā.

Dziļi simboliska ir grafika «Rāpu|i» (114. att. 6. piel.). Ķirzakas mistiski izlien no divdimensionālā zīmējuma plaknes un dīvainā rindā soļo pāri dažā­diem trīsdimensionālās pasaules objektiem — dabaszinātnieka traktātam senlaicīgā iesējumā, regulāram daudzskaldnim un trauciņam ar cigarešu un sērkociņu kastītēm —, lai atkal neglābjami atgrieztos divdimensionālā zīmē­juma plaknē. Šī grafika nepārspējama ar simbolikas bagātību. Tā kā zīmējumā apvienota divu un triju dimensiju pasaule, tās kopējā dimensionalitāte ir daļskaitlis (2 < D < 3), tātad fraktālis. Plaknes zīmējumā ķirzakas novietojas komplementāri ar trešās kārtas simetrijas asi. Un vēl — grafikas centrālās daļas regulārais daudzskaldnis, kas simbolizē Eiklīda ģeometrijas idealizēto pasauli, pretstatīts traukam ar fraktāļiem augiem — fraktāļu ģeometrijas simbolu. Apbrīnojams, filozofiski pravietisks skatījums uz Eiklīda un Mandelbrota kom­plementārajām ģeometrijām jau 30 gadus pirms fraktāļu ģeometrijas tapšanas!

Eshera māksla ir patiesi apbrīnojama ar dziļi intuitīvo skatījumu, vizuāli atainojot modernās 20. gadsimta zinātnes paradigmu visbūtiskākos pamatele­mentus: komplementaritātes principu (9. att. 1. piel.), relativitātes principu (6. att. 1. piel.), paradoksu loģikas «dīvaino cilpu» (48. att. 2. piel.) un frak­tāļu ģeometriju (112.-114. att. 6. piel.).

Apbrīnojami, ka Eshera mākslinieciskā intuīcija un vizuālā domāšana jāva viņam tikpat dzi|i kā Einšteinam, Boram un Mandelbrotam iespiesties Pasaules būtisko noslēpumu izpratnē.

Daudzkrāsaina un daudzveidīga fraktāļu pasaule atrodama savdabīgās latviešu mākslinieces Montas Kuršes akvareļos. To lieliski ilustrē 115. attēlā (6. piel.) parādītais akvarelis, kurā saskatāmas visdažādākās fraktāļu formāci­jas: fraktāļu «meži», «ūdenskritumi» un «mākoņi». Raksturīgi, ka māksliniece šai burvīgajai, filozofiski tendētajai fraktāļu ainavai devusi nosaukumu «Dao gaisma».

75. FRAKTĀĻU ĢEOMETRIJA DATORA «VĪZIJĀS»

Kā norāda Mandelbrots [109], fraktāļu ģeometrijas iedīgli tā sauktajā tīrajā jeb abstraktajā matemātikā parādījās jau 20. gs. sākumā. Visnozīmīgākais no tiem bija Georga Kantora izveidotā kopu teorija. Kantora atklātie punktu «pu­tekli» ar daudz lielāku dimensiju nekā punktam (D = 0), bet daudz mazāku nekā taisnei (D = 1) — punktu kopu fraktālā dimensija ir daļskaitlis D^ = 0,63 — bija pirmie īstie matemātiskie fraktāli (sk. 54. eseju). Klasiskās matemātikas apoloģēti Kantora punkta «putekļu» kopu nosauca par «patoloģisku mon­stru». Bet īsta matemātisko «monstru» galerija atklājās, pārejot no reālo skaitļu pasaules uz komplekso skaitļu plakni.

Punktu kompleksā plaknē veido divloceklu summa, kuras pirmais loceklis ir reāls skaitlis, piemēram, 3, bet otrais — imaginārs, piemēram, li, kur ; šajā gadījumā kompleksais skaitlis ir c = 3 + li- Ap 1920. gadu funkciju uzvedību kompleksā plaknē sāka pētīt franču matemātiķi Pjērs Fato un Gastons Džulia. Liels bija viņu pārsteigums, ka, kom­pleksā plaknē operējot ar pavisam vienkāršu formulu pie nosacījuma, ka operā­ciju atkārto daudzas reizes, ar tā saukto iterācijas metodi varēja iegūt visfan­tastiskākās figūras, patiesi īstu matemātisku «monstru» galeriju! Mandelbrots šo iteratīvās procedūras sākumformulu metaforiski nosaucis par skulptora kaltu, ar kuru var iegūt visbrīnišķīgākās skulptūras, ja cītīgi un nepārtraukti ka| [109]. Šīs dīvainās neregulārās figūras, kuras aptver haotiska rakstura robežlīnija, kas vei­dojas divu atraktoru konkurences rezultātā, nosauca par Džulias tīkliem.

Iterācijas process bija saistīts ar ietilpīgām kalkulācijām. Tāpēc Mandelbrots varēja pārņemt pētījumu stafeti no Fato un Džulias tikai septiņdesmitajos gados, kad bija pieejami pietiekami jaudīgi datori. Otrs svarīgs faktors šo pētījumu attīstībai bija datoru iespēja parādīt iterācijas rezultātus vizuāli kā grafiskus attēlus uz displeja. Tādējādi Mandelbrots varēja garlaicīgās analītis­kās metodes un to ierobežotās iespējas aizstāt ar vizualizētiem rezultātu attēliem. Tas atbilda viņa matemātiskajam credo\ «redzēt nozīmē ticēt» {«to see is to believe»). Šī paradigma radīja jauno vizuālo fraktāļu ģeometriju, kas kļuva par bāzi vispārinātai haosa teorijai.

Sākumformula, ar kuras palīdzību iegūst Džulias un vēl daudz komplicētā­kos Mandelbrota tīklus, ir fantastiski vienkārša:

x . =f{x) =x2+ c (10)

n+1 J v tv n T l > v '

kur x ir komplekss mainīgais, ar kuru veic n iterācijas, bet c ir konstants para­metrs — komplekss skaitlis, kas satur reālo un imagināro dalu ([136], 8. lpp.)- Neviens līdz Džuliam un Mandelbrotam pat iedomāties nevarēja, kādu maģisku skaistuma pasauli atvērs iterācijas procedūra šīs supervienkāršās formulas ietvaros!

Formulas (10) iterācijas procedūru veic šādi: skaitli xQ kāpina kvadrātā un tam pieskaita komplekso parametru c. Tā iegūst skaitli Xj. Šo pašu procedūru atkārto ar Xy lai iegūtu x2 , un tā tālāk līdz bezgalībai vai praktiski līdz vēla­majai n vērtībai.

Lai izprastu lietas būtību, aplūkosim visvienkāršāko gadījumu, kad kon­stante c = 0 ([136], 9. lpp.). Kāpinot kvadrātā skaitli xQ , pēc katras iterācijas iegūstam rindu xQ —> Xq —> … Atkarībā no xQ vērtības šai rindai ir divi atraktori. Ja |xj< 1, atraktors ir nulle, bet, ja |xj> 1, atraktors ir bezgalība. Robežgadījums veidojas pie |xj = 1. Tad skaitļu rinda izvietojas uz robežlīni­jas starp abu atraktoru iedarbības sfērām, un tas ir aplis ar rādiusu 1 apkārt nulles vērtībai. Uz šīs robežlīnijas abu atraktoru «pievilkšanās spēki» sav­starpēji kompensējas, un šajā konkurences saspēlē skaitļi uz apļa ir it kā sav­dabīgā «bezsvara» stāvokli. Šis ir interesants piemērs, kā abstraktie atraktori darbojas «tīrās» matemātikas sfērā. Tātad pie konstantes vērtības c = 0 līdz­svara robeža ir vienkārši aplis un viss norit Eiklīda ģeometrijas ietvaros.

Situācija radikāli izmainās, ja cž0, bet ir, piemēram, c= -0,12375 + 0,56508/. Arī šajā gadījumā x() —> x2 —> … ir izvēle starp trim iepriekš minētajām

iespējām. Tikai šajā gadījumā «iekšējais» atraktors vairs nav nulle un robežlīnija vairs nav gluda. Tā kļūst par sakrokotu līkloču līniju bez samanāmām regula­ritātes iezīmēm, līdzīgu dabas fraktāļiem —jūras krasta līkloču līnijai. Un gluži kā jūras krasta līnijai ari šai matemātiskajai robežlīnijai parādās autosimilaritātes jeb pašlīdzlbas efekts. Aplūkojot iegūto robežlīniju palie­linājumā, redzams, ka šis līnijas struktūras motīvi pašlīdzīgi atkārtojas mazākā mērogā, t. i., tiem piemīt mēroga invariance. Citiem vārdiem, robežlīnija veido haotisku struktūru. Šādas robežas modernajā matemātikā ir pazīstamas kā Džulias tīkli. No klasiskās matemātikas viedokļa tas ir kaut kas neiedomā­jams, ka skaitļu pasaulē un ģeometrijā var būt ari haotiskas struktūras. Tas bija pretmets pitagoriskajai un eiklīdiskajai paradigmai par harmoniju un kār­tību skaitļu un ģeometrijas pasaulē.

Gastona Džulias un Pjēra Fato patiesi fascinējošie darbi palika nezināmi pat matemātiku vidū, tāpēc ka bez datora vizualizētajiem attēliem nebija iespējams parādīt šo delikāto pētījumu rezultātus. Tikai redzot «in vivo» šis maģiskās fraktāļu vīzijas uz displeja, bija pilnībā iespējams novērtēt to nozīmību un saprast jauno Mandelbrota fraktāļu ģeometrijas paradigmu.

Darbojoties datoru un programmatūras kompānijas IBM laboratorijā ar moderniem datoriem, Mandelbrots varēja veikt lielu iterāciju skaitu ar dažādām kompleksā parametra vērtībām. Tā viņš astoņdesmitajos gados atklāja vis­iespaidīgāko fraktāļu «monstru», kas pazīstams ar Mandelbrota tīkla (Mandelbrot set) nosaukumu. Mandelbrota tīklu uzskata par viskomplicētāko matemātisko objektu, kāds jebkad «redzēts». Un tai pašā laikā, kā redzams pēc formulas (10), tas izriet no visvienkāršākajiem vienādojumiem.

Tipisks Mandelbrota tīkls, kas iegūts, iterējot formulu (10) pie dažādām kompleksā parametra c vērtībām, mainot šā parametra reālās sastāvdaļas vērtības robežās —2,4 < Re(c) < 0,8 un imaginārās sastāvdaļas robežās —1,2 < Im(c) <1,2 [136], parādīts 116. attēlā 278. lpp.

Pie ikvienas izvēlētās parametra c vērtības veidojas noteiktas struktūras Džulias tīkls. Tādā kārtā Mandelbrota tīkls faktiski ir superpozīcija no dau­dziem Džulias tīkliem. Attēlā parādīti 12 izvēlēti Džulias tīkli, kas iegūti pēc noteiktām parametra c vērtībām. Ar skaitļiem no 1 līdz 12 atzīmētas vietas, kurās Mandelbrota tīklā «iebūvēti» atbilstošie «subordinētie» Džulias tīkli.

Mandelbrota tīkla izteikti komplicētās robežlīnijas, kā saprotams, veidojas deterministiskā haosa režīmā. Pārsteidzošākais ir tas, ka vienkāršā sākumfor- mula (10) šķiet pilnīgi determinēta. Taču tā savā klēpī nes daudzveidīgu polimorfu haosu.

Krāsains datora veidotais zīmējums («kompjūtera vīzija»), kas iegūts, auto- similāri palielinot melnbaltajā attēlā iezīmēto taisnstūri, ievērojamā palielinā­jumā parādīts 117. attēlā 6. pielikumā.

Jaunās fraktāļu ģeometrijas maestro un viņu adepti jūsmo par fraktāļu vīziju fascinējošo skaistumu. Vācu matemātiķi Peitgens un Rihters savai sais­tošajai, lieliski ilustrētajai grāmatai devuši nosaukumu «Fraktāļu skaistums. Kompleksu dinamisku sistēmu attēli» {«The Beauty ofFractals. Images of Complex Dynamic Systems», [136]). Šajā grāmatā ievietota Gerta Eilenbergera eseja «Brīvība, zinātne un estētika» {«Freedom, Science, andAesthetics»). Esejas autors izcel estētisko apsvērumu lomu jaunu zinātnes modeļu un paradigmu tapšanā. Šai kontekstā viņš salīdzina klasiskās analītiskās matemātikas paradigmu ar auksto un strikto gotisko stilu, bet jauno vizuālo fraktāļu ģeometriju — ar baroku. (Atgādināsim, ka adjektīvs «barocļue» tika lietots, lai apzīmētu kaut ko iregulāru, dīvainu vai ekscentrisku [140].) Pēc Eilenbergera domām, fraktāļu «vīzijas» dod jaunu, padziļinātu ieskatu matemātikas un fizikas pamatprincipu izpratnē un ir lielākais atklājums zinātnē kopš kvantu mehānikas rašanās pirms 60 gadiem. Viņš domā, ka fraktāļu ģeometrija neapšaubāmi revolu­cionizēs zinātnes priekšstatus par pasaules uzbūvi. Šādam vērtējumam var visā pilnībā piekrist.

Tomēr konservatīvākie analītiskās matemātikas apoloģēti bija citādās domās par Mandelbrota tīkla fraktāļu skaistumu. Viņi joprojām tos uzskatīja par neglītiem monstriem, sava veida matemātiskiem bastardiem, kam nebūtu vietas «tīrasinīgā» matemātiskā sabiedrībā. Tas vēlreiz parāda, cik bīstami ir nesaskatīt

116. att. Mandelbrota tikls, kas veidojas no Džulias tīkliem. Attēlā parādīti 12 Džulias tīkli, kas iekļaujas kā sastāvdaļas kompleksajā Mandelbrota tīklā [136],

Lielās Patiesības komplementāros pretmetus un dogmatiski turēties pie «vienī­gās» patiesības.

Iesvaidītiem Lielo Patiesību meklējumu takās, mums nebūs grūti pamanīt, ka vizualizētā fraktāļu ģeometrija ir komplementārais pretmets analītiskajai matemātikai un ka tās abas faktiski ir vēl plašākas cilvēka pasaules izziņas meto­dikas komponenti. Vēl plašāki pretmeti ir vizuālais un analītiskais domāšanas veids, kas saistīts gan ar izzinātāja subjektīvajām īpatnībām, gan ar kultūras tradīcijām. Pie šīs interesantās gnozeoloģiskās problēmas vēl atgriezīsimies.

Rūpīgāk aplūkojot Mandelbrota tīkla centrālo figūru (117. att. 6. piel.), domas par tās skaistumu tiešām var dalīties. Šis tēls var asociēties ar kādu spu­rainu, daudzkājainu insektu, kas tad nu arī simbolizētu haosu, kļūdams par tā ikonu. Bet šis daudzveidīgais, polimorfais Mandelbrota tīkls satur vēl citas sastāvdaļas, kas patiesi ir bezgala skaistas. 118. attēlā (6. piel.) redzams dīvains krāteris, kas liecina par simetrijas elementu klātbūtni vispārējā tīkla haotiskajā struktūrā. Un visiespaidīgākais — šis dīvainais krāteris imitē telpisku dziļumu zīmējuma plaknē! Simboliski tas ir tunelis uz bezgalību un neapšaubāmi izraisa filozofiskas pārdomas. Mēs izjūtam mistiski iracionālu bezgalības pieskārienu.

Te saskaras racionālais ar iracionālo, simetrija ar asimetriju, sakārtotība ar haosu — elementi, kas raksturo pār pasauli valdošo deterministisko haosu.

Interesanti, ka šīs fraktāļu «vīzijas» var izomorfi transformēt fraktāļu «mūzikā» ([136], 11. lpp.). Mainot formulas (10) parametru, atbilstoši mainās «muzikālās» frāzes, un, ieejot haosa režīmā, iegūstam kaut ko līdzīgu rozā vai brūnajai mūzikai (82. att. 227. lpp), kas raksturīga deterministiskajam haosam. Kā apgalvo Peitgens un Rihters [136], akustiskais efekts varot būt pat iespaiciīgāks par vizuālo.

Aplūkosim vēl vienu interesantu Mandelbrota ģeometrijas fraktāli. Arī to iegūst iterācijas ce(ā no supervienkāršas analītiskas izteiksmes:

f{z) = Xz{\ -z), (11)

kur z ir mainīgais, ar kuru veic n iterācijas, bet X ir kompleksais parametrs un f(z) ir fraktāļa «ģenerācijas funkcija».

Iterācijas procedūrā vispirms iegūst f2 (z) = flf(z)) pie noteiktas parametra X vērtības, tad f^(z) = f{f2 (z)) = /{/{/{z))), un tā tālāk— ad infinitum.

Izvēloties komplekso parametru A, = 1,64 + 96/ un veicot 25 iterācijas, iegūstam 119. attēlā (6. piel.) redzamo daudzgalvaino, daudzkrāsaino pūķi. Šis fraktāļu pūķis jau imitē īstu mākslas darbu un, manuprāt, simbolizē gan Austrumus vispār, gan specifiski Austrumu estētikai raksturīgos asimetrijas principus. Visapbrīnojamākais tomēr ir tas, kā tik vienkāršās formulās kā izteiksme (10) un (11) ir «iekapsulētas» daudzveidīgās polimorfās fraktāļu formas, kuras tās spēj «ģenerēt». Tas patiesi līdzinās skulptora kaltam, ar kuru var izcirst visdažādākos tēlus, vai mūrnieka ķellei, ko lieto, lai uzceltu katedrāles.

Filozofiski sakrālā atkāpē varam secināt, ka Radītājam varēja pietikt ar nelielu skaitu šādu vispārinātu formulu, lai radītu to bezgalīgo formu daudzveidību, kuras sastopamas dabas fraktāļu ģeometrijā. Datorizētā fraktāļu ģeometrija spēj ne vien iegūt visdažādākās mākslīgās fraktāļu vīzijas, bet arī imitēt dabas fraktāļu ainas. 120. attēlā (7. piel.) redzam «fraktāļu» zemeslodi ar pasaules okeānā dreifējošiem kontinentiem. Kā zina vērtēt ģeologi, šādi kontinentu dreifi raksturīgi Zemes ģeoloģiskajai vēsturei simtiem miljonu gadu ilgajā evo­lūcijā. Zīmējumā skaidri saskatāma kontinentu un krasta līniju fraktālā struk­tūra un tikpat košs pavadonis. Tāpat uz datora displeja var vizualizēt kalnu fraktālās struktūras (121. att. 7- piel.)

76. SIMBOLU VIZUĀLAIS SKAISTUMS

Bet vai tikai vizuāli skatāmas formas var būt skaistas? Vai arī simbolu valodā rakstītām analītiskām formulām un vienādojumiem nepiemīt savs iekšējās struktūras skaistums un pašiem simboliem — tīri vizuāla pievilcība?

Dabaszinātniekam priekšstats par kādas formulas vai vienādojuma iekšējo slēpto skaistumu var būt saistīts ar tā plašo lietojuma diapazonu dabas parā­dību aprakstā, saglabājot izteiksmes vienkāršību. Šāds dievišķs skaistums piemīt jaunu zinātnes paradigmu iedibinātajām visuniversālākajām, bet reizē maksimāli vienkāršajām dabas procesu apraksta formulām. Tādas ir formulas (1)—(5). Arī fraktāļu vīziju «ģenerēšanas» formulām (10) un (11) to vienkāršība piešķir iekšēju skaistumu. Tās ir kā kūniņas, no kurām izšķiļas brīnišķīgi krāsaini tauriņi.

Fiziķi īpaši apjūsmo Maksvela vienādojumu skaistumu. Marejs Gells-Manns plašam lasitāju lokam domātajā autobiogrāfisko eseju grāmatā «Kvarks un jaguārs. Piedzīvojumi vienkāršajā un sarežģītajā» {«The Quark and Jaguar. Adventures in the Simple and Complex», [52], 83. lpp.) parāda Maksvela vienā­dojumus, nevis lai analizētu to fizikālo būtību, bet ilustrācijai, cik efektīgi var aprakstīt kompleksas dabas parādības ar vienkāršām, universālām matemātis­kām izteiksmēm. Un tieši šai apstāklī izpaužas šo vienādojumu skaistums.

Lai arī šie vienādojumi ir sarežģītāki nekā Lielo Paradigmu formulas (1)—(5), to vienreizējība izpaužas universalitātē. Ar matemātiskām izteiksmēm, kas satur tikai nedaudzas rindas, var aprakstīt pilnīgi visas elektromagnētiskās parādības Visumā (sk. vienādojumus a, b, c 122. attēlā 282. lpp.). Bet būtiska ir vēl cita Maksvela teorijas iezīme, kas to raksturo kā universālu teoriju, proti, ar Maksvela vienādojumiem var ne vien aprakstīt viņa laikā jau pazīstamos Ampēra un Faradeja elektriskos un magnētiskos eksperimentus, bet arī iekļaut kopējā elektrisko un magnētisko parādību shēmā redzamās gaismas viļņus kā elektro­magnētiskas svārstības un paredzēt vēl citu iespējamo elektromagnētisko svārstību eksistenci. Tās eksperimentāli atklāja vēlāk — gan elektromag­nētisko svārstību spektra garo viļņu galā (infrasarkanā gaisma, radioviļņi), gan īsāko viļņu diapazonā (ultravioletā gaisma, Rentgena stari, y-radiācija). Tas 19. gs. bija Maksvela teorijas triumfs. Pēc tam, 20. gs., triumfēja kvantu mehānika un kvantu elektrodinamika, kas apraksta elektromagnētiskā lauka mijiedarbību ar vielu.

Maksvela vienādojumi parādīti trijās dažādās pierakstu formās: a — vektoriālajā formā, kā to parasti izklāsta mūsdienu elek- trodinamikas mācību grāmatās; b — parciā­lo diferenciālvienādojumu formā, kā tos izveda Maksvels; c — viskompaktākajā re- latīvistiskajā pierakstā, kurā apvienoti a pieraksta pirmais un ceturtais vienādojums un otrais vienādojums ar trešo (122. att.).

Kā redzams, vienus un tos pašus dabas likumus var aprakstīt ar dažāda tipa un dažādas simbolikas izteiksmēm, bet nav grūti parādīt, ka visas izteiksmes ir identas. Katrai no tām ir savas priekšrocības un savi trūkumi.

122. att. Maksvela vienādojumi, kas apraksta visas elektromagnētiskās parādības Visumā: a — vienādo- jumu pieraksts mūsdienīgā vekto­riālā formā; b — Maksvela laika sākotnējais vienādojumu pieraksts parciālo diferenciālvienādojumu forma; c — viskonspektīvākais vienādojumu pieraksts relatīvistiskā formā [52].

Vispazīstamākais un skaistākais ir pir­matnējais (b) Maksvela vienādojumu pie­raksts. Tajā uzskatāmi redzami simetrijas elementi, kas atspoguļo dabas elektromag­nētisko parādību iekšējo simetriju. Vekto­riālais pieraksts (a) ir kompaktāks un ērtāks praktiskam lietojumam. Relatīvistiskais pieraksts (c) ir vienkāršībā vislakoniskākais, bet uztverams tikai augsta ranga teorēti­ķiem.

Gravitācijas likums ir universāls dabas likums. To pirmais, kā zināms, formulēja Ņūtons, un tas ietverts vienādojumā (9). Visvispārinātākā veidā to formulēja Ein- šteins. Arī Einšteina vispārīgās relativitātes universālais gravitācijas likums, kas darbojas visur kosmosā, ir lakoniski vienkāršs un skaists ([52], 87. lpp.):

G Hv = 87Ī ^V ■

Vienādojuma kreisās puses loceklis ap­raksta relatīvistisko telpas un laika liekumu (ko nosaka gravitācijas lauka lielums), bet labās puses locekļi — enerģijas blīvumu, t. i., vielu un citus laukus bez gravitācijas lauka.

Jāatzīst, ka šīs izskatā tik vienkāršās formulas izcelsmes vēsture būtiski atšķirīga no tā, kā «dzima» Einšteina slavenā formula E = mc (3), kas aprak­sta universālo masas un enerģijas ekvivalences principu (sk. 15. eseju), vai kā tika atklāts Ņūtona gravitācijas likums (9).

Ņūtons gravitācijas likumu atklāja intuitīvas iedvesmas brīdi, viesojoties vecāku mājās Vulsthorpā, Linkolnširā, 23 gadu vecumā (sk. 82.2. eseju). Redzot no ābeles krītošu ābolu, viņš tīri intuitīvi secināja, kā līdzīgā kārtā ari iVlēness krīt uz Zemi, un bez jebkāda izveduma uzrakstīja vispārināto Ņūtona gravitācijas likuma formulu (9). Tas bija izteikti intuitīvs spriedums uz analo­ģijas pamata, tas bija radies nevis formāli analītiskās loģikas, bet gan asociatīvi tēlainās domāšanas ietvaros (sk. 86. eseju).

Līdzīgi ģeniālas atklāsmes brīdī Einšteins 1912. gadā postulēja leģendāro masas un enerģijas ekvivalences principu (3). Kā redzams no Einšteina manu­skripta fragmenta (34. att. 75. lpp.), viņš drosmīgi atmeta nevajadzīgos un mazsvarīgos lielumus, atstājot tikai visnozīmīgāko sakarību: E=mc~ (3), kas vēlāk kļuva par mūsu gadsimta jaunās paradigmas stūrakmeni.

Pavisam citāda izcelsme ir Einšteina vispārīgās relativitātes universālajam gravitācijas likumam. Šis «vienkāršās» formulas (12) izvedums prasīja vairāk nekā septiņus intensīva darba gadus, soli pa solim izejot caur loti komplicē­tiem starpvienādojumiem. Ilustrācijai 123.rf un Ł attēlos parādīti Einšteina rokraksta fragmenti ar sarežģītiem starpizvedumiem, kas publicēti izcilā vjet­namiešu izcelsmes kosmologa Thuana Trinha Huana saistošajā grāmatā «Mainīgais Universs» {«The Changing Universe», [188]).

Pat neiedziļinoties šo komplicēto vienādojumu fizikālajā būtībā, varam prie­cāties par Einšteina domas vizualizētās simbolikas kaligrāfisko skaistumu. Kos- mologs Huans šos unikālos rokraksta fragmentus komentē šādi [188]: «Univer­sālās gravitācijas teoriju Alberts Einšteins publicēja 1915. gadā; viņš to nosauca par vispārīgās relativitātes teoriju. Kā Ņūtona fizikas vispārinājums šī ārkārtīgi komplicētā matemātiskā teorija tiek uzskatīta par vienu no elegantākajām cilvēka prāta konstrukcijām. Einšteina fizikā gravitācija nav spēks, kas iedarbojas no attāluma. Mēness nenovirzās no eliptiskās orbītas tāpēc, ka tā trajektoriju nosaka telpas liekums, ko veido Zemes gravitācijas lauks. Mūsdienās pierādīts, ka vispārīgā relativitātes teorija visadekvātāk apraksta gravitācijas procesus Visumā.»

Iespējams, ka, tieši strādājot pie šā titāniskā darba, Einšteins formulēja credo par savu attieksmi pret Dievu: «Es gribu zināt, kā Dievs radīja Visumu. Es gribu zināt Viņa domas. Viss pārējais ir tikai detaļas.» [166, 188]

Arī Stlvens Hokings uzskata, ka, radot universālās kosmosu skaidrojošās teorijas, mēs būtībā tikai izzinām Dieva domas [64].

Elektromagnētiskās un gravitācijas mijiedarbības ir divas no četrām funda­mentālajām Visuma mijiedarbības formām, un tās apraksta norādītās relatīvi vienkāršās, bet reizē universālās formulas.

123. (i dtt. Fragments no Einšteina rokraksta — da|a no sarežģītajiem starpvienādojumiem, kuru rezultāta tika iegūta vienkāršā vispārīgās relativitātes Visuma universālā gravitācijas likuma formula (12) [188).

123. b att.

Divas pārējās fundamentālās mijiedarbības formas darbojas atomu kodolu un elementārdaļiņu fizikas jomā, un to apraksts ir matemātiski ļoti komplicēts [52], Tam pamatā ir superstīgu modelis un M-teorija, par ko īsi stāstīts 35. esejā «Mikropasaules «stigu orķestris»».

Vācu rakstnieks Tomass Manns grāmatā «Doktors Fausts» [112] apcer interesantu, nedaudz paradoksālu problēmu par mūzikas pieraksta (par­titūras) vizuāli estētisko izpausmi. Apskatot kāda komponista partitūras lapu, mēs uztveram nošu pieraksta īpatnējo kopainu — kompozīcijas «audumu» (pattern), kas veido it kā muzikālā sacerējuma metastruktūru. Katram mūzi­kas stilam, katram individuālam komponistam partitūras kopskata, kom­pozīcijas «auduma» metastruktūra ir atšķirīga. Atskaņojot mūziku, mēs šo «audumu» it kā šķetinām šķiedru pa šķiedrai. Bet interesanti ir ari vienlaicīgi uztvert visa muzikālā auduma kopskatu! Tā, sekojot Tomasa Manna idejai, var salīdzināt, piemēram, Baha, Mocarta, Šēnberga un Keidža partitūru lap­puses (83.-86. att. 230.-235. lpp.). Redzams, cik atšķirīgi ir šie muzikālie «audumi», un, uztverot tos tiri vizuāli, var gūt īpašu emocionāli estētisku baudu. Te ir analoģija ar ķiniešu un japāņu hieroglifu kaligrāfiju. Hieroglifa rakstu var uztvert ari estētiski kā mākslasdarbu, nesaprotot uzrakstītā saturu. Japānas muzejos ir kaligrāfijas zāles, kurās hieroglifu teksti tiek pasniegti kā mākslasdarbi (31. att. 2. piel.).

Estētisko kritēriju loma modernajā zinātnē, izvērtējot dažādus intelek­tuālus modeļus, apcerēta 3. esejā. Sarežģītu dabas parādību aprakstam nepie­tiek ar Aristoteļa patiesības definīciju, jo sastopamies ar intelektuālo modeļu daudzveidību. Jāsaprot, ka intelektuāli vienmēr var izveidot vairākus hipotē­tiskus modeļus, kas vienlīdz labi izskaidro empīriski novērotos faktus. Šādā gadījumā, kā uzsvēris viens no pasaules izcilākajiem teorētiķiem angļu fiziķis Pols Diraks [37], kritērijs var būt tikai modeļa estētiskais novērtējums. Skaistā­kais būs modelis, kas būs loģiski vienkāršāks un arī vienkāršāk aprakstāms matemātiskā formālisma ietvaros. Tas attiecas gan uz heliocentrisko paradigmu (sk. 3. eseju), gan uz aprakstītajiem Maksvela un Einšteina vienādojumiem.

Līdzīgus uzskatus pauž ari ievērojamais elementārdaļiņu speciālists ameri­kāņu fiziķis Gells-Manns [52].

Sai kontekstā mērķtiecīgi atcerēties ari DNS dubultspirāles atklāšanas vēs­turi. Autobiogrāfiskajā esejā «Dubultspirāle» {«The Double Helix»), [198]) viens no atklājuma autoriem Džeimss Votsons atceras, ka DNS struktūras meklējumos viņu vienmēr vadījusi ideja, ka Daba mēdz izvēlēties skaistāko risinājuma variantu. Tas bija ciešākā pakojuma princips un DNS bāzu kom- plementaritāte, veidojot asimetrisko dubultspirāles struktūru. Un DNS dubultspirāle (14. att. 47. lpp.) patiesi ir viens no skaistākajiem (un infor­matīvi saturīgākajiem) Dabas veidojumiem! Tā redzam, ka mūsdienu zinātnē komplementāri saplūst Skaistā un Patiesā kategorijas.

Kā raksta grāmatas «Fraktāļu skaistums» {«The Beauty of Fractals») autori Peitgens un Rihters ([136], 4. lpp.), matemātiķi un it īpaši fiziķi parasti domā tēlos, vizuāli. Vēl vairāk — viņi estētiskas kategorijas izmanto kā kritērijus vismaz pilnībai {completenesš), ja ne patiesībai. Viens no izcilākajiem vācu izcelsmes matemātiķiem Hermans Veils atzīst: «Savā darbā es vienmēr esmu mēģinājis apvienot patieso ar skaisto, un, ja man jāizvēlas viens vai otrs, es parasti izvēlos skaisto.»

Par tēlainās domāšanas īpašo lomu zinātniskajos atklājumos runāsim plašāk 83. un 86.4. esejā.

77. KOMPLEMENTARITĀTES PRINCIPS UN KVANTU FIZIKA LAIKMETU GRIEŽOS

77.1. Nilsa Bora filozofiskie uzskati

Neviena no mūsu gadsimta fizikālajām un filozofiskajām koncepcijām nav izraisījusi tik dzīvas diskusijas un kontraversijas kā komplementaritātes prin­cips un nenoteiktības relācija un no šim koncepcijām izrietošā kvantu fizikas statistiskā interpretācija kā pretmets Ņūtona determinismam. So problēmu dažkārt sauc ari par kvantu dilemmu, kaut gan tās nozīmība tālu pārsniedz kvantu fizikas robežas un to pamatoti var uzskatīt par vienu no mūsdienu centrālajām problēmām uz dabaszinātņu sasniegumiem balstītajā filozofijā.

Kvantu dilemmas vēsture šā jēdziena šaurākajā izpratnē detalizēti aplūkota nesen publicētajā Belfāstas universitātes fizika Endrjū Vaitekera plašajā mono­grāfijā «Einšteins, Bors un kvantu dilemma» («Einstein, Bohr and the Quantum Dilemma», [201]). Bora un Einšteina disputs sākās 1927. gada novembri Solveja kongresā Briselē, kur pulcējās visas pasaules vadošie atomfiziķi (8. att. 1. piel.). Tur Nilss Bors pirmo reizi plašākai zinātnieku auditorijai izklāstīja Heizenberga nenoteiktības relācijas fizikālo būtību un tās vispārinājumu kā komplementaritātes principu. No šā brīža sākās abu gadsimta dižāko gara titānu vairāk neka desmit gadus ilgā diskusija, no kuras kā pārliecinošs uzvarētājs izgāja Nilss Bors [52, 201]. Šis zinātniskais strīds pārsniedza profesionālās fizikas ietvarus, jo tas skāra vairākus filozofijas pamatpostulātus.

Tieši komplementaritātes principa ne tikai fizikālais, bet ari filozofiskais aspekts bija diskusijas uzmanības centrā. Bors uzsvēra domu, ka «rezultātus {evidence}, ko iegūst pie atšķirīgiem nosacījumiem, nevar aprakstīt tikai viena skatpunkta ietvaros. Tie jāapraksta kā komplementāri, jo tikai globāls kopskats ietver pilnu informāciju par pētāmajiem objektiem.» Bors uzskatīja, ka mikropasaules parādības nevar izskaidrot tikai Ņūtona determinisma ietvaros, kā to vēlējās Einšteins. Būtībā līdz ar komplementaritātes principu Bors aizstāvēja filozofiskā holisma pozīcijas (sk. 84. eseju), kuras jau sengrieķu filo­zofijā vispārīgā veidā bija formulējis Aristotelis. Proti, ka veselais ir būtiskāks par tā daļām ([201], 179. lpp.).

Kvantu fizikā visnozīmīgākā ir viļņa un daļiņas kā pretmetu komplementa- ritāte (sk. 14. eseju un 35. att. 78. lpp.). Bet plašākā nozīmē tas ir jautājums par nepārtrauktā un diskrētā komplementaritāti, kas ilgi šķita nesavienojami gan fizikā (gaismas viļņu un korpuskulārās teorijas pretmeti), gan matemātikā, gan — konceptuālā aspektā — arī filozofijā.

Iepazinies ar senķīniešu Dao filozofijas pamatnostādnēm un jan un iņ pret­metu simbolikas saturu, Nilss Bors bija spiests konstatēt (tāpat kā Leibnics attiecībā uz bināro skaitīšanas sistēmu), ka komplementaritātes princips jau bijis pazīstams pirms vairāk nekā 2000 gadiem! Varbūt tieši tas Boru mudināja meklēt plašāku komplementaritātes principa lietojumu citās dabas un humani­tāro zinātņu jomās. Šī doma vistiešāko izpausmi radusi Bora filozofiskajā esejā «Atomfizika un cilvēka zināšanas» («Atomic Physics and Human Knoivledge» [12]).

Bors uzskatīja, ka komplementaritāte var būt epistemoloģisks modelis visās cilvēces izziņas sfērās — visupirms bioloģijā, psiholoģijā un sociālajā antropo­loģijā ([201], 190. lpp.). Viņš noraidīja strikti fizikāli mehānisku skaidrojumu dzīvības procesiem. Bors uzskatīja, ka bioloģiskā evolūcijā fizikāli mehāniskie (kauzālie) un statistiskie procesi darbojas komplementāri ar teleoloģiskiem (mērķtiecības) principiem. Šādu uzskatu apstiprina uz deterministisko haosu balstīta bioloģiskā morfoģenēze (sk. 65. eseju). Dīvainie atraktori un, iespē­jams, kāds metaatraktors darbojas kā uz attīstības mērķi virzītājs dzinējspēks (sk. 70. eseju). Bērza vai priedes iedīgļa attīstības galamērķis ir sasniegt pieau­guša un morfoģenētiski nobeigta attiecīgās sugas koka veidu, uz to virza atbil­stošie dīvainie atraktori. Tāpat apaugļotas cilvēka olšūnas morfogēnās attīs­tības galamērķis ir nobriedis, fiziski un garīgi pilnvērtīgs homo sapiens pār­stāvis. Kā asprātīgi teicis kāds no kvantu fizikas ekspertiem, varbūtība, ka šādas sarežģītas formas varētu izveidoties tīri stohastisku procesu rezultātā, līdzinās varbūtībai, ka, apšaudot ar ložmetēju klints bluķi, būtu iespējams laika gaitā iegūt Milosas Venēras tēlu.

Bora izpratnē dzīvības fizikāli mehāniskais un teleoloģiskais apraksts papil­dina viens otru kā komplementārās Lielās Patiesības. Jāuzskata, ka dzīvības eksistences fakts bioloģijā ir analogs kvantu postulātam atomfizikā. Tas ir tikpat fundamentāls kā akcijas kvants h, kuru nevar atvasināt no klasiskās mehānis­kās fizikas.

Tāpat kā determinisms (kauzalitāte) un indeterminisms (nenoteiktība) ir savstarpēji papildinošu principu pāris visās dabas parādībās, tā indivīda brīvā griba un determinisms (liktenis) ir jāpieņem kā komplementārs pāris cilvēka psihē. Bors uzskatīja, ka domas un emocijas ir komplementāri stāvokli cilvēka psihiskajās norisēs. Bora pareģojums par komplementaritātes koncepcijas iespējamiem izpausmes veidiem bioloģijā apstiprinājies molekulārajā bioloģijā kā svarīgāko molekulāro sistēmu struktūras komplementaritāte. Tā DNS dubultspirāles atklājums 1953. gadā parādīja, ka šī stabilā, bioloģiski tik nozī­mīgā ģenētiskās informācijas ierakstu pārnesēja makromolekula veidojas tās uzbūves «ķieģelīšu» — DNS bāzu struktūras komplementaritātes rezultātā (14. att. 47. lpp. un 61. att. 154. lpp.). DNS dubultspirāle neapšaubāmi ir visskaistākā un arī stabilākā bioloģiskā makromolekula dzīvajā dabā. Tāpat dzīvo organismu metabolisma dinamikā visnozīmīgākais komplekss ferments + substrāts un imūnbiologiskais komplekss anūgēns + antiviela veidojas šo pāru struktūras komplementaritātes rezultātā. Šo kompleksu struktūras komple- mentaritāti var metaforiski salīdzināt ar rokas un cimda atbilstību.

77.2. Volfgangs Pauli ka fiziķis un filozofs

No visiem kvantu fizikas pamatlicējiem šveicietis Volfgangs Pauli (sk. 1. ta­bulu 31. lpp. un 124. att. 7. piel.), šķiet, visdziļāk izprata jaunās kvantu para­digmas un komplementaritātes saikni ar citām cilvēces gara aktivitāšu sfērām, it īpaši ar filozofiju, psiholoģiju un reliģiju. Nilss Bors par šīm problēmām pa­matā izteica tikai vispārīgus apsvērumus [12], bet Volfgangs Pauli tās pētīja un apcerēja jau profesionālā līmenī. Šai jomā viņam bija arī labāka sagatavotība. Jaunībā viņš ieguva labu klasisko izglītību, prata grieķu un latīņu valodu un lasīja antīkos autorus oriģinālā. Viņš labi orientējās humanitārajā sfērā — psi­holoģijā un tradicionālajā filozofijā. Volfgangu Pauli it īpaši interesēja ideju vēsture un reliģijas problēmas.

Tai pašā laikā daudzi uzskatīja Pauli par matemātikas un jaunās fizikas brīnumbērnu. Deviņpadsmit gadu vecumā 1919. gadā viņam uzticēja rakstīt enciklopēdijai par relativitātes teoriju. Šo uzdevumu Pauli izpildīja vairāk nekā spoži. Pats Einšteins šim pārskatam devis visaugstāko novērtējumu. Kāds asprātis tika teicis, ka relativitātes teoriju patiešām saprotot tikai divi cilvēki pasaulē: pats Alberts Einšteins un jaunais ģēnijs Volfgangs Pauli.

Tomēr Pauli, par sarūgtinājumu Einšteinam, neturpināja darboties relativi­tātes teorijas jomā, bet visu turpmāko radošo mūžu veltīja kvantu fizikai. Dzīves pēdējā gadu desmitā viņš pievērsās filozofijai, it īpaši jaunās kvantu paradigmas filozofiskajiem aspektiem, kā arī vispārīgajai ideju (paradigmu) vēsturei. Priekš­laicīgā nāve nedeva Pauli iespēju apkopot filozofiskās atziņas monogrāfijā. Tās galvenokārt saglabājušās Volfganga Pauli sarakstē ar kolēģi un domubiedru, Bāze- Ies universitātes teorētiskās fizikas profesoru Markusu Fīrcu. Vēstules apkopojis un līdz ar tulkojumu angļu valodā un komentāriem izdevis somu fiziķis Laurikai- nens [103]. Tādējādi tikai 30 gadus pēc Volfganga Pauli nāves plašākai sabiedrī­bai tika dota iespēja iepazīties ar viņa oriģinālajām un fascinējošajām filozofiska­jām domām. Agrākie periodikā publicētie Pauli darbi nesen apkopoti grāmatā «Raksti par fiziku un filozofiju» {«Writings on Physics andPhylosophy», [135]).

Volfganga Pauli domu centrālā tēma ir Bora komplementaritātes princips, kas kā vadmotīvs caurauž visas publikācijas un vēstules [103, 135].

Ar psiholoģiju saistitās atziņas, pie kurām Pauli nonāca sadarbibā ar švei­ciešu psihiatru, analītiskās (dzīļu) psiholoģijas pamatlicēju Kārlu Gustavu Jungu (126. att. 7. piel.), publicētas kopējā darbā «Dabas skaidrojums un psihe» («Naturklarung undPsyche») 1952. gadā [135].

Volfgangs Pauli bija šķietami pretrunīga personība. Viņš bija izcils analīti­ķis ar enciklopēdiskām zināšanām modernajā fizikā, taču lieliski pārvaldīja arī matemātisko formālismu. Uzskata, ka Pauli bijis viens no kvantu fizikas pamatlicēju spožākajiem teorētiķiem. Fizikas vēsturē viņš iegājis kā viena no nozīmīgākajiem mikropasaules likumiem — Pauli principa— atklājējs. Par to viņš saņēma Nobela prēmiju. Kolēģi Pauli dēvēja par «fizikas sirdsapziņu», un ikviens pirms nozīmīgāka darba publicēšanas vēlējās dzirdēt viņa komentārus un kritiku. Pauli lieliski prata atšķirt svarīgo no maznozīmīgā, būtisko no otršķirīgām detaļām [103]. Tā bija Volfganga Pauli personības racionālā puse. Taču viņš uzskatīja, ka pasaulē bez racionālā eksistē arī iracionālais, ko nevar izzināt ar deduktīvo domāšanu, bet tikai aptvert ar intuīciju un atklāsmi. Viņš bija reliģiozs, ar noslieci uz misticismu. Jaunībā katolis, bet vēlāk, palikdams dziļi reliģiozs, sarāva saites ar oficiālo baznīcu. Pauli bija pārliecināts, ka materiālā un garīgā pasaule ir patstāvīgas un savstarpēji komplementāras. Līdzīgi savam tuvākajam draugam psihologam Karlam Gustavam Jungām, Pauli ticēja, ka eksistē dievišķā Anima Mundi, Pasaules Dvēsele. Un šī bija Volf­ganga Pauli personības iracionālā puse. Tātad jau savā būtībā — gan kā per­sonība, gan ar pasaules uzskatu — Pauli bija dzīvs komplementaritātes principa iemiesojums.

Arī pašā Pauli personībā bija kaut kas mistisks. Fiziku vidū cirkulēja daudzi nostāsti par tā saukto «Pauli efektu». Ja viņš apmeklēja kādu fizikas laborato­riju, tad eksperiments, kuru viņam gribēja demonstrēt, noteikti neizdevās. Lai arī šajos nostāstos dominē humoristiskais elements, daudzi fiziķi tam svēti ticēja. Tā tuvs Pauli draugs, ievērojamais fiziķis Oto Šterns, nekad viņam neļāva apmeklēt savu laboratoriju [103].

Pauli dziļi ticēja skaitļu mistikai. Šai sakarībā viņu īpaši saistīja pirmskaitlis 137. Šis skaitlis parādās kā nozīmīga mikropasaules konstante atomu spektru sikstruktūras teorijā, un tas redzams vairākās dabas konstantēs: ch!2n e , kur c ir gaismas ātrums vakuumā, h— Planka konstante unf— elektrona elemen- tārlādiņš. Pauli bija pārliecināts, ka šai maģiskajai konstantei ir būtiska nozīme, ka tā sasaista elektromagnētismu, relativitātes un kvantu teoriju.

1958. gada decembri lekcijas laikā Cīrihes Tehniskajā universitātē Pauli uznāca pēkšņa neizturamu sāpju lēkme, un ātrās palīdzības mašīna viņu steig­šus nogādāja Sarkanā Krusta slimnīcā. Viņu ievietoja tieši 137. istabā. Kad Pauli asistents Encs apmeklēja slimnīcā savu skolotāju, pirmais jautājums bija, vai viņš ievērojis istabas numuru. Vai Pauli nojauta, ka šī skaitļa mistērija drīz tiks viņam atklāta [103]? Pēc desmit dienām Pauli bija miris.

Tieši skaitļu mistērija saistīja Pauli pitagoriešu filozofijā. Šo filozofisko skolu radīja sengrieķu matemātiķis Pitagors, pazīstamās Pitagora teorēmas autors, kas dzīvoja aptuveni 570—500 gadus pirms Kristus dzimšanas.

Pitagorieši uzskatīja, ka Visuma pamatus veido veselie skaitļi, tie nosaka pasaules harmonisko uzbūvi līdzīgi harmonijas likumiem mūzikā. Kā Pauli rakstījis kādā vēstulē ([103], 96., 210. lpp.), pitagorieši cieši saistīja skaitļu matemātiku (un tātad arī mūziku!) ar kontemplatīvo meditāciju (starp citu, meditācija ir grieķu vārda «theoria» sākotnējā nozīme). Pitagoriešu mācībā īpaši nozīmīgs bija skaitlis četri.

Četri kā simbolisks skaitlis cieši saistīts ar kvadrātu un krustu [69], kā arī ar antīko doktrīnu par četriem Pasaules pamatelementiem Zemi, Ūdeni, Gaisu un Uguni— to sengrieķu filozofijā ieviesa Empedokls [103]. Šī koncepcija būtībā at­bilst mūsdienu dabaszinātņu atziņām par vielas četriem agregātstāvokļiem: cietu, šķidru, gāzveida un plazmu. (Piektais iedomātais elements — ēters, Ņūtona mehānikas «garabērns», — izrādījās fikcija, ko atspēkoja Einšteina relativitātes teorija un Maikelsona—Morlija eksperimenti.)

Tetraktija (tetraktys) — četrkārtība — ir četru mazāko veselo skaitļu summa: 1+2 + 3 + 4=10. Tāpēc tetraktiju ģeometriski attēlo trīsstūrskait- lis 10 (125. att.). Pitagoriešiem tas ir svēts skait­lis, kas simbolizē pilnību. Tetraktijas personifikā­cija ir harmoniskais Dievs [69]. Skaitlis četri arī simbolizē vienību starp Debesīm un Zemi. Tet­raktijas telpiskais ģeometriskais analogs ir tetra­edrs — visvienkāršākais no visiem poliedriem [103]. Turklāt skaitlis četri simbolizē arī tais­nību. Tāpēc tas ir zvēresta kodols. Pitagoriešu sakrālais zvērests skan: « Viņš, kurš iedēstīja mūsu dvēselē skaitli četri, kas ir avots un saknes mūžīgi plūstošai radīšanai.»

Šo pitagoriešu zvērestu Arturs Šopenhauers izvēlējās par moto savā nozīmīgajā darbā «Par teikuma četrkāršajām saknēm, balstoties uz pietiekošā pamata principu» «(Ūber die vierfache Wurzeldes Satzes vom zureihenden Grunde», «The Fourfold Root of the Principle of Sufficient Reason», [103], 129. lpp.).

X XX XXX

xxxx

125. att. Tetraktijas — četrkārtības simbolisks attēls. Sa­skaņā ar pitagoriešu princi­piem, tetraktiju ģeometriski at­tēlo trīsstūrskaitlis 10, ko veido četru mazāko veselo skaitļu summa: 1 + 2 + 3 + 4= 10. Pitagoriešiem tas ir svēts skaitlis un simbolizē pilnību. Kā parā­dījis Pauli [103], tetraktija jeb četrkārtība vai — latinizētā ter­minoloģijā — kvaternitāte veido kvantu fizikas filozofisko bāzi.

Pauli parāda [103], ka tiešā tetraktija, četrkārtība vai — latinizētā termino­loģijā — kvaternitāte veido kvantu fizikas filozofisko bāzi. Sadarbībā ar

Markusu Fīrcu Pauli attīsta tālāk Bora komplementaritātes principu, pilnvei­dojot to par kvaternitāti (četrkārtību). Pauli to formulēja vēstulē Fīrcam 1951. gada 3. oktobrī (sk. [103], 129. un 211. lpp.). Viņš uzsver, ka fizikā kvater- nitāti veido divu fundamentālo pretmetu pāri:

1)    kompensējošo pretmetu pāris, ko klasiskajā fizikā pārstāv, piemēram, pozitīvais un negatīvais lādiņš (+, —);

2)    komplementāro pretmetu pāris, ko ieviesa kvantu fizika, piemēram, daļiņas koordinātas un impulss p) vai enerģija un laiks (E, t), un ko saista nenoteiktības relācijas izteiksmes (4) un (5) (77. un 78. lpp.).

Kompensējošo pretmetu pāru mijiedarbību var aprakstīt deterministiskā mehānisma ietvaros, bet komplementārais pāris prasa statistisko indetermi- nismu, varbūtības un nenoteiktības principus. Pirmo — klasisko pretmetu pāri var pilnīgi izprast racionālas domas ietvaros, bet kvantu fizikas pretmetu pāris ienes iracionālisma elementus pat tik eksaktā zinātnē kā fizika.

Pauli aplūko ari analogus pretmetu pārus psiholoģijā. Kā kompensējošie pret­meti var būt labais un ļaunais, bet kā komplementārie pretmeti — zinātniskais un ārpuszinātniskais. Vai — citiem vārdiem — racionālais un iracionālais, kas visplašākajā filozofiskajā kontekstā atbilst daoiskajam pretmetu pārim jan un iņ.

77.3. TrinitārAs un kvaternitArās domāšanas formas

Klasiskās dabaszinātnes (un ari uz tīro racionālismu balstītā filozofija) pazina tikai kompensējošos (+,-) pretpolus un tādējādi pēc būtības palika tipiski trinitāras domāšanas ietvaros. Te, pirmkārt, jāmin mehāniskā deter- minisma pamadicēji Keplers, Ņūtons un Laplass, tad — filozofiskā racionālisma iedibinātājs Dekarts un, protams, Hēgelis, kura pazīstamā kategoriju triāde — tēze, antitēze un sintēze — ir visraksturīgākais racionāli trinitārās domāšanas piemērs. Kvaternitārā pasaules izpratne raksturīga, kā jau minējām, pitagorie- šiem un vēlāk neoplatonikiem [103].

Kvaternitārās iezīmes parādās Kanta četru filozofisko pamatkategoriju tabulā: kvantitāte, kvalitāte, attiecības (relatlvisms) un modalitāte. Pirmās divas kategori­jas Kants nodēvēja par matemātiskām, otras divas — par dinamiskām. Un, lai gan modalitātes kategorijā parādās tādi jēdzieni kā iespējamība un nepiecieša­mība, Kants — atbilstoši sava laikmeta paradigmai — bija stingrs mehāniskā determinisma aizstāvis. Tomēr viņa filozofijā parādās arī iracionāls komponents. Tā ir racionālam prātam nepieejamā lietu sevī{Dinge an sich) pasaule [103, 84, 85].

Kanta sekotāji Fihte un Hēgelis noārdīja trauslo sienu starp racionāli izzi­nāmo un neizdibināmo «Dinge an sich» pasauli un, tādējādi izslēdzot «ceturto», atkal atgriezās trinitāras domāšanas žņaugos, no jauna paceļot racionālo domā­šanu uz visvarenības pjedestāla.

Vēl skaidrākā formā nekā Kantam kvaternitāte iezīmējas Šopenhauera domāšanā. Tāpat kā Kants, viņš postulē četras filozofiskās pamatkategorijas, un viena no tām — «rīcības motīvi» — Šopenhaueru šķietami tuvina indeter- minisma un iracionālisma pozīcijām. Tomēr Šopenhaueram pirmā un nozīmīgākā ir kantiskā kauzalitātes kategorija. Līdzīgi Kantam, viņš ievēro kauzalitātes principa deterministisko interpretāciju. Tā «motīvi», kas indivī­dam šķiet esam viņa brīvā griba, ir faktiski determinēti kā «Pasaules Gribas» izpausmes forma [103]. Kā Austrumu filozofijas cienītājs Šopenhauers tuvojās iracionālās pasaules robežlīnijai, bet šo robežu nešķērsoja.

Būtu nepiedienīgi vainot pirmskvantu un pirmsgēdela Rietumu dabas­zinātniekus un filozofus par pārspīlēti vienpusīgu racionālās domāšanas glori- fikāciju un nespēju ieiet neparastajā kvaternitārajā pasaulē, jo Rietumos tikai 20. gadsimta jaunā paradigma nostiprināja Lielo Patiesību pretmetus — determinismu un indeterminismu, racionālismu un iracionālismu — kā vienas «monētas» pretējo pušu komplementārus pārus, kā arī parādīja deduktīvās domāšanas un tās radīto sistēmu nepilnību un aprobežotību. Blakus deduktī­vajai domāšanai līdztiesību ieguva tās pretmets — intuitīvā domāšana. Šajos apstākļos tradicionālā filozofija ir zaudējusi savu nozīmību. Daudzas tipiski gnozeoloģiskas sfēras, kuras līdz pat 20. gs. metafiziskā filozofija monopolizēja un mēģināja risināt ar prātniecisku ekvilibristiku, tagad ir kļuvušas par eksakto zinātņu izpētes objektiem. Tas attiecas gan uz tādām būtiskām pasaules parādī­bām kā laiks un telpa, viela un fizikālie lauki, vakuums un haoss, gan uz tādām fundamentālām kategorijām kā nepieciešamība un gadījums, determinisms un indeterminisms, vienkāršais un saliktais, diskrētais un nepārtrauktais.

77.4. Kanta tīra prata antinomijas

un modernā kosmoloģija

Kants šīs fundamentālās kategorijas un to pretmetus uzskata par tīrā prāta antinomijām [84]. Pēc viņa domām, tās ir dialektiskas pretrunas, «ko parastajā dogmatiskajā ceļā nekad nevar novērst, jo tiklab tēzi, kā antitēzi var pierādīt ar vienādi skaidri saprotamiem un neatspēkojamiem pierādījumiem .. prāts tātad redz, ka viņā pašā ir radusies nesaskaņa, — par šādu stāvokli priecājas skep­tiķis, bet kritiskajā filozofā tas katrā ziņā modina pārdomas un nemieru» ([84], 99. lpp.). Turpat tālāk, darba «Prolegomeni» skaidrojumos, Kants atzīst tīrā prāta ierobežojumus un nepilnību, kā arī iespējamos stohastiskos maldu ceļus: «Metafizikā var sarunāt visādus niekus, nebaidoties, ka pieķers melos. Jo, ja vien nerunājam paši sev pretim, kas visai iespējams sintētiskos, kaut arī pilnīgi izdomātos nolikumos, tad visos tais gadijumos, kad jēdzieni, ko mēs saistām, ir tikai idejas, kas (pēc visa sava satura) nemaz nevar tikt dotas pieredzē, pieredze mūs nekad nevar atspēkot. Tiešām, kā mēs varam izdibināt ar piere­dzi: vai pasaule pastāv mūžīgi; vai tai ir sākums; vai matērija ir dalāma līdz bez­galībai; vai tā sastāv no vienkāršām daļiņām? (E. I. Šiliņa izcēlums — Red.) Šādi jēdzieni nevar būt doti nevienā, pat ne visplašākajā pieredzē; ar šo raudzes akmeni tātad nevar atklāt apgalvojošā vai noliedzošā nolikuma nepareizību.» ([84], 99. lpp.)

Kaut ari Kants laikam gan bija viens no visu laiku kritiskākajiem domātā­jiem, tīrā prāta loģika viņu noveda strupceļā un maldīgos secinājumos. Mo­dernā kosmoloģija un vispārīgā relativitātes teorija pārliecinoši pierāda, ka pasaulei ir sākums laikā un Visuma telpa ir ierobežota (sk. 37. eseju). Līdzīgi 20. gadsimta modernās zinātnes nozares elementārdaļiņu teorija un sinerģē- tika parādija, ka fundamentālās pretmetu kategorijas — saliktais un vienkār­šais, diskrētais un nepārtrauktais, gadījums un nepieciešamība, determinisms un indeterminisms — nebūt nav tikai tīrā prāta antinomijas, bet ir reālā pasaulē komplementāri eksistējošas Lielās Patiesības. Tādā kārtā mūsu gad­simta eksaktās zinātnes veiksmīgi aizstāj iepriekšējo gadsimtu tradicionālo Rietumu metafizisko filozofiju. Mūsdienu filozofija nevar palikt tikai racionālo spriedumu jomā, tai jāsaskaras ari ar esamības iracionālo pusi. Šādām prasī­bām, manuprāt, vistuvāk pienākusi Martina Heidegera filozofija, kas vienlai­cīgi postulē arī vecās klasiskās filozofijas galu.

No šim peripetijām vairāk nekā divtūkstoš gadu laikā veiksmīgi izvairījušies Austrumu filozofi. Sekojot Dao iedibinātajam iņ un jan komplementaritātes principam, Austrumu filozofija vienmēr ir bijusi kvaternitāra, aptverot Lielo Patiesību abas puses. Šai aspektā Nilsa Bora uz paradoksu loģikas principiem dibinātā kvantu fizika savā garīgajā struktūrā ir radniecīga orientālajām filo­zofijām. Tā neizveidoja noslēgtu jēdzienu un koncepciju sistēmu — kā, piemēram, Ņūtona mehānika, Maksvela elektrodinamika vai klasiskā termo­dinamika —, bet palika atvērta turpmākai evolūcijai.

77.5. Kvantu fizikas Prinstonas interpretācija

Jau II Pasaules kara priekšvakarā Getingenes, Kopenhāgenas un Kembridžas vietā par pasaules atomfizikas centru kļuva Prinstonas Padziļināto pētijumu institūts (Institute for Advanced Studies) ASV. Tur pulcējās visas pasaules spožākie prāti — gan matemātiķi, gan atomfiziki un kosmologi, daudzi kā emigranti no totalitārajam režimam pakļautajām Eiropas zemēm. Tur līdzās strādāja abi izcilākie gara titāni, gadsimta jauno paradigmu iedibinātāji Alberts Einšteins un Kurts Gēdels. Pastāvīgi viesi tur bija gan kembridžietis Pols Diraks, gan emigrants kopenhāgenietis Nilss Bors. Un atcerēsimies, ka nevis Kopenhāgenā, bet tieši Prinstonā tika uzcelts piemineklis Nilsam Boram kā komplementaritātes principa atklājējam (3. att. 15. lpp.). Kvantu fizikas Kopen­hāgenas interpretācija, ko izveidoja filozofiski ievirzītais trio Bors, Heizenbergs un Pauli (sk. 1. tabulu 31. lpp.), tika papildināta ar koncepcijām, kuras pazīstamas kā Prinstonas interpretācija [201]. Par tās autoriem uzskata Prinstonas institūtā strādājošos ungāru izcelsmes emigrantus Džonu fon Neimanu un Eiženu Vīg- neru, kā arī vispusīgo un talantīgo amerikāņu teorētiķi Džonu Arčibaldu Vīleru.

Džonu fon Neimanu pamatoti uzskata par vienu no izcilākajiem gadsimta matemātiķiem. Viņš atstājis paliekošu ieguldījumu datorzinātnē un izstrādājis ekonomikā tik nozīmīgo spēļu teoriju. Bet mūs vairāk interesē Neimana iegul­dījums kvantu mehānikas matemātisko pamatu izveidē: Kopenhāgenas kvantu fizikas statistiskā interpretācija bija vairāk konceptuālas un epistemoloģiskas iedabas, bet Neimans tai izstrādāja striktus matemātiskus un aksiomātiskus pamatus. Viņa fundamentālais darbs kvantu fizikas teorijā vispirms tika publi­cēts 1932. gadā vācu valodā. ŠI slavenā grāmata angļu valodā gan iznāca krietni vēlāk — 1955. gadā, tikai divus gadus pirms autora pāragrās nāves. Nosau­kums « Kvantu mehānikas matemātiskie pamati» («Mathematical Foundations of Quantum Mechanics» [128]) precīzi atspoguļo tās saturu. Kvantu mehānikas statistiskās interpretācijas pretinieki — pirmām kārtām Alberts Einšteins — pieļāva domu, ka statistiskā indeterminisma koncepcija varētu būt virspusēja un zem tās varētu atrasties strikti determinēti t. s. «slēptie mainīgie» (hidden variables), kas tiešā pieredzē neparādās.

Taču Neimans savā fundamentālajā darbā parādīja, ka kvantu mehānikas iet­varos šādi «slēptie mainīgie» nav iespējami un mikropasaules statistiskais inde- terminisms, kas izriet no nenoteiktības relācijas un komplementaritātes principa, ir ne vien konceptuāli, bet arī strikti matemātiski korekts un adekvāts. Neimana traktējumu var nosaukt par mikropasaules gnozeoloģisko interpretāciju ([201], 197. lpp ). Tas jāizprot tā, ka kvantu mehāniskā vi|ņu funkcija, kas apraksta mikrodaļiņas varbūtējo stāvokli, nereprezentē fizikālo realitāti, bet mūsu zināša­nas par šo fizikālo realitāti. Šāds traktējums atspoguļo nenoteiktības relācijas dziļāko būtību, proti, ka subjekts novērotājs nevar fiksēt novērojamā objekta — mikrodaļiņas — stāvokli, to neietekmēdams pašā novērošanas vai mērīšanas pro­cesā. No šā viedokļa subjekts un objekts ir savstarpēji sasaistīti, korelēti — kā dīvainās cilpas metafora Eshera «Zimējošajās rokās» (48. att. 2. piel.).

Šī jaunā, no kvantu fizikas izrietošā filozofiskā paradigma būtiski satricinā­ja kā klasiskās fizikas, tā ari metafiziskās filozofijas pamatnostādnes. Līdz tam uzskatīja, ka pati par sevi saprotama ir subjekta un objekta savstarpējā neatka­rība, iespēja tos strikti atšķirt vienu no otra; tā bija dekartiskā duālisma pamat- aksioma. 19. gs. materiālisma vai Spinozas determinisma tradīcijās tendētiem prātiem paradigmu maiņu bija grūti pieņemt.

Kvantu mehānikas Kopenhāgenas interpretācija, kā norāda Marejs Gells— Manns [52], bija savā būtībā antropocentriska un šauri specifiska, jo aprakstīja situāciju, kas veidojas, fiziķiem eksperimentāli pētot mikrodaļiņu uzvedību. Mēģinot paplašināt šo interpretāciju, bija vajadzīgs kāds hipotētisks, abstrakts «ego» kā subjektīvais mikropasaules «novērotājs». Radikālu soli šai virzienā spēra otrs ungāru izcelsmes prinstonietis Eižens Vigners, pasaules klases teorē­tiķis, kas 1963. gadā saņēma Nobela balvu par oriģināliem simetrijas principu izmantošanas veidiem fundamentālu fizikālu problēmu risinājumos. Vīgners secināja, ka universālā nenoteiktības jeb indeterminisma principa kosmiskai interpretācijai nepieciešams pieņemt hipotēzi par Visuma Saprāta (Conscious- ness or Mind) eksistenci [201]. Filozofiski tā būtu jāizprot kā Gara un Matē­rijas komplementāra koeksistence un savstarpēja mijiedarbība. Šā mūsdienu fizikā un kosmoloģijā plaši izplatītā pasaules uzskata arhetipisko modeli varētu meklēt Platona un neoplatoniķu filozofiskajās mācībās. Bet varbūt pareizāk būtu to saistīt ar daoisko iņ un jan komplementaritātes modeli (sk. 9. eseju).

Līdz ar Albertu Einšteinu determinisma pozīcijas neveiksmīgi mēģināja aizstāvēt arī francūzis Luijs de Brojī, kas nekādi negribēja akceptēt jau fizikā vis­pārpieņemto viļņu funkcijas statistisko skaidrojumu. Einšteins savos meklēju­mos vienmēr tiecās pēc harmonijas un pilnības, tāpēc viņu neapmierināja kvantu teorijas šķietamā nepilnība un nepabeigtība, kas izpaužas nenoteiktības relācijā t. i., neiespējamībā vienlaicīgi noteikt, piemēram, mikrodaļiņas impulsu (p) un koordinātas {ej). Uz to Bors atbildēja, ka tieši šī «nepilnība» ir nenoteiktības relā­cijas dziļākā būtība, ka tikai abu pretmetu — p un q — komplementaritāte noved pie pilnības un nobeigtības. Tā ir Bora Lielo Patiesību aksioma.

Līdzīgi apslēpto mantu meklētājiem, ik pa laikam atradās kāds entuziasts, kas mēģināja atrast Einšteina iedomātos «apslēptos mainīgos», kuri ļautu no jauna iegrožot mikropasauli determinisma rāmjos. Viens no tādiem bija kvantu fiziķis Deivids Boms, kas lielu dzīves daļu veltīja šo «apslēpto mainīgo» mek­lējumiem. Kā atceras Marejs Gells-Manns ([50], 170. lpp.), viņš 1951. gadā Prinstonas institūtā ticies ar Deividu Bomu. Boms viņam stāstījis, ka, būdams pārliecināts marksists, viņš nekādi nevarot pieņemt kvantu mehānikas indeter- minismu, jo marksisti ticēja, ka ne vien materiālā pasaule, bet ari sabiedrība ir pakļauta stingri determinētiem likumiem (sk. 80. eseju). Jāuzsver, ka Einšteina un Boma noraidošā attieksme pret kvantu mehānikas statistisko interpretāciju atšķīrās ar diametrāli pretēju argumentāciju. Kā jau redzējām, Einšteins neva­rēja pieņemt šo statistisko interpretāciju reliģiski ētisku apsvērumu dēļ, viņam šķita nepieņemams Dievs, kas dabas likumus veido stohastiski, «ar spēļu kau­liņu palīdzību». Turpetim Boma kriticisms sakņojās ideoloģijā, aklā ticībā marksisma dogmām. Vēlāk Deivids Boms uzrakstīja mācību grāmatu kvantu mehānikā, kurā atsevišķas nodaļas tika īpaši veltītas «slēpto mainīgo» hipotēzei un mēģinājumiem kvantu fiziku reducēt uz deterministiskiem pamatiem.

Boms bija pārliecināts, ka Einšteinu iepriecinās pūles teorētiski apstiprināt viņa kriticisma pareizību. Tomēr, Bomam par šokējošu pārsteigumu, Einšteins personīgā sarunā norādīja, ka Boma argumentācija nav pietiekami pamatota un vinu nepārliecina ([52], 170. lpp.). Vēl asāk reaģēja vienmēr kritiskais Volf­gangs Pauli, kas Boma darbu nosauca par «mākslīgu metafiziku» [201],

Loti interesanta nianse Einšteina vērtējumā atrodama piecdesmitajos gados Bornam adresētajā vēstulē: «Vai esat dzirdējis, ka Boms (tāpat kā de Broji pirms 25 gadiem) tic, ka viņš spēs kvantu teoriju interpretēt determinisma iet­varos? Man šāda pieeja šķiet pārāk lēta.» [14] Vēlāk Borns ar izbrīnu komentē šo vēstuli [14], jo Boma teorija saskanēja ar paša Einšteina agrāk paustajiem uzskatiem. Vai gara milzis mūža nogalē beidzot būtu atzinis savu kļūdu?

Interesanta ir paša Deivida Boma uzskatu metamorfoze. Mūža nogalē viņš atsakās no marksisma un pievēršas orientālajai filozofijai, kļūstot par indiešu filozofa Krišnamurti sekotāju. Savos pēdējos darbos Boms aizstāvējis orien­tālajai filozofijai tik raksturīgo holisma ideju, uztverot norises pasaulē kā dinamisku mijiedarbību tiklu ([21], 65. lpp ). Tā bija acīmredzama atteikša­nās no ilgi aizstāvētās determinisma paradigmas.

Par deterministisko «slēpto mainīgo» meklētāju uzskatāms ari angļu izcel­smes teorētiķis Džons Bells, kas ilgstoši strādāja Šveicē, CERN teorētiskās fizikas nodaļā. Bellu var raksturot kā kritisku pragmatiķi, ko interesē tikai kvantu teori­jas tīri tehniskās problēmas. Viņš Bora un tā skolnieku un sekotāju filozofiskās nostādnes uzskatīja vienkārši par romantiku. Lai cik kritisks pret Kopenhāgenas un Prinstonas kvantu mehānikas interpretācijām, Bells, neskatoties uz savu «antiromantisko» pragmatismu, bija spiests atzīt, ka Visuma Saprāta koncepcija ieņem centrālo vietu dabas dziļākās realitātes izpratnē ([201], 201. lpp.).

Trešā Prinstonas superzvaigzne Džons Arčibalds Vllers bija pārliecināts Nilsa Bora komplementaritātes principa aizstāvis. Viņa zinātniskais credo visspilgtāk izgaismots Nilsa Bora simtgadei veltītajā rakstā žurnālā «Physics Today» 1985. gadā [200],

Mūsdienās kvantu mehānikas Kopenhāgenas un Prinstonas interpretācijas mēdz dēvēt par ortodoksālām, jo tās aplūko kvantu fizikas principu lietojumu ierobežotā dabas parādību sfērā, proti, mikrodaļiņu uzvedības aprakstā. Modernā zinātne ir parādījusi, ka kvantu fizikas principi darbojas daudz plašākos mēro­gos, ka tie ir universāli un tiem pakļautas visas dabas parādības kā mikro- pasauiē, tā ari makrokosmā, kā nedzīvajā, tā dzīvajā dabā.

77. 6. Kvantu elektrodinamika un hromodinamika. Rjčards Feinmens un Marejs Gells-Manns

Lielisks kvantu fizikas triumfs bija kvantu lauka izpēte un kvantu elektrodi- namikas izveide piecdesmitajos gados. To radīja visaugstākās raudzes gadsimta otrās puses teorētiķu trio — leģendārais Ričards Feinmens, japānis Tomonaga Siničiro un amerikānis Džūlians Švingers (sk. 32. un 33. eseju).

Kvantu elektrodinamika apraksta un izskaidro fizikālā lauka un elementār­daļiņu mijiedarbību, daļiņu rašanos un anihilācijas fizikālā vakuumā. Fritjofs Kapra to metaforiski salīdzina ar indiešu dieva Šivas kosmisko deju (sk. 51. att. 131. lpp.). Taču jāatceras, ka pašlaik kvantu elektrodinamika ir viena no precīzākajām fizikālajām teorijām (sk. 32. eseju).

Sešdesmitajos gados kvantu fizikas iespaida sfēra vēl paplašinājās. Amerikāņu fiziķis Marejs Gells-Manns, zinātnieks ar ģeniālu intuīciju un bagātu iztēli, izveidoja jaunu avangardisku kvantu fizikas nozari — kvantu hromodinamiku (sk. 34. eseju). Tās rašanās saistījās ar jaunu elementārdaļiņu — «krāsaino» kvarku atklāšanu, no kuriem veidojas «baltie» nukloni: protoni un neitroni (53. att. 133. lpp.). Šie sasniegumi parādija, ka kvantu fizikas principi darbojas ne vien atomu un molekulu līmenī, bet ari kodolu un elementārdaļiņu proce­sos, nosakot kodolspēku veidošanos. Kā uzsvēris Marejs Gells—Manns ([52], 123. lpp.), dabas fundamentālie likumi balstās uz kvantu mehānikas pamat­principiem — nenoteiktības relācijas un komplementaritātes principu. Ikvienā pasaules izzināšanas stadijā ir jāizmanto kvantu fizikas metodiskās pieejas.

77.7. Kvantu astrofizika. StIvens Hokings

Pēc Gella-Manna nostādnes Visums ir kvantu universs, kam raksturīga gan vienkāršība (simplicity), gan statistiskā nenoteiktība (randomness) [52]. Visspilgtāk to apliecina pēdējo gadu desmitu sasniegumi zinātnē. Kvantu fizi­kas principu universalitāti apstiprina tās veiksmīgā izmantošana gan mikro- pasaulē — elementārdaļiņu teorijā, superstlgu mode|a izveidē un vienotā lauka teorijas izstrādēs (sk. 35. eseju), gan makropasaulē, skaidrojot kosmosa uzbūves un evolūcijas principus. Tā kvantu kosmoloģijas iedibinātājs, par leģendu kļuvušais angļu astrofiziķis un kosmologs Stīvens Hokings uzskata (sk. 36. eseju), ka Heizenberga—Bora kvantu nenoteiktības principa izman­tošana astrofizikā ievērojami paplašina šā principa universalitāti, padarot to par Visuma visnozīmīgāko principu [66], Tieši nenoteiktības principa lieto­jums deva Hokingam iespēju parādīt, ka arī melnais caurums ir nedaudz caur­spīdīgs, to apvij gaismēnas oreols (55. att. 2. piel.).

Tālāk attīstot kvantu kosmoloģiju, Hokings ieviesa Visuma viļņu funkciju (the Wave Function ofthe Universe). Šis pieejas svarīgākais secinājums ir, ka šāda funkcija apraksta ne vien Visuma pašreizējo stāvokli, bet — saskaņā ar kvantu fizikas statistisko dabu — arī universa evolūcijas alternatīvās vēstures ([52], 138. lpp.). Tādā kārtā Lielā Sprādziena {Big Banģ) scenārijā varēja būt dažādas varbūtības.

Pašreiz pieņemtais scenārijs (57. att. 3. piel.), kura rezultātā radās dzīvības un cilvēka attīstībai piemēroti apstākli, ir tikai viens no daudziem iespējamiem

Visuma vēstures variantiem. Svarīgi, ka gan elementārdaļiņu teorijā, gan kos­moloģijā vienlaicīgi jāizmanto abas gadsimta visnozīmīgākās un visuniver­sālākās teorijas: kvantu fizika un vispārīgā relativitātes teorija. Tās abas papil­dina viena otru, tātad ir pēc savas būtības komplementāras. Katra atsevišķi dod tikai vienu no Lielo universālo Patiesību pusēm. Marejs Gells—Manns uzskata, ka kvantu fizikas atklāšana un izveidošana ir visaugstākais cilvēces radošā gara sasniegums [52], No pat iedīgļiem gadsimta sākumā, no kvantu teorijas pat­riarhiem Planka, Einšteina un Bora līdz mūsdienu kvantu fizikai — līdz Feinmenam, Gellam-Mannam un Hokingam — to radījuši visģeniālākie prāti. Šodien daudzi no viņiem apbalvoti ar Nobela prēmiju — ap piecpadsmit teorētiķu un vismaz pusducis eksperimentatoru, kuru pētījumi tieši vai netieši apstiprināja kvantu fizikas teoriju pareizību. Bet — lai cik paradoksāli tas izklausītos — kvantu fizikas komplementāro pusi, vispārīgo relativitātes teoriju, septiņu gadu laikā (1908-1915) izstrādāja viens vienīgs, bet izcili ģeniāls cilvēks Alberts Einšteins.

Tas, ka viņš visā turpmākajā dzīvē negribēja atzīt universālās Lielās Patie­sības otro, papildinošo pusi — kvantu fiziku—, varbūt jāuzskata par šā super- ģēnija vislielāko traģēdiju. Tieši tāpēc, kā parāda Gells-Manns ([52], 126. lpp.), Einšteina lielais sapnis radīt vienotu lauka teoriju, kas aprakstītu itin visas Visuma parādības, visus četrus universālās mijiedarbības spēkus, cieta galigu fiasko. Albertam Einšteinam atšķirībā no Nilsa Bora nebija pieņemami para­doksi un paradoksu loģika, nebija pieņemams «tīram racionālam prātam» grūti izprotamais, šķietami pretrunīgais un iracionālais Lielo Patiesību likums.

78. DIALEKTISKĀ PRETSTATU CĪ^A — EIROPAS

RACIONĀLISMA GARABĒRNS

78. 1. Komplementaritātes un dialektikas

modeļu būtiskā atšķirība

Orientālais jan un iņ pretmetu modelis, tāpat kā no tā izrietošais Nilsa Bora postulētais komplementaritātes princips, precīzi definē abus pretmetus veidojošo jēdzienu vai kategoriju ekvivalenci. Šie pretmeti harmoniski papil­dina viens otru kā divas pilnīgi līdzvērtīgas Lielo Patiesību puses. Tas izriet gan tieši no Bora Lielo Patiesību definīcijas, gan no komplementaritātes prin­cipa filozofiski vizualizētā jan un iņ simbola (1. att. 14. lpp.) vai tā mūsdienīgā varianta Eshera grafikā «Diena un Nakts» (9. att. 1. piel.).

Kardināli pretēja nostādne ir Rietumu racionālā prāta izauklētajai dialek­tiskajai filozofijai. Dialektikas būtību izsaka tagad jau par stereotipu kļuvusī definīcija: «Pretstatu vienība un cīņa nosaka dabas un sabiedrības attīstību.» Šā filozofiskā modeļa aizsākumus ierasts meklēt sengrieķu domātāja Heraklīta darbos, un tā apogeju saskata Hēgeļa noslēgtajā filozofiskajā sistēmā.

Dialektiskā modeļa būtiskākā iezīme ir tā, ka pretstati netiek uzskatīti par ekivalentiem, savstarpēji papildinošiem. Gluži pretēji — tie tiek uztverti kā antagonistiski, savstarpēji izslēdzoši. To vienība ir tikai īslaicīgs līdzsvara stāvoklis, par dominējošo attīstības elementu tiek uzskatīta pretstatu cīņa. Arī pretstatu pārī viens no elementiem ir dominējošais, kas cīņā tiecas pakļaut otru. Šādā asimetriskā modeli viena no pretmetu Lielajām Patiesībām tiek atzīta par «patiesāku» nekā otra, un tas neizbēgami noved pie «vienīgās» īstenās patiesības doktrinācijas. Šis strupceļš ir tipisks Rietumu tradicionālajai racionā­lisma filozofijai no senajiem grieķiem līdz pat jauno laiku izcilākajiem domā­tājiem. Atšķirībā no Austrumu gudrajiem, kas patiesības meklējumos netiecās veidot nobeigtas un noslēgtas filozofiskas sistēmas un doktrīnas, Rietumu domātāji itin bieži iekrīt «vienīgo», absolūto patiesību slazdos, noliedzot savu amatbrāļu postulētās citas «vienīgās» patiesības, un, izmantodami diskursīvās loģikas ekvilibristiku, būvē noslēgtas filozofiskās sistēmas līdzīgi gotikas vai baroka katedrālēm. Bet filozofiskai domai Patiesibas meklējumos jābūt atvēr­tai, gatavai pieņemt paradoksus un pretmetu patiesības, atziņu, ka «var būt arī citādi». Šāda pieeja raksturīga orientālajai filozofijai un komplementaritātes principa garā iesvaidītajai mūsdienu zinātnei.

78. 2. Mainīgais un pastavigais sengrieķu filozofijā. Heraklits pret parmenldu

Sengrieķu domātāju Heraklltu (dzīvojis no apm. 544. g. līdz 483. g. pr. Kr.) tradicionāli pieņemts uzskatīt par Rietumu dialektiskās ontoloģijas iedibinātāju. Viņš, šķiet, pirmais formulējis spārnoto domu, ka pasaules attistibas pamatā ir mūžīgā pretrunu sadursme, līdzāspastāvēšana un cīņa [94, 197]: «Karš ir visam tēvs.» Heraklīta nostādnēs jau iezīmējas izteikta vienpu­sīga pretstatu interpretācija. Visa primāts ir uguns, tas ir kosmiskais logoss, pirmais vārds. Uguns pretstatiem — ūdenim vai zemei — ir tikai pakārtota loma [197]. Tāpat pakārtota loma ir pretstatu lldzesamībai, virzošais primāts tiek piedēvēts pretstatu vai pretrunu cīņai. Diemžēl šīs vienpusīgās dialektikas iedīglis, kļūstot par sava veida Rietumu kultūras arhetipu, ir bijis visai notu­rīgs vairāk nekā divdesmit gadsimtu laikā un radījis tādus «vienīgās patiesības» monstrus kā Hēgela un Marksa dialektiskās doktrīnas.

Taču Heraklīta fdozofija, tuvāk iepazīstot, izrādās daudzpusīgāka un daudzšķautņaināka, nekā to attēlo vēlākie dialektikas apoloģēti. Dialektiķi īpaši iemīlējuši viņa filozofisko metaforu, ka cilvēks nevar divreiz iekāpt tai paiā upē, jo vienmēr cits ūdens viņam tecēs garām. Šī metafora simbolizē hera- klītisko ticību mūžīgai kustībai un attīstībai [197]. Bet ir ari cits izteikums, kas Heraklītu tuvina Austrumu filozofijas paradoksu loģikai (sk. 86. 5. eseju): «Mēs iekāpjam un neiekāpjam tai pašā upē; mēs esam un mēs neesam.» ([197], 26. lpp.) Tas vairāk līdzinās Dao un dzenbudistu koanām, arī 20. gadsimta paradigmas nostādnēm nekā uz racionālismu tendētai dialektikai. Ar Aus­trumu filozofiju un mūsdienu moderno kosmoloģiju sasaucas arī Heraklīta doma par pasaules ciklisko attīstību, par tās bojāeju un atjaunošanos.

Jāuzsver, ka Heraklīts nav filozofs racionālists, viņa izziņas spēcīgākie ieroči ir intuīcija, iekšējais skatījums, poētiska iztēle un pat misticisma strāvojums. Heraklīts ir vairāk pravietis nekā prātnieks, vairāk orākuls nekā Sokrātā tipa skolotājs [197] (ne jau velti viņam deva epitetu «tumšais» — nesaprotamais).

Pretstats Heraklītam ir viņa laikabiedrs Parmenīds (6.-5. gs. pr. Kr.), pirmais logiķis un deduktīvās loģikas iedibinātājs pirms Aristoteļa. Viņa filo­zofiskās domas pamatā ir atziņa, ka pasaule ir mūžīga, nemainīga un nepār­ejoša esamība. Lietu kustība un maiņa ir tikai subjektīvās uztveres maldi un šķietamība [94]: «Kā bija sākumā, ir tagad un būs vienmēr.» [197]

Parmenidam nav pieņemama orientālajā filozofijā un ari Heraklīta para­doksā izteiktā doma par esamības un neesamības pretmetu pāri, par to, ka pirmsākumā varētu būt bijis Lielais Tukšums (Great Void). Viņa izpratnē šādi paradoksālie pretmeti ir loģiski pretrunīgi, tāpēc bezjēdzīgi un nevar kļūt par loģiskās domāšanas atribūtiem. Šajā Parmenida argumentācijā iezīmējas svarīgs formālās loģiskās domāšanas princips, ko vēlāk formulē Aristotelis, — nepretrunīguma princips, kas nosaka, ka vienlaikus nevar pastāvēt divi viens otram pretrunīgi spriedumi (sk. 86. 1. eseju). Šī formālās loģikas argumentā­cija ir pamatā vienai no Parmenīda filozofijas pamattēzēm: «Ir Esamība, Neesa­mības nav.» [94, 197]

Taču Austrumu filozofijas sasniegumi uzskatāmi parāda, ka nevis formālā «nepretrunīguma» loģika, bet tieši paradoksu vai koanu loģika ir radošās filo­zofiskās domas galvenā virzītāja (sk. 86. 5. eseju). So paradoksu loģikas stafeti pārņēma 20. gadsimta paradigmu veidotāji. Atcerēsimies Nilsa Bora credo, ka bez paradoksiem nav iespējams domāšanas progress. Tikai uz formālo loģiku balstīta domāšana ir ierobežota, un tai bieži vien pietrūkst jaunrades elementu un attīstības perspektīvas.

Nav grūti saskatīt, ka Heraklīta un Parmenīda filozofija savā būtībā ir jan un iņ tipa pretmetu «dvīņi», ka tās abas reprezentē Lielās Patiesības, jo šo šķietami pretrunīgo filozofiju pamatkategorijas — maiņa un pastāvīgums, dinamiskā kustība un statiskais miera stāvoklis — ir reālā pasaulē eksistējoši, savstarpēji papildinoši komplementāri pāri. Ari Heraklīta intuitīvā un Parme­nīda loģiski analītiskā pieeja ir savstarpēji komplementāras pasaules izziņas metodes. Diemžēl vēlākie ontoloģiskās dialektikas apoloģēti un doktrīnisti dialektikas pirmsākumus saskatīja tikai Heraklīta nostādnēs un Parmenīda ievirzes domātājus uzskatīja par metafizisku maldu mācību sludinātājiem.

Šāda vienpusība nepiemīt orientālajai filozofijai. Mainīgais un pastāvīgais, mainīgais un mūžīgais tiek skatīti kā viena otru papildinošas filozofiskas kate­gorijas. Dzenbudismā šos pretmetus simbolizē zieda un akmens metafora.

78.3. Dialektika ka diskusiju un paradoksu māksla

Antīkajā filozofijā dialektiku uztvēra nevis kā ontoloģisku disciplīnu, bet kā uz dialogiem un dažkārt ari paradoksiem balstītu patiesības izziņas metodi. Jau tīri etimoloģiski grieķu vārds dialektika (dialektike) apzīmē sarunu māk­slu, prasmi loģiskā diskusijā ar jautājumiem un atbildēm izzināt un atklāt patiesību. Šai kontekstā interesanti piebilst, ka Aristotelis par dialektikas atklājēju uzskata Zenonu, 490. g. pr. Kr. dzimušo Parmenīda skolnieku, kas iegājis vēsturē kā izcils paradoksu meistars [197]. Viens no slavenākajiem Zenona paradoksiem ir paradokss par lidojošas bultas miera stāvokli: «Lido­joša bulta atrodas miera stāvokli. Jebkurā momentā tā ieņem telpu, kas tai pašai ir ekvivalenta. Tāpēc tā nevar kustēties.» ([197], 42. lpp.) Šis ir raksturīgs formālās loģikas slēdziens un apstiprina Parmenīda tēzi, ka pasaulē visas lietas ir miera stāvoklī, to kustība ir tikai šķietamība. Šobrīd gan mēs to uztveram kā savdabīgu paradoksu, kura atrisinājumu dod miera stāvokļa un kustības pret­metu komplementaritāte.

Ne mazāk pazīstams ir paradokss par Ahilleju un bruņurupuci: «Ahillejs nekad nevar noķert bruņurupuci. Lai to izdarītu, viņam vispirms jāsasniedz punkts, no kura bruņurupucis sāka skriet, bet pa to laiku bruņurupucis jau būs pavirzījies tālāk; kad Ahillejs būs sasniedzis šo punktu, bruņurupucis būs atkal pavirzījies tālāk, un tā ad infinitum (līdz bezgalībai).» ([197], 42. lpp.) Ari šis Zenona paradokss apstiprina tēzi par pasaules norišu nepārtrauktību. To var uzskatīt par metaforisku arhetipu Ņūtona un Leibnica atklātajiem diferenciālvienādojumiem, kas balstās uz nepārtraukti mainīgu bezgalīgi mazu lielumu robežvērtībām.

Sengrieķu filozofijā atrodami vēl citi interesanti arhetipi. Zenona laika­biedrs, 460. g. pr. Kr. dzimušais Dēmokrits, izstrādā atomistisko pasaules uzbūves modeli: viss pasaulē būvēts no tālāk nedalāmām daļiņām — atomiem, kuru ir bezgalīgi daudz un dažādi. Tādējādi atomistiskais modelis postulē pasau­les diskrētās uzbūves paradigmu kā pretstatu Parmenīda un Zenona nepār­trauktības (kontinuitātes) paradigmai. Un atkal šie šķietami nesavienojamie pretmeti izrādās savstarpēji komplementāri. Tos apvieno modernās kvantu fizikas daļiņas un viļņa komplementārā pāra modelis, kurā simetriski, līdzīgi kž jan un iņ simbolā, savstarpēji viena otru papildina diskrētības (daļiņas) un nepārtrauktības (viļņa) filozofiskās kategorijas (sk. 14. eseju un 35. att. 78. lpp.).

Dialektika kā diskusiju māksla augstāko virsotni sasniedz Sokrātā dialogos [197, 83, 142, 143]. Tajos sastopamas arī domas, kas sasaucas ar Dao un dzenbudisma nostādnēm, piemēram, slēdziens, ka patiesa zināšana izsakāma vārdos: «Es zinu, ka es nezinu.» Sokrātā ģeniālā skolnieka Platona (427.— 347. g. pr. Kr.) nodibinātajā filozofiskajā Akadēmijā bija četras pamatdisciplī- nas: aritmētika, ģeometrija, harmonija un astronomija.

Tomēr šīs zinātnes bija tikai ievads augstākajā zinātnē, ko Platons nosauc par dialektiku — tīrā prāta zinātni, kas loģiski pēta jēdzienu un ideju kopsaka­rības. Šī zinātne, pēc viņa domām, ir vienīgā, kas var vest pie pilnīgas patiesības atziņas ([83], 185. lpp.), turklāt nesagatavotam cilvēkam ar nepietiekami cēlu garu tā ir visai bīstama zinātne, jo var kļūt par tukšu retoriku un novest pie aplamībām, kas stipri kaitē filozofijas labajai slavai. Tāpēc ar šo zinātni nodar­boties cilvēki drīkst tikai pēc rūpīgas atlases [83]. Šie Platona brīdinošie vārdi izrādījās pravietiski.

78. 4. hēgeļa spekulatīva dialektika un panlogisms

Dialektikas kā izziņas metodes nekritiska, spekulatīva un pat ļaunprātīga izmantošana kulmināciju sasniedza vācu filozofa Georga Fridriha Hēgeļa un viņa ekstrēmi kreisā sekotāja Karla Marksa doktriniskajos darbos. Hēgelismu un marksismu pamatoti uzskata par Rietumos pārāk ilgi valdošā racionālisma intelektuālā «grēka» ārlaulības bērniem. Spekulatīvi tika postulētas «vienīgās» un «absolūtās» patiesības, citādi domājošo uzskati tika pasludināti par nezināt­niskiem, maldīgiem un tātad kaitīgiem, apkarojamiem ar visiem iespējamiem līdzekļiem. Tādā kārtā dialektika kļuva par idejisko ieroci varas tehnoloģijai, manipulācijai ar cilvēku prātiem.

Abiem jaunlaiku filozofiem nebūt nepiemita sengrieķu domātājiem rakstu­rīgais gara cēlums. Viņi nebūt nebija pasīvi vērotāji (grieķiski tbedrein — vērot, no tā etimologiski cēlušies vārdi «teorētisks» un «teorija»), kas nododas filozofiskām meditācijām un Patiesības meklējumiem. Tie bija kareivīgi cīnī­tāji par savu «vienīgo» patiesību ar mērķi aktīvi pārveidot pasauli un sabied­rību. Šobrīd šķiet paradoksāli, kā Hēgeļa spekulatīvā filozofija, kas balstās uz ticību cilvēka racionālā prāta visvarenībai un nemaldībai, vispār varēja rasties tikai dažus gadu desmitus pēc Kanta «Tīrā prāta kritikas».

Vācu filozofs Imanuels Kants (1724—1804), neapšaubāmi izcilākais Eiropas domātājs pēc Platona un Aristoteļa, līdzīgi Kopernikam astronomijā revolu- cionarizēja tālāko filozofijas kā zinātnes attīstību. Viņš pirmais kritiski novērtēja tīrā, racionālā prāta izziņas iespēju robežas [84, 85]. Kanta analīze parāda, ka eksistē tādas esamības sfēras, kuras nevar izzināt tikai ar racionālā, diskursīvā prāta slēdzieniem, piemēram, laika un telpas gallguma vai bezgalīguma, brīvības un nepieciešamības, Dieva esamības un citas problēmas. Citiem vārdiem, eksistē «lietas sevi» (Dinge an sich), kas atrodas aiz transcendentālā prāta izziņas iespēju robežām. ŠI Kanta kritiskā pieeja — ka prātam jāapjēdz savas robežas — saskan ar mūsdienu zinātnes un filozofijas nostādnēm, ka pasaulē eksistē racionāli nedefinējams esamības slānis, kam var tuvināties tikai intuitīvi — kā dzejā vai mākslā. Svarīgi, ka savā pieejā Kants būtībā izmanto­jis Lielo Patiesību pretmetu principu. Viņš parāda, ka jauno laiku filozofijā dominējošās skolas — racionālisms (Dekarts) un empīrisms (Bēkons, Loks, Hjūms) — ir vienpusīgas un ka tikai to abu kritiska sintēze paver ceļu prātam pieejamas patiesības izziņai. Šo kantisko pieeju uzskatāmi raksturo viņa ieviesto apriori (uz prāta) un aposteriori (uz pieredzes) veidoto slēdzienu pretmeti, kas būtībā iemieso racionālisma un empīrisma komplementaritāti.

Hēgelis savā postkantiskajā filozofijā no jauna restaurē racionālisma vienpu­sīgo dominanti, nekritiski atjaunojot ticību prāta visvarenībai.

Tīrā racionālisma iedīgļus, kā jau minēts, var saskatīt jau sengrieķu prāt­nieka Parmenīda filozofijā, kas apgalvo, ka «viens un tas pats ir domāt un būt.» ([94], 148. lpp.) Šo idej u gandrīz burtiski atkārto jauno laiku racionālisma filozofijas iedibinātājs Renē Dekarts (1596-1650) tai laikā tik iemīļotajā latiņu mēlē: «Cogito, ergo sum (Domāju, tātad esmu).» ([94], 266. lpp.) Dekartiskie racionālisti prātu izprata kā izzinātāja subjekta — indivīda atribūtu, Hēgela filozofijā savukārt prāts, ko viņš nosauc par garu, tiek traktēts pašā vispārlgā- kajā nozīmē, to piedēvē gan gara, gan materiālajai pasaulei. Šādu filozofisku nostādni — ka prāta loģika visā pilnībā iemiesojusies it visur pasaulē — sauc par panlogismu (grieķu vai. pan — viss, logos— saprāts). Visa Hēgela filozo­fiskā sistēma balstās uz šādu panlogisma garā postulētu aksiomu: «Tas, kas ir saprātīgs, ir īstens, bet tas, kas ir īstens, ir saprātīgs.» ([94], 314. lpp.) Taču Hēgeļa filozofiskajai sistēmai līdzīgi daudzām deduktīvi loģiskām sistēmām piemīt slēpts iekšējs defekts, sava veida Ahilleja papēdis. Gadsimtu pēc Hēgela nāves vācu matemātiķis Kurts Gēdels pierādīja deduktīvo sistēmu nepilnīgitrna teorēmu (sk. 46. eseju), ko nosauca viņa vārdā. Šīs paradigmatiskās teorēmas filozofiskais vispārinājums izsakāms vārdos: «Ikviena deduktīva sistēma ir nepilnīga, jo satur apgalvojumus, kas nav pierādāmi šīs sistēmas ietvaros.» Hēgeļa sistēmā tas ir postulētais apgalvojums, ka viss, kas ir saprātīgs, ir īstens, un otrādi. Šāda apgalvojuma pieņēmums gan ir nevis prāta, bet ticības lieta. Taču — vai viss, kam mēs ticam, ir īstens?

Gēdela teorēmas filozofiskais vispārinājums kļuva fatāls ne vien Hēgeļa, bet ari daudzām citām Rietumu filozofiskās domas izauklētajām racionāli de­duktīvajām sistēmām. Šo sistēmu trūkums ir ne tikai Gēdela uzsvērtais nepil- nīgums, kas tās pārcel no racionālās prāta uz iracionālo ticības sfēru, bet ari tas, ka šādas sistēmas pārsvarā ir noslēgtas resp. nobeigtas un tādējādi izslēdz domas tālāko virzību. Turpretim Austrumu filozofijām raksturīga atvērtība un nepabeigtība, kas rosina tālāko filozofiskās domas virzību. Turklāt Hēge- lim nepiemita ne sengrieķu domātājiem raksturīgais gara cēlums, ne Kanta analītiskais kriticisms. Kā liecina laikabiedri, viņš bijis iedomīgs, godkārīgs un absolūti pārliecināts, ka viņa filozofija ir Eiropas filozofiskās domas augstākais kalngals un pēc viņa nekāda cita filozofija nav iedomājama [145]. Hēgelis ir tipisks «vienīgās» absolūtās patiesības apoloģēts. Viņš nevis meklē, bet zina patiesību.

Hēgeļa spekulatīvajā filozofijā nav vietas racionālam prātam nepieejamai kantiskajai «lietai sevī». Aiz viņa sistēmas ietvariem paliek visa iracionālā esamības sfēra gan gara, gan dabas pasaulē. Hēgeli ļoti trāpīgi raksturojis psihoanalītiķis un filozofs Karls Gustavs Jungs: «Viņš man liekas kā vīrs, kas sevi iesprostojis paša vārdu uzbūvētajā ēkā un pompozi žestikulē šajā cietumā.» ([82], 87. lpp.) Hēgeļa laikabiedrs Arturs Šopenhauers līdzīgā kontekstā atzīst, ka Hēgeļa filo­zofiskajiem darbiem par moto varētu izmantot Šekspīra vārdus: «Tādas blēņas kā neprašu valoda, kam trūkst saprāta» («Such stuffas madmen tongue and brain not», [145], 32. lpp.). Šie trāpīgie vārdi it īpaši attiecināmi uz Hēgeļa darbiem dabas filozofijā. Būdams diletants eksaktajās zinātnēs, Hēgelis uzskatīja par savu misiju filozofiski dialektiski definēt daudzus fizikas pamat­jēdzienus, piemēram, siltumu, elektrību u. c. Kā norāda Karls Popers, Hēgela darbi dabas filozofijā mudž no šādām pseidozinātniskām definīcijām ([145], 27. un 304. lpp.). Ilustrācijai dažas no tām. Tā siltums Hēgeļa izpratnē ir «vielas atgriešanās tās bezformībā .. kā negācijas negācija», bet «skanoša priekšmeta uzsildīšana ir siltums kopā ar skaņu». Dialektiskās loģikas ietvaros Hēgelis «pierāda», ka dzelzs priekšmeta magnetizēšana palielina tā svaru. Cits kuriozs secinājums — ka Ņūtona teorija par ķermeņa inerto un gravitācijas masu ir iekšēji pretrunīga. Kā gan Hēgelis varēja paredzēt, ka vēlāk Einšteins pierādīs ķermeņa inertās un gravitācijas masas identitāti?

Cik satriecošs kontrasts starp diviem vācu filozofiem: dialektiskā panlogisma iedibinātāju Hēgeli un tīrā prāta kritiķi Kantu! Karalauču gigants Imanuels Kants pretstatā Hēgelim bija ar plašu un dziju erudīciju eksaktajās zinātnēs: matemā­tikā, mehānikā, fizikā, kosmoloģijā un antropoloģijā. Viņa pirmais izcilākais darbs (1755. g.) bija nevis filozofijā, bet gan debesu mehānikā un kosmoloģijā. Tas vēl šodien labi pazīstams kā Kanta—Laplasa hipotēze par Saules sistēmas iz­celšanos. «Tīrā prāta kritika» sekoja pēc vairāk nekā divdesmit gadiem (1881. g.).

Komentējot Hēgeļa «domu graudus» dabas filozofijā, Karls Popers secina, ka tie neliecina par domas bagātību, bet gan par domas tukšumu (emptiness, [145], 28. lpp.). Gara filozofijā Hēgeli var uzskatīt par spekulatīvu avantū­ristu, bet dabas filozofijā viņš — pretstatā Kantam — ir vienkārši pašpārlie­cināts šarlatāns. Popers uzskata, ka Hēgeļa dialektika, kuras mērķis bija stāties «neauglīgās formālās loģikas» vietā, savā būtībā ir mistifikācijas metode, kas imitē šķietami zinātnisku gaisotni. Hēgeļa panākumi bija sākums «negodī­guma laikmetam» (tā Šopenhauers raksturo vācu ideālisma periodu) un «bezat­bildības laikmetam» (tā Heidens nosauc moderno totalitārismu). Pirmais iezī­mējas ar intelektuālu bezatbildību, otrais — kā pirmā sekas — ar morālu bezatbildību ([145], 28. lpp.) Jaunajā laikmetā agrākie filozofiskie termini kļūst par maģiskiem, pseidofilozofiskiem saukļiem, par bezsaturīgu iedolo- ģisku žargonu. Mūsdienu filozofs Ludvigs Vitgenšteins mēģina novilkt demar­kācijas līniju starp jēgsaturīgo un bezjēdzīgo (nonsense) un konstatē, ka šī demarkācijas līnija sakrīt ar līniju starp zinātni un metafiziku, t. i., starp zināt­niskām domām un filozofiskām pseidopozīcijām ([145], 293. lpp ).

Dialektika tā arī nepaglāba pašpārliecināto filozofu no galējas vienpusības un faktiski kalpoja tikai viņa «vienīgās» patiesības apoloģētikai, kas komple­mentaritātes aspektā bija puspatiesība, pusmaldi. Nepiepildījās arī Hēgeļa pareģojums, ka līdz ar viņu beigsies Eiropas filozofiskā doma, ka viņš ir filozofu plejādes pēdējais pārstāvis. Notika pretējais — 19. gadsimts iezīmējās ar racionālisma filozofijas pretmetu: uz iracionālismu tendētās filozofiskās domas uzplaukumu. Te vispirms minams Arturs Šopenhauers, kas pasauli uztvēra kā gribu un priekšstatu {Welt als Wille und Vorstellunģ). Visas norises virza kāda dievišķīga Griba, un redzamā Pasaule ir šīs Gribas objektivizācija. To apjēgt ļauj intuīcija, nevis racionālais prāts ([89], 158. lpp.) Šopenhauera filozofiskā doma ievērojami tuvinās orientālās filozofijas nostādnēm. Cilvēka iracionālā daba un tās izpausmes ir arī dāņu reliģiskā domātājā Sērena Kirkegora un vācu filozofa Fridriha Ničes uzmanības degpunktā [94],

78. 5. Dialektika, ideoloģija un totalitārisms

Hēgeļa vienšķautnes dialektika k(uva par sākumpunktu un noderīgu balstu marksistiskajai filozofijai un tās garabērnam un piedēklim — komunistiskajai ideoloģijai. Šim nolūkam Hēgeļa filozofija tika vienkārši transformēta, dialek­tisko ideālismu aizstājot ar dialektisko materiālismu, citiem vārdiem, gara pasaules primātu aizstājot ar materiālās pasaules primātu. Hēgeļa mācību par ideju vēsturisko attīstību savukārt aizstāja vēsturiskais materiālisms, materiālis­tiskā vēstures izpratne. Saskaņā ar to sabiedrības struktūras pamatā ir ražošanas attiecību kopums, kas veido bāzi, kura nosaka politisko un tiesisko virsbūvi un tai atbilstošās ideoloģijas formas — morāli, mākslu, reliģiju, filozofiju, politisko un tiesisko ideoloģiju ([94], 325. lpp.). Tādā kārtā Hēgela filozofijas manti­niece marksistiskā filozofija faktiski transfomējās par doktrinizētu ideoloģiju.

Filozofijas un ideoloģijas būtiskā atškiriba ir tā, ka filozofija meklē Patie­sību, turpretim ideoloģija meklē tikai pierādījumus savai vienīgajai, iedomā­tajai patiesībai. Ideoloģisko mācību veidotāji, kuru tipiskākais pārstāvis ir Markss, necenšas iedziļināties pasaules sarežģītajās parādībās. Viņi gremdējas utopiskās nākotnes vīzijās un nevis kā kritiski domātāji, bet gan kā fantasti rada speku­latīvas teorijas, pieskaņojot tās savām vīzijām [94]. Marksa domāšanas manieri lieliski raksturo viens no mūsdienu Rietumu izcilajiem filozofiem Karls Jasperss: «Marksa sacerējumu stils nav pētnieka stils .. Viņš nekad necitē tādus piemērus, kuri varētu būt pretrunā ar viņa paša teoriju, bet tikai tos, kuri skaidri un gaiši apliecina to, ko viņš pats uzskata par absolūto patiesību. Visa viņa pieeja ir viena vienīga taisnošanās, nevis pētniecība, bet tā ir taisnošanās par kaut ko tādu, kas tiek pasludināts nevis par zinātnieka, bet par ticīgā patie­sību.» (Citēts pēc [94], 324. lpp.)

Ideoloģija ir domu sistēmas pārveide par ticības sistēmu ([94], 616. lpp.). Lai iegūtu plašu atsaucību un atbalstu t. s. masās, ideoloģijai ir raksturīga vienkāršošana, primitivizēšana un shematizācija, tāpat ari aizspriedumu un ticējumu kultivēšana, stereotipu veidošana, nevēlamā noklusēšana un ilūziju radišana. Atšķirībā no filozofijas ideoloģija ir uz ticības vai aizspriedumu bāzes izveidota uzskatu sistēma. Totalitārās sistēmās tai ir tīri utilitāra loma — «salīmēt» indivīdu resp. tautu vienveidīgā masā, kas fanātiski tic saviem ideali­zētajiem vadoņiem un dievina tos. Cik efektīva var būt šāda ideoloģijā sakņo­ta psihiska manipulācija ar cilvēku prātiem, pavisam nesen parādīja Hitlera, Staļina un Mao totalitārie monstri.

Arī atvērtās demokrātiskās sabiedrībās gan partijas, gan reliģiskās sektas, gan citi totalitāri veidojumi izmanto visdažādākās ideoloģijas formas savu locekļu un piekritēju «salīmēšanai» bezpersoniskā ticīgo sekotāju konglomerātā.

Marksistiskajā ideoloģijā jo bieži tiek demagoģiski izmantota Hēge|a dialektiskā metode un dialektiskā loģika. Saskaņā ar formālo loģiku jēdziens vienmēr paliek pats sev idents (A = A), bet dialektiskās loģikas pamattēze apgalvo, ka laika gaitā jēdzieni pārveidojas un A var kļūt par B. Citiem vārdiem, balts var kļūt par melnu un otrādi. Te uzskatāmi redzama dialektiskās un komple­mentārās loģikas būtiskā atšķirība. Tātad dialektiskajā loģikā atkarībā no «vēs­turiskās» situācijas A ir vai nu idents sev (A = A), vai ari līdzinās B (A = B). Turpretim uz komplementaritātes principu balstītajā loģikā vienmēr līdzās pastāv abi pretmeti A un B. Tā Hēgeļa dialektika atkarībā no «vēsturiskās» situācijas secina, ka ir vai nu tikai balts, vai arī tikai melns. Turpretim komplementaritātes princips nosaka, ka baltais un melnais eksistē vienlaicīgi un papildina viens otru kā baltā un melnā pretmetu puses jan un iņ simbolā (1. att. 14. lpp.). Vai metaforiski kā monētas divas puses — skaitlis un ģerbo­nis —, kas kopā veido monētas identitāti un būtību.

Nav grūti secināt, ka dialektiskā «vai nu, vai ari» loģika noved pie «vienīgās» patiesības, turpretim jan un iņ princips jau savā sākotnējā būtībā ietver abas pretmetu Lielās Patiesības. Var tikai piekrist dzirdētam apgalvojumam — ka hēgelisms un marksisms tiešām ir Rietumos pārāk ilgi valdījušā racionālisma intelektuālā «grēka» ārlaulības bērni. Ilustrēsim ar piemēru, kā marksisti izman­toja dialektisko loģiku komunistiskās ideoloģijas un totalitārisma apoloģētikā.

Kā jau minēts, saskaņā ar Hēgeļa filozofiju tēzes un antitēzes pretstatu «cīņā» viena no pusēm ir dominējošā un «varmācīgi» pakļauj otru. Tā pret­statu pāri demokrātija — diktatūra dominējošā, attīstību «virzošā» loma tiek piešķirta diktatūrai. Šāda «dialektika» neizbēgami noved pie absurda, bet totalitārismam noderīga demagoģiska secinājuma, ka «diktatūra ir visaugstākā demokrātijas forma». Tādējādi hēgelisms un marksisms sagatavoja ideoloģisko augsni vēsturiski visnecilvēcīgākajām totalitārisma formām — staļinismam un maoismam.

Ne mazāku ļaunumu cilvēcei nodarījis cits Hēgeļa «intelektuālā grēka» produkts. Neviens cits kā viņš bija pirmais, kas viskonsekventāk aizstāvēja vēsturisko relativismu — teoriju, ka patiesība ir relatīva, atkarīga no laikmeta gara ([145], 308. lpp.). Saskaņā ar šo doktrinu katram vēsturiskam periodam ir savas vienīgās īstenās patiesības, sava ētisko vērtību skala. Šī teorija kļuva par noderīgu idejisko ieroci vienīgo patiesību apoloģētikai. Marksisti Hēgeļa domu par vēsturisko relativismu transformēja par ideoloģisku dogmu, pos­tulējot patiesības sociāli škirisko dabu. Jebkura patiesība vai tās interpretācija tika padarīta atkarīga no tā, kādu sociālo šķiru pārstāv tās paudējs vai aizstāvis. Saskaņā ar šo vēsturiskā materiālisma doktrīnu par « zinātniskām» tika atzītas tikai t. s. «progresīvās» patiesības — tās, kuras var veicināt komunisma uzvaru pasaulē. Komunistiskajā režīmā tika ideoloģizētas itin visas gara darbības sfēras, pat dabaszinātnes. Komunistiskie ideologi pasludināja par «antizināt- niskām» veselas modernās zinātnes nozares, tādas kā ģenētika un kibernētika. Kvantu fizikas Kopenhāgenas interpretācija tika atzīta par ideālistisku un tātad antizinātnisku, tāpat arī Bora komplementaritātes princips, kas ir pretrunā vienīgās «zinātniskās» patiesības doktrīnai. Arī morāli ētiskās normas un likumi tika pakļauti un pielaikoti «škiriskām» interesēm: jebkura rīcība ir tikumiska, ja tā veicina proletāriskās revolūcijas un komunisma uzvaru. Ar to tika akcep­tēts velnišķais Makiavelli princips «Mērķis attaisno līdzekļus».

Dziļi psiholoģisku un skaudru filozofisku šā visatļautības principa analīzi devis krievu rakstnieks Fjodors Dostojevskis romānā «Noziegums un sods» («npeeryTineHHe h naKa3anne»). Vēstulē žurnāla «PyccKHH BecTHHK» redak­toram Katkovam Dostojevskis raksta, ka romāns «ir kāda nozieguma psiho­loģisks apskats» ([35], 528. lpp.). Šajā vēstulē rakstnieks paskaidro, ka Raskoļņikovu lidz noziegumam noveduši materiālistiskie un ateistiskie uzskati un «dīvainās, «līdz galam neizdomātās idejas», kas vēdī gaisā». Tie bija 19. gs. septiņdesmitie gadi, kad gaisā patiesi virmoja morālā nihilisma un marksis­tiskās dialektikas idejas par cildeniem mērķiem, kuru sasniegšanai atļauti jebkuri līdzekli. Raskolņikovam sods nav vis katorga, bet gan paša sirdsapziņa, kuru romāna epilogā atmodina Soņa — grēciniece, kas viņu pavada katorgas gaitās, un viņas dāvātais evaņģēlijs pagalvī. «Dialektikas vietā bija stājusies pati dzīve, un apziņā vajadzēja izveidoties kaut kam pavisam jaunam.» ([35], 524. lpp.)

Vai šādu pašatklāsmi un nožēlu var sagaidīt no totalitāro represīvo režīmu vadītājiem un izpildītājiem? Tie pārsvarā ir brutāli un nežēlīgi vīri, varaskāri maniaki un sadisti, bieži vien ar psihiskām novirzēm — kā abi gadsimta lielie diktatori Staļins un Hitlers. Hēgela dialektikas ambivalentais relatīvisms, apgalvojums, ka atkarībā no situācijas melns var būt balts vai balts — melns, veidoja komunistiskās ideoloģijas idejisko pamatbāzi. Konsekventi sekojot šādai dialektiskai domu gaitai, varēja apgalvot, ka atkarībā no vēsturiskās situācijas patiesība kļūst par meliem vai otrādi — meli par patiesību. Rezultātā ideoloģija transformējās par demagoģiju. Tāda bija amorālās varas tehnoloģija.

Tas viss varēja atgādināt absurdo teātri vai ļaunu farsu, bet — ak vai tiem nolemtajiem aktieriem, kuriem bija jātēlo savas lomas šai ļaunuma un melu impērijas teātrī! Divi izcilākie mūsu gadsimta prozaiķi ar nepārspējamu māksliniecisku spēku un iztēles bagātību konģeniāli atainojuši totalitāro režīmu dēmonisko būtību. Tie ir Francis Kafka un Džordžs Orvels.

Kafkas romānā «Process» šausminošā tiešumā parādīts viss neziņas, baiļu, bezpalīdzības, pazemojumu un terora emocionālais spektrs, kādu pārdzīvoja tūkstošiem un atkal tūkstošiem nelaimīgu un nevainīgu cilvēku čekas un gestapo pagrabos un vēlāk teatrāli inscenētos tiesas procesos.

Orvela 1948. gadā uzrakstītais antiutopiskais romāns «1984» {«Nineteen Eighty-Four») parāda, kas notiktu ar cilvēci, ja visā pasaulē būtu uzvarējis komunistiskais režīms [132]. Saskaņā ar iepriekš aprakstīto dialektikas modeli visi ierastie jēdzieni ir apgriezti — melnais ir balts, meli ir patiesība. Partijas ideoloģijas ministrija, kuras daudzgalvainā ierēdņu armija nepārtraukti nodar­bināta, lai atbilstoši momentam un situācijai pārveidotu vēsturi, hronikas vai statistiku, tiek saukta par Patiesības ministriju (Ministrj ofTruth). Kara minis­trija atbilstoši saucas Miera ministrija (Ministry ofPeace). Lokālie karini nebūt nav beigušies. Visu pasauli ir sadalījušas trīs komunistiskās lielvaras — trīs savstarpēji naidīgi bloki, kas mainīgās kombinācijās cīnās savā starpā (tā Orvels ģeniāli pareģoja sagaidāmo politisko un ideoloģisko konfliktu starp abām komunistiskajām lielvarām — PSRS un Ķīnu).

Visvarenākā un nozīmīgākā ir Drošības un domu kontroles ministrija. Tās rīcībā ir t. s. Domu policija {Thought Police), kas ar ultramodernu novērošanas un noklausīšanās ierīču palīdzību seko katram ikviena pilsoņa solim un sarunām. Visur redzami brīdinoši lozungi: «Lielais Brālis jūs novēro (Big Brother is Watching You).» Šo ministriju, kuras cietumos ar visrafinētākajām metodēm spīdzina notvertos citādi domājošos, sauc par Mīlestības ministriju {Ministrj ofLovē). Un Lielais Brālis, tāpat kā tā prototips — mums labi zināmais tautas tēvs un skolotājs — ir jāmīl un jādievina. Itin visur redzami Lielā Brāļa portreti, tāpat kā Partijas trīs pamatlozungi ([132]. 9. lpp.):

«Karš ir miers.»

«Brīvība ir verdzība.»

«Nezināšana ir spēks.»

Ģeniāli vienkārša un gudra dialektika! Tā lieliski asociējas ar Hēgeļa un Marksa dialektiskajām aksiomām: «Brīvība ir apzināta nepieciešamība,» — un: «Diktatūra ir augstākā demokrātijas forma.»

Par šādu hēgeliski marksistisku brīvības izpratni ironizē Tomass Manns epohālajā romānā «Doktors Fausts»: «Brīvību nevar aizstāt revolūcijā dzimusi diktatūra.» ([112], 219. lpp.). Vai šo apgalvojumu uzskatāmi neapstiprina jauno laiku vēsture? Lielā Franču revolūcija, kas iesākās brīvības un brālības ideālu vārdā, drīz vien nobeidzās ar Robespjēra trim terora gadiem, kad šis pašas brivības un brālības vārdā giljotinēja pāri par 30 tūkstošiem Francijas pilsoņu. Un kā pēdējo šajā terora ķēdē— pašu Robespjēru…

Līdzīgi Oktobra revolūcija Krievijā (tā gan faktiski bija boļševiku bruņots apvērsums) t. s. proletariāta diktatūras aizsegā noveda pie galēja totalitārisma un Staļina vienpersoniskās tirānijas, kas 30 gados Gulaga vergu nometnēs nobendēja vairāk nekā 60 miljonus cilvēku. Staļinisko «brīvību» cildinošo odu «un es nezinu starp zemēm simtām, kur vēl citur cilvēks ir tik brīvs» tautā parodēja ar rindām «cilvēks brīvs tik tad, kad nav vairs dzīvs»…

Šo diktatūru terora mērogi un izpildes mehānismi ir atšķirīgi, bet to anti­humānā būtība ir viena un tā pati — tā balstās uz «vienīgās īstenās» patiesības dialektikas demagoģiskajiem principiem. Staļina režīma orveliskā būtība visā cinismā sevi parādīja trīsdesmito gadu beigās. 1936. gadā tika pieņemta t. s. Staļina konstitūcija, kas pilsoņiem deklarēja visas demokrātiskās brīvības un kuru komunisti pasludināja par visdemokrātiskāko konstitūciju pasaulē. Bet jau pēc gada sākās visplašākās un nežēlīgākās represijas, kas skāra miljoniem cilvēku, tai skaitā daudzus komunistiskā režīma aizstāvjus, partijas biedrus un revolūcijas veterānus. Šīs masveida represijas «Patiesības ministrijas» ideologi skaidroja ar «pieaugošo šķiru cīnu sociālisma apstākļos». Atbilstošo jurisdik­ciju sagatavoja ideologi — juristi. Cilvēka notiesāšanai nav vajadzīgi objektīvi pierādījumi. Pietiek ar viņa «vaļsirdīgu» atzīšanos pret režīmu inkriminētos noziegumos. Par «vaļsirdību» savukārt rūpējās čekas «Mīlestības ministrijas» izpildīgie, režīmam uzticīgie «kalpotāji». Konstitūcijā garantētā vārda brīvība bija jāizprot dialektiski — kā brīvība slavināt un apdziedāt režīmu. Citādu uzskatu paušana bija, kā to trāpīgi nosauca Orvels, «thought crime» (domā­šanas noziegums), un citādi domājošos sodīja kā kriminālnoziedzniekus par režīma apmelošanu un iekārtas pamatu graušanu vai arī pasludināja par psihiski slimiem un ieslodzīja cietumu psihiatriskajās slimnīcās.

Patiesība nebija ne jāmeklē, ne jāpierāda, jo varas pārstāvjiem bija monopols uz «vienīgo» īsteno patiesību.

Jau komunistiskās ideoloģijas pamatlicējs Karls Markss saprata, ka vina sludinātajam morāles principu relatīvismam, to vēsturiskajam un škiriskajam traktējumam nav pieņemamas reliģiju gadsimtos izauklētās vispārcilvēciskās ētikas normas. Komunistu škiriskajai ideoloģijai bija absolūti nepieņemami kristietības morāles pamatbaušļi «Tev nebūs nokaut», «Tev nebūs zagt», «Tev nebūs iekārot sava tuvākā mantu». Un vēl nepieņemamāks bija Kristus sludi­nātais cilvēkmīlestības pamatbauslis «Tev būs mīlēt savu tuvāko kā sevi pašu». Šīs vispārcilvēciskās reliģiskās ētikas normas Markss nosauca par opiju tautai. To vietā bija jānāk revolucionārajai «šķiru cīņas» morālei: «Viss ir atļauts, kas nāk par labu revolūcijas un komunisma uzvarai.» Šķiras ienaidnieki, ko vēlāk sāka dēvēt par tautas ienaidniekiem, bija jāapspiež un jāiznicina bez žēlastības. Revolūcijas ekonomiskais sauklis bija — «laupīt salaupīto!». Šķiru cīņas dialek­tiskā ideoloģija iedibināja ētisko nihilismu un palīdzēja atraisīt viszemākos instinktus: naidu, skaudību, nenovīdību, apmelošanu, nodevību un šantāžu.

Kristietību aizstāja «karojošais ateisms» — antireliģisks fanātisms. Baznī­cas, Krievijas arhitektūras lepnums, tika izlaupītas, sagrautas, uzspridzinātas. To kalpotāji un uzticīgie draudzes locekļi dzīvi beidza Gulaga vergu nomet­nēs. Ar orvelisku centību no tautas atmiņas tika izdzēsti krievu savdabīgās reliģiski ievirzītās filozofijas izcilākie pārstāvji Vladimirs Solovjovs, Nikolajs Berdjajevs un Pāvels Florenskis ([94], 332. lpp.). Šie ievērojamie filozofi līdz ar gadsimta izcilāko krievu rakstnieku Fjodoru Dostojevski veidoja 19. gs. otrās puses un 20. gs. sākuma Krievijas reliģiskās filozofijas «sudraba laikmeta» garīgo kodolu. Šis reliģiski filozofiskais strāvojums sakņojās Bizantijas kultūrā un tās kristīgajā Austrumu atzarā — pareizticībā. Pretstatā Romas Rietumu kristietībai, kam raksturīgs kanonizēts, sholastisks racionālisms, Austrumu kristietība gremdējās mistiskā dzīves un Dieva uztveres izjūtā. Šie pretstati dziļā fdozofiskā skatījumā spilgti izgaismoti Dostojevska ģeniālajā romānā «Brāļi Karamazovi» Ivana Karamazova esejā «Lielinkvizitors» [34].

Krievijas garīgajai kultūrai fatālu triecienu deva Ļeņina dekrēts par krievu humanitārās inteliģences izraidīšanu uz Rietumiem 1922. gadā. Padomju lasītāju vairs nesasniedza Dmitrija Merežkovska, Ivana Buņina un Vladimira Nabokova darbi.

Padomju režīma laikā gandrīz nepieejams kļuva arī Fjodors Dostojevskis, kas visā pasaulē tika atzīts par izcilāko krievu rakstnieku un domātāju. Padomijā šā rakstnieka daiļrade pat netika iekļauta obligātajās skolu literatūras programmās, un, ja arī par to tika runāts, tad tikai ar atbilstošu «lietošanas pamācību». Par to nebūtu jābrīnās, jo Dostojevskis pretstatā komunistiskās ideoloģijas sludinātajai naida morālei un principam, ka mērķis attaisno līdzek­ļus, apliecināja kristīgās cilvēkmīlestības un morālās atbildības principus. Šos Kanta kategoriskajam imperatīvam līdzvērtīgos morāles principus Dostojev­skis apcerējis epohālajos darbos «Noziegums un sods» un «Brāļi Karamazovi», kā arī neilgi pirms aiziešanas mūžībā krievu literatūras draugu biedrībā nolasī­tajā referātā «Puškins». Dostojevskis jautā: ja tiktu celta jauna cilvēku likteņ- ēka, jauna — ideāla sabiedrība ar mērķi beigās aplaimot visus cilvēkus, sniegt viijiem mieru un labklājību, bet ja tās sasniegšanai būtu nenovēršani nepie­ciešams nomocīt kaut tikai vienu vienīgu cilvēcisku būtni — bērnu vai sirm­galvi —, vai jūs būtu ar mieru kļūt par tādas ēkas arhitektu? Viņa atbilde ir kategoriska— nē: «Bet kāda var būt laime, ja tā dibināta uz cita nelaimi?»

Izcilā Dostojevska personības un pasaules uzskatu pētniece Zenta Mauriņa atzīst, ka Dostojevska morāles mācība balstās uz mīlestības ētiku — atšķirībā no Kanta, kas ar savu kategorisko imperatīvu postulē pienākuma ētiku [115].

Vistraģiskākais liktenis piemeklēja pasaules ranga filozofu Pāvelu Floren- ski. Viņš inteliģences, zināšanu un vispusības dēl tiek dēvēts par krievu Leonardo da Vinči, jo sevi vienlīdz parādīja gan fizikā un matemātikā, gan lingvistikā, teoloģijā, mākslas vēsturē un filozofijā. Vina universālais prāts ne vien radīja jaunu sistēmu krievu filozofijā, bet arī ietekmēja kibernētikas, sim­bolu teorijas, semiotikas un mākslas vēstures attīstību 20. gadsimtā ([94], 430. lpp.). Viņš palika Krievijā un 1937. gadā, tāpat kā talantīgais dzejnieks Osips Mandelštams, tika nošauts čekas Gulaga nometnē (tagad esot atrasti materiāli, ka viņš bijis dzīvs līdz 1943. gadam).

Viena no Florenska filozofijas būtiskākajām iezīmēm ir tā, ka viņš aicina apvienot pretstatus, ko Eiropas filozofija tik cītīgi tika šķīrusi. Iekšējā un ārējā pasaule, jutekliskais un garīgais, parādība un jēga, neraugoties uz atšķirībām, pēc Florenska domām, cieši saistās. To vienība parādās simbolā ([94], 340. lpp.)

Varam tikai piebilst, ka šie Florenska filozofiskie uzskati cieši tuvojās orientālajai Dao filozofijai un viņa pieminētais simbols varētu būt idents ar jan un iņ simbolu.

79. SLĒGTA UN ATVĒRTA TIPA SABIEDRĪBAS. TOTALITĀRISMS UN DEMOKRĀTIJA

Angļu filozofs Karls Popers grāmatā «Atvērtā sabiedrība un tās ienaidnieki» (« The Open Society and Its Enemies», [145]), analizējot totalitāro iekārtu idejis­kos pamatus, izšķir slēgta un atvērta tipa sabiedrības. Totalitārismam raksturīgs slēgtas sabiedrības modelis.

Par slēgtas sabiedrības senāko prototipu Popers uzskata pirmatnējo sa­biedrību {tribal societj). Tajā cilts locekļu individuālās intereses tiek pakļautas visas cilts kopīgajām interesēm un vadoņa vai vecākā gribai. Šāds slēgtas sabied­rības modelis bija drošākais izdzīvošanas garants citu naidīgu vai konkurējošu cilšu vidū. Vēlāk, veidojoties valstiskām struktūrām, šis «tribāliskais» modelis tika pārmantots un nostiprināts ar likumdošanu un valsts varu un tā apoloģē- tikai radīti filozofiski pamatojumi un skaidrojumi. Pēc Popera domām, jau Pla­tona ideālās valsts modeli [143] iezīmējās totalitārisma apoloģētikas elementi.

Platons darbojās Atēnās, grieķu pilsētvalstinā ar samērā attīstītām demo­krātijas tradīcijām. Viņš jutās vilies pēcperikla demokrātijā: uzskatīja, ka valsts tiek slikti pārvaldīta, ka tās politiku veido nekompetenti cilvēki. Tāpēc Pla­tons savā ideālvalstl deva priekšroku autoritāram režīmam: valsti vajag pārval­dīt apgaismotam monarham filozofam ([197], 68. lpp.). Šajā valsti viņš paredz vienotus dzīves un domāšanas standartus un ētikas normas, autoritāru domas un rīcības kontroli. Ari Platona Akadēmijā valdīja autoritāra gaisotne: atcerē­simies norādījumu, ka ar augstāko filozofisko disciplīnu — dialektiku cilvēki drīkst nodarboties tikai pēc rūpīgas atlases.

Arī Atēnu demokrātijā necieta citādi domājošos. Spilgtākais piemērs ir nāves­soda piespriešana tā laika izcilākajam filozofam Sokratam. Viņš tika apsūdzēts un notiesāts par «neticēšanu dieviem, kuriem visa pilsēta (t. i., Atēnas) tic» ([197], 56. lpp.). Kaut ari Sokrāts labi apzinājās, ka tiek apvainots netaisni, tikai savu filozofisko uzskatu dēļ, viņš atteicās no iespējas aizbēgt un kā pilsonis, kas lojāls savas pilsētas likumiem, iztukšoja indes kausu savu draugu un mācekļu pulciņā, līdz pat pēdējam apziņas mirklim nododamies filozofiskām sarunām.

Reikss Vorners [197] izsaka domu, ka Sokrāts, kas savā filozofijā vairāk par visu mīlēja paradoksus, ari dzivi izvēlējās nobeigt kā paradoksu, apzināti pieņemot netaisno nāves spriedumu. Bet varbūt tā bija senajiem grieķiem tik raksturīgā pakļaušanās Liktenim. Eshila un Sofokla traģēdijas ir Likteņa traģēdijas. Līdzīgu sentimentu pauž arī dziesminieks Pindars ([197], 58. lpp.): «Likums ir valdnieks pār visiem, kā mirstīgiem, tā nemirstīgiem.»

Vēsturiskie priekšnosacījumi atklāta tipa sabiedrību tapšanai sāka īstenoties daudz vēlāk, tikai pēc viduslaikiem. Vispirms tā bija renesanses jaunā paradigma par individualitātes primātu, par ikviena cilvēka tiesībām realizēt savas spējas un talantu. ŠI renesanses kultūras pamatiezīme paver ceļu tik atšķirīgām personī­bām, tādiem visaugstākās raudzes ģēnijiem kā Leonardo da Vinči un Mikelan- dželo, Koperniks un Galilejs, Šervantess un Šekspīrs. Tieši Šekspīra daiļrade varbūt visspilgtāk raksturo laikmeta pamatievirzi. Viņa radītās kaismīgās rak- sturtraģēdijas ir kā spilgts pretmets sengrieķu dramaturgu Eshila un Sofokla likteņtraģēdijām.

Nākamais priekšnosacījums bija indivīda domas un rīcības brīvība, vienlī­dzība un no visa tā izrietošās politiskās un ekonomiskās brīvības. Šim demo­krātiskajām atvērtas sabiedrības brīvībām augsni sagatavoja 18. gs. apgais­mības filozofi Francijā un Vācijā, ari Amerikā. Politiski tās realizējās vispirms Amerikas Neatkarības deklarācijā 1776. gadā: indivīdam garantēja tiesības uz dzīvību, brīvību un tieksmi pēc laimes {Life, liberty andpersuit for happiness). Mazliet vēlāk Lielā franču revolūcija deklarēja tikpat nozīmīgu apgaismības laikmeta filozofu izauklēto principu: brīvība, brālība, vienlīdzība {liberte, fra- ternitē, egalite). Taču franču apgaismotāju hipertrofētais racionālisms (Prāta dieviete Kristus mācības vietā) noveda pie morāla nihilisma un voltēriska cinisma («Ja Dieva nav, tas jāizgudro»), kas sagatavoja augsni totalitārismam. Tieši tāpēc Lielajai franču revolūcijai raksturīgas ekstrēmas galējības — sākotnējā revolucionārā jūsma un pacēlums pāraug naida un terora atmosfērā, kas poli­tisko norišu finālā noveda pie Napoleona Bonaparta autoritārā imperiālisma.

Tomēr, kā savā dziļi analītiskajā grāmatā parāda Karls Popers, par visbīs­tamākajiem ienaidniekiem atvērtai demokrātiskai sabiedrībai kļuva 19. gs. filozofi Hēgelis un Markss, kas nobruģēja ideoloģisko ceļu 20. gs. globālajiem totalitārajiem režīmiem — bolševismam un fašismam. Hēgeļa ietekmi un popu­laritāti noteica nevis viņa filozofijas nozīmīgums vai oriģinalitāte, bet gan tās noderīgums totalitāro režīmu ideoloģijai. Viņš kļuva par Prūsijas militāras karaļvalsts oficiāli atzīto un atbalstīto filozofu.

Prūšu karaļa Fridriha Vilhelma režīmam lieliski noderēja Hēgeļa mācība par valsti un tās varas prioritāro lomu. Saskaņā ar Hēgela doktrīnu valsts ir viss, indivīds nav nekas, viņam jāpateicas valstij par visu — par savu fizisko un garīgo eksistenci. «Valsts ir Dievišķā Ideja, kas realizējas uz zemes,» raksta Hēgelis. «Valsts zina, ko tā grib. [..] Valsts ir realitāte.» Valstij ir absolūta autoritāte morāles jautājumos, tā nosaka katra indivīda morāli un apziņu. Valsts ir kara­stāvokli ar citām tautām, tieši karā parādās valsts varenība ([145], 31., 65. lpp.). Jājautā — vai var vēl izdomāt piemērotāku apoloģētiku prūšu militārismam un vēlāk hitleriskā «Reiha» nacistiskajai kara mašīnai?

Tā Hēgela filozofiju vienlīdz veiksmīgi izmantoja gan ultrakreisie mark­sisti, gan centriskie konservatīvie, gan galēji labējie fašisti. Tā bija universāli noderīga doktrīna jebkuram totalitāram režīmam. Bija tikai jāmaina akcenti un frazeoloģija. Tā marksisti aizstāja karu starp tautām ar karu starp šķirām, bet fašisti — ar karu starp rasēm ([145], 30. lpp.).

Jāuzsver, ka totalitārisms vienmēr balstās uz «vienīgās īstenās» patiesības doktrīnu. Patiesība nav jāmeklē, tā ir tikai viena un zināma varas ideologiem. Tāpēc indivīdi ir jāpakļauj vienam centram, valsts vai vienīgās partijas kontro­lei, un tām ir monopoltiesības definēt un nosargāt «vienīgās» patiesības. Tota­litārisms prasa vienotus dzīves un domāšanas standartus, domu un rīcības cenzūru [145]. Turklāt hēgeliskajam un marksistiskajam totalitārismam ir raksturīgas idejas par cilvēka dabas uzlabošanu. Visi ir jāpadara vienādi, vienādi domājoši. Citādi domājošie tiek izolēti no sabiedrības vai iznīcināti. Bet tieši radošie indivīdi ir vienmēr bijuši «citādi domājoši». Tos iznīcinot, sabiedrība zaudē vērtīgāko ģenētisko fondu.

Slēgta tipa sabiedrībām ir tieksme norobežoties no visa atšķirīgā, tām svešā, šīs sabiedrības necieš jaunievedumus, izmaiņas [94]. Agrāk vai vēlāk tās totāli biro- kratizējas un nonāk galējā stagnācijā. Tieši tāpēc, kā uzskatāmi parāda mūsdienu vēsture, tās nav spējīgas konkurēt ar atvērta tipa demokrātiskām sabiedrībām.

Atvērta tipa sabiedrības (open societies), kuru prototips ir Rietumu demo­krātijas, ir spilgts pretmets slēgta tipa sabiedrībām. Demokrātisko sabiedrību pamatus veido indivīda un ģimenes, nevis grupu, partiju vai valsts institūciju primāts, uzskatu plurālisms pretstatā valsts doktrinizētai ideoloģiskai vienvei­dībai. Sabiedrībai netiek uzspiestas «vienīgās» patiesības, katrs indivīds ir tiesīgs meklēt savu patiesību. Atvērto sabiedrību liberālisma idejas un morāli ētiskās vērtības balstās uz tādu — arī «atvērtu» — filozofu mācībām kā Sokrāts, Kants, Bergsons, uz tādu literatūras titānu darbiem kā Fjodors Dostojevskis un Tomass Manns, uz mūsu gadsimta izcilāko zinātnieku Alberta Einšteina un Nilsa Bora morāli ētiskajiem principiem.

Modernās zinātnes īpašā loma atvērtās sabiedrības veidošanā un attīstībā visdziļāk analizēta un novērtēta zinātnes filozofu Karla Popera un Bērtranda Rasela pētījumos.

Atvērtās sabiedrības ekonomiskos pamatus savukārt veido modernā «trešā viļņa» {«brain force») tehnoloģija, privātīpašums un brīvais tirgus. Otrais pasau­les karš savā būtībā bija atvērto sabiedrību cīņa pret fašistiskā totalitārisma lielvarām — Vāciju, Itāliju un to satelītiem.

Pēckara periods vainagojās ar Cilvēka tiesību deklarācijas pieņemšanu 1948. gadā — tajā formulēti tiesiskie un morāli ētiskie atklātās sabiedrības attīstības pamatprincipi. Otra totalitārā lielvara — Staļina bolševistiskā impē­rija —, neizturējusi ekonomisko un tehnoloģisko konkurenci ar Rietumiem, sabruka 1991. gadā. Uzvarēja atvērtās sabiedrības modelis.

Bērtranda Rasela 1952. gadā publicētajā grāmatā «Zinātnes iespaids uz sabiedribu» {«The īmpact of Science on Society») izdarītie slēdzieni apstiprina, ka mūsdienās, kad sabiedrības ekonomisko virzību nosaka modernās tehno­loģijas sasniegumi, slēgtās totalitārās sabiedrības nespēj nodrošināt nepiecie­šamās brīvības normālai zinātnes un tehnoloģijas attīstībai un tāpēc lemtas stagnācijai un sabrukumam [163]. Totalitārie režīmi faktiski kļūst par savu dogmatisko ideoloģiju ķīlniekiem un upuriem. Tā Vācijas nacistiskie ideologi novilka rasistisku demarkācijas līniju, sadalot zinātni āriskā (ģermāniskā) un neāriskā. Pie «neāriskās» un tātad apkarojamās zinātnes piederēja Einšteina relativitātes teorija un Nilsa Bora modernā atomfizika. Par «neārisku» tika uzskatīts pat Bora talantīgais skolnieks, nenoteiktības relācijas atklājējs vācietis Verners Heizenbergs, kas atradās īpašā gestapo un Himlera drošības dienesta (SD) uzraudzībā.

Jau trīsdesmito gadu sākumā nacisti sagrāva pasaulslaveno Getingenes skolu, uzskatot to par «neāriskās» zinātnes citadeli (sk. 8. eseju). Šis tuvredzī­gais rasistiskais fanātisms kļuva fatāls režīmam. Vācijas zinātnieku sasniegumi atomfizikā un tehnoloģijā izrādījās gaužām rudimentāri salīdzinājumā ar grandiozo Manhetenas projektu, kura intelektuālo potenciālu veidoja tieši no Eiropas emigrējušie zinātniskie prāti.

Komunistiskajiem ideologiem bija cita «šķiriskā» demarkācijas līnija. Viņu­prāt, zinātne bija jādala progresīvajā, uz dialektisko materiālismu bāzētajā padomju zinātnē un reakcionārajā, ideālisma caurstrāvotajā Rietumu buržuāzis­kajā zinātnē. Tā aiz šīs «škiriskās» demarkācijas līnijas nokļuva, kā jau minēts, vairākas modernās zinātnes nozares: kibernētika, ģenētika, molekulārā biolo­ģija, kvantu ķīmija u. c. Par to, cik fanātiska bija komunistisko ideologu pārliecība, ka ne vien sabiedrības, bet ari dabas likumi ir «šķiriski», liecina kurioza epizode, ko atmiņās apraksta padomju atombumbas «tēvs» akadē­miķis Igors Kurčatovs. Kad viņš politbiroja sēdē demonstrējis pirmās pluto- nija atombumbas maketu, Staļins jautājis, cik atombumbu var izgatavot no Berijas resorā saražotā plutonija. Kurčatovs atbildējis — pagaidām tikai vienu, jo atombumbas uzspridzināšanai nepieciešama plutonija kritiskā masa. Uz jautājumu, kas šo kritisko masu noteicis, Kurčatovs nosaucis Enriko Fermi un dažu citu Rietumu zinātnieku vārdus. Tad padomju «zinātnes korifejs» pār­gudri pamācījis atomfiziķi, ka tā ir buržuāziskās zinātnes plutonija kritiskā masa, padomju zinātnieku noteiktā kritiskā masa varētu būt krietni mazāka, un no esošā plutonija daudzuma varētu tikt izgatavotas vairākas atombumbas! Šobrīd šādu epizodi varētu ieslēgt absurdā teātra repertuārā. Bet varam tikai iedomāties, ko pārdzīvoja Kurčatovs, netieši apvainots «šķiriskās modrības» trūkumā…

Abi supergigantiskie totalitārie režīmi, paldies Dievam, ir aizgājuši no vēs­tures skatuves, dodot vietu atklātām sabiedrībām. Varam tikai piebilst, ka to sagrāve bija jau idejiski ieprogrammēta slēgto sistēmu iekšienē. Tas bija hēge- liskais «vienīgās patiesības» vīruss, kas līdzīgi AIDS vīrusam sagrāva šo sistēmu «imunitāti».

Padrūmo nodaļu par totalitārismu un ideoloģijām gribas nobeigt ar 15. gs. vācu mistiķa Kempijas Toma pravietiskajiem vārdiem: «Sic transit gloria rnundi (Tā aiziet pasaules godiba).»

80. HISTORICISMA ORAKULĀRĀ FILOZOFIJA.

VĒSTURISKA DETERMINISMA ILŪZIJAS UN MALDI

Sekojot mehāniski determinisma doktrīnai, 19. gs. vēstures filozofi, it īpaši Hēgelis un Markss (un viņu adepti) naivi ticēja, ka determinisma paradigma paplašināma arī socioloģijas jomā un cilvēces vēsturiskā attīstība aprakstāma strikti determinētu likumu ietvaros. Kā astronomi var precīzi noteikt Saules un Mēness aptumšošanās dienu un stundu, tā vēsturniekiem un sociologiem vajadzēja varēt zinātniski prognozēt revolūciju iestāšanos un sabiedrības eko­nomiskās un sociālās attīstības gaitu. Karls Popers šādu pieeju trāpīgi dēvē par orakulāro filozofiju [ 147].

Karls Markss pašpārliecināti iejutās jauno laiku pravieša lomā un līdzīgi Delfu orākula pītijai pareģoja kapitālistiskās sabiedrības neizbēgamo sabruk­šanu un komunismu kā mesiju, «kura rēgs jau lidinās pār Eiropu». Apollona priesterieni orakulārā ekstāzē noveda no klints plaisas plūstošie indīgie tvaiki, Marksu un viņa sekotājus savukārt apdullināja varaskāres un pasaules pārvei­došanas mānijas reibinošais vīraks. Socioloģiskās teorijas, kas balstās uz ticību, ka eksistē determinēti vēstures un sociālās attīstības likumi, kas virza nepār­trauktu progresu, Karls Popers vispārinātā nozīmē sauc par historicismu. Analī­tiskai dažādu veidu un nokrāsu historicisma teoriju kritikai Popers veltījis grāmatu «Historicisma nabadzība» {«The Poverty of Historicism», [147]). Tajā parādīts, ka vēsturiskās nolemtības {historical destiny) teorijas balstās uz tīru māņticību {sheer superstition), jo cilvēces vēsturiskās virzības gaitu nevar prog­nozēt ar zinātniskām vai citām racionālām metodēm. Lielākais Jaunums cilvē­cei bija tas, ka šīs teorijas — it īpaši Hēgeja un Marksa izpratnē — tika pasniegtas kā absolūtas «vienīgās» patiesības un kļuva gan par komunistu, gan nacistu totalitārā režīma oficiālo ideoloģiju. Šai kontekstā īpaši jāpiemin, ka savu grāmatu Karls Popers veltījis «tiem neskaitāmajiem dažādo ticību, tautu un rasu vīriešiem, sievietēm un bērniem, kuri kļuva par upuriem fašistu un komunistu ticībai nepielūdzamiem vēsturiskās nolemtības likumiem {Beliefin Inexorable Laws of Historical Destiny). Autors apgalvo, ka, pat balstoties uz tīri loģiskiem secinājumiem, var pierādīt, ka principā nav iespējams prognozēt cil­vēces vēsturiskās attīstības nākotnes virzību.

Historicisma atspēkojuma argumentācija balstīta uz pieciem loģiskiem slēdzieniem [147]:

1)  cilvēces vēstures gaitu ietekmē cilvēku zināšanu apjoma pieaugums;

2)    ar racionālām vai zinātniskām metodēm nav iespējams prognozēt cil­vēces zinātnisko atziņu nākotnes virzību, un jaunas atziņas, kas balstās uz zinātniskiem atklājumiem nākotnē, nav prognozējamas — to apstip­rina gan vēsturiskā pieredze, gan zinātnes pētnieku slēdzieni;

3)    tas nozīmē, ka principā nav iespējams zinātniski prognozēt cilvēces vēs­tures nākotnes virzību;

4)    tas savukārt nozīmē, ka mums jāatmet cerības izveidot zinātnes disci­plīnu, ko varētu nosaukt par teorētisko vēsturi, vai, citiem vārdiem, vēs­turisko sociālo zinātni, kas būtu līdzvērtīga tādām zinātnēm kā teorē­tiskā fizika un teorētiskā ktmija, un tātad nevar tikt izveidota zinātniska vēsturiskās attīstības teorija, kas varētu kalpot par bāzi prognozēm;

5)    historicisma teorijas un metodes ir iluzoras, maldinošas un neauglīgas, tās balstās vai nu uz kailu ticību, vai māņticību, vai uz abām kopā.

Visbūtiskākais šajos slēdzienos ir otrais — vispārliecinošākais arguments. Ja eksistē tāda parādība kā arvien pieaugošais cilvēces zināšanu kopums, tad šodien nav iespējams paredzēt to, ko zināsim tikai rit. Šos atzinumus pārlieci­noši apstiprina zinātnes attīstības vētrainā gaita mūsu gadsimtā. 19. gs. beigās neviens no tā laika izcilākajiem zinātniekiem neparedzēja jaunu paradigmu dzimšanu. Gluži pretēji — 19. gs. klasiskās fizikas patriarhi, piemēram, uzska­tīja, ka fizikas teorētiskā būve ir principā pabeigta, jānoskaidro tikai detaļas, jāprecizē dažādu fizikālo konstanšu skaitliskās vērtības, bet nekādi jauni, negai­dīti pārsteigumi nav paredzami. Tā izcilais amerikāņu fiziķis Alberts Maikel- sons 1894. gadā apgalvoja: «Visnozīmīgākie fizikas fundamentālie likumi un fakti ir jau atklāti. Tie tagad ir tik pamatoti pierādīti, ka visai maza ir varbūtība, ka tos varētu mainīt kādi jauni atklājumi. Iespējamie nākotnes atklājumi varētu būt saistīti tikai ar sestās decimālzīmes labojumiem kādā fizikālā konstantē.» [51] Un to viņš teicis vairāk nekā desmit gadus pēc pirmajiem Maikelsona— Morlija eksperimentiem, kas pierādīja gaismas ātruma konstanto vērtību un vēlāk k|uva par vienu no apstiprinājumiem Einšteina speciālajai relativitātes teorijai — 20. gs. jaunajai paradigmai!

Gadsimtu mijā notika neprognozētais — pilnīgi negaidīti iezīmējās jauni atklājumi, kas satricināja klasiskās fizikas, it īpaši mehāniskā determinisma paradigmas teorētiskos pamatus. Vēsturiskā determinisma un historicisma doktrīnas un orakulārās ilūzijas fatāli sagrāva indeterminisma paradigma, kas izrietēja gan no universālās nenoteiktības relācijas principa, gan no sinerģē- tikas, nelineāro sistēmu dinamikas un haosa teorijas pamatnostādnēm. Izrādī­jās, ka determinisms un indeterminisms ir reālā pasaulē komplementāri darbo­jošies principi. Augstas kompleksitātes pakāpes nelineārās dinamiskās sistēmās,

88. att. K. Fridrihsona akvarelis "Fūga"

89. att. Dž. Polloka glezna "Painture" (Gleznojums, 1948).

91- att. Japānu 17. gs. sino stila keramikas tējas ceremoniju tase.

94. illl /illi'MS IzhlrliN l'ivikl iii k:ililnmii is k-ilnns

95. alt. Daži eksotiski augu valsts fraktāli: a — ziedkāposti (c. Rotnanesco) |46);

99■ att. "Kā sākas Dzīvība" [77]. Sievietes olšūnas apaugļošanās aina. Zviedru pētnieka I-enarta Nilsona iegūtajā unikālajā mikrogrammā redzama olšūna un tās fraktālais apvalks. Apkārt vairāki desmiti spermatozoīdu, kuru mērķis — izlauzties caur olšūnas apvalku un ienest tajā tēva hromosomās kodēto ģenētisko "tekstu", lai tas komple-

100. att. "Kā sākas Dziviba" [77]. Attēlā redzams cilvēka embrijs piecdesmitajā dienā (t. i., septiņas nedēļas) |)ēc olšūnas apaugļošanas. Attēla augšējā da|ā — smadzeņu nervu šūnu masīva mikrogramma. Lieliski redzama gan smadzeņu sūnu fraktālā struktūra, gan embrija galvas asinsvadu fraktāļu "raksts".

104. att. Taifūna "Violeta" vēja ātruma vektoriālā sadalījuma satelituzoēmums, kas iegūts 1996. gadā ar speciāli izveidotu lāzera sistēmu, kas mēra jūras viļņošanās stiprumu un vēja virzienu. Uzņēmums ataino taifūnu Klusajā okeānā Japānas krastu tuvumā. Mērījumi tika veikti 190 000 punktos ("Scientific American", Dec. 1996, p. 25).

107 ,iti l> k'li> iili'vn-i "ItilnrL'irlin n>li" MOKI

pie kurām neapšaubāmi pieder ari cilvēces sociālās un ekonomiskās struktūras, determinētas likumsakarības darbojas tikai šo sistēmu līdzsvara stāvokļos. Turpretim, ja sistēma nonākusi nelīdzsvarotā stāvoklī, tās uzvedība un tālākā norišu virzība ir principā neprognozējama, jo vienmēr iespējami daudzi un dažādi attīstības scenāriji. Sistēmas nelinearitātes būtība izpaužas tieši ar to, ka nelīdzsvarotā stāvoklī pavisam niecīgi faktori, gadījuma fluktuācijas vai novir­zes var izraisīt katastrofālas sekas, neprognozējamas tālākās norises, lavlnveida pāreju uz kādu citu — pilnīgi jaunu un neparedzētu stāvokli. Šādās nelineārās sistēmās prognozēšanas iespējas var būt statistiski ticamas tikai relatīvi nelielos laika intervālos, kuros tās vēl pakļaujas lineāriem determinētiem likumiem.

Vēsturiskais determinisms un tā marksistiskais paveids, kas pazīstams kā vēsturiskais materiālisms, sakņojās ticībā, ka cilvēces vēstures norises ir tikpat stingri determinētas kā planētu kustība ap Sauli. Šis visvienkāršākais divu ķermeņu distancētas mijiedarbības mehānisms kļuva par prototipu un intelek­tuālo modeli deterministu domāšanā un pieejā nesalīdzināmi sarežģītāku norišu un parādību interpretācijai. To metaforiski ataino ar labi noregulēta pulksteņa darbību. Un, lūk, vēsturiskie deterministi šo primitīvo pulksteņa mehānisma modeli mēģināja izmantot nesalīdzināmi sarežģītāku sistēmu, kāda neapšau­bāmi ir sabiedrības attīstības vēsture, aprakstam. Cilvēku sabiedrība ir daudz- komponentu dinamiska sistēma, kuras virzību nosaka komplicēts nelineāru mij­iedarbību tikls, nevis vienkāršas, kauzāli determinētas lineāras cēloņu un seku ķēdes. Ja jau meklēt analoģijas ar dabas procesiem, tad ar cilvēces sabiedriskās virzības iespējamo modeli drīzāk varētu salīdzināt nevis planētu kustību ap Sauli, bet gan pārsteidzoši komplicētās un grūti prognozējamās meteoroloģiskās parādības tepat virs Zemes — atmosfērā. Tieši astronomija (debesu mehānika) un meteoroloģija veido savdabīgu pretmetu zinātņu pāri, no kurām pirmā sim­bolizē kārtību, otrā — haosu, un šim pārim atbilst tās raksturojošās vizuālās metaforas — pulkstenis un mākonis. Pirmajā darbojas strikti determinēti likumi, otrajā dominē statistisks indeterminisms. Astronomi var precīzi prognozēt pla­nētu kustību trajektorijas simtiem gadu nākotnē, bet meteorologi, izmantojot vismodernākās metodes — satelītu fotouzņēmumus, miljoniem novērojumu datus un superdatoru modelēšanu, var prognozēt gaidāmo laiku labākajā gadī­jumā tikai dažām dienām. Un kur tad vēl absolūti neprognozējamās stihiskās dabas parādības, ko izraisa «tauriņa efekts» nelīdzsvarotos apstākļos, — orkāni, tornado, taifūni, plūdi, lavīnas, zemestrīces (sk. 28. eseju)…

Šobrīd liekas vairāk nekā paradoksāli, ka Ņūtona mehāniskā determinisma valdīšanas gadsimtos zinātnieki nešaubīgi ticēja uz astronomijas likumiem bal­stītā determinisma modelim, spītīgi ignorējot acīmredzamās haotiskās parādī­bas un statistiskā indeterminisma izpausmes tepat uz Zemes.

Pārsteidzoši, cik bieži «vienīgās» patiesības apoloģētus padara aklus ticība pašu izdomātiem intelektuāliem modeļiem. Kā liecina zinātnes vēsture, kādā noteiktā laikmetā dominējošās paradigmas piekritēji ar gandrīz sakrālu pārlie­cību tic šis paradigmas intelektuālo modeļu vienreizībai un pareizībai. Tāpēc zināmā mērā pareizs ir dažkārt dzirdētais apgalvojums, ka uzskatu aprobežo­tību un sektantismu var sastapt ne vien reliģijā, bet arī zinātnē. Ticīgie palai­kam ir neiecietīgi pret citādi domājošiem.

Vēsturiskais determinisms īstenībā tikai konsekventi paplašināja mehāniskā determinisma modeļa izmantošanas robežas. Tomēr ir kāda būtiska atšķirība: ja mehāniskā determinisma fiasko tikai satricināja ticību līdz tam vispārpie­ņemtām zinātniskām doktrīnām un autoritātēm, tad vēsturiskā determinisma dogmas kļuva par ideoloģisku ieroci varaskāriem maniakiem un prasīja miljoniem cilvēku dzīvību. Cilvēcei nekas nav bīstamāks par orakulārām filo­zofijām un to pausto «vienīgo» patiesību apoloģētu centieniem pārveidot pasauli atbilstoši šai iluzorajai patiesībai.

Vēsturiskā determinisma dogmas sagrāvusi pati dzīve. Sabiedrības attīs­tība, tās sociālās un ekonomiskās struktūras neseko «astronomiskā pulksteņa» modeļa diktētiem deterministiskiem likumiem. Kā nevar iepriekš paredzēt stihiskas dabas parādības, tāpat orakulāro filozofiju ietvaros nav iespējams prognozēt sabiedrības virzības singulāros mezglu punktus un tādas nelaimes kā karus, revolūcijas, atentātus, bruņotus apvērsumus, atomkatastrofas vai pasaules biržu krahus. Šajos punktos, kad sabiedrības iekšējās spriedzes «gradients» sasniedzis nelīdzsvarotā stāvokļa kritiskās robežvērtības, sistēma evolucionē nelineāri un iespējami visdažādākie tālākās attīstības scenāriji.

Tipisks dinamiski nelīdzsvarotas neprognozējamas vēsturiskās virzības pie­mērs varētu būt Lielā franču revolūcija. Vai varēja paredzēt, ka šī revolūcija, kas sākās ar Bastīlijas ieņemšanu 1789. gadā brīvības, brālības un vienlīdzības vārdā, jau pēc īsa laika novedīs pie Robespjēra asiņainā terora un finālā radīs Napoleona impēriju, kas satricināja visas Eiropas feodālās karaļvalstis un vēlāk neatgriezeniski stimulēja nāciju pašapziņas atmodas un veidošanās procesus? Šādus procesus nekādi nevar iespiest vēsturiskā determinisma shematiskā modeļa Prokrusta gultā.

Marksistiskās orakulārās filozofijas stūrakmeņa — t. s. vēsturiskā mate­riālisma — doktrīna pēdējo fatālo triecienu saņēma 1991. gada augustā, kad pretēji deterministiskās attīstības pseidozinātniskajām prognozēm komunis­tiskā impērija Padomju Savienība pēc kuriozā 19. augusta puča spontāni sabruka dažu dienu laikā. Tas arī negaidīti un neprognozēti nodrošināja neatkarību Baltijas valstīm. Laikam neviena no orakulārajām un utopiskajām filozofijām cilvēces vēsturē nav bijusi tik maldīga un iluzora kā marksisms. Praktiski nav piepildījusies neviena no marksistu sludinātajām prognozēm. Nenotika gaidītā pasaules revolūcija; saskaņā ar Marksa ekonomisko doktrīnu kapitālistisko zemju iedzīvotājiem bija jānonāk galīgā nabadzībā, bet sociālis­tisko zemju iedzīvotājiem — pārpilnībā: dzīvē viss notika pretēji: tautu reliģiskās tradīcijas un nacionāli etniskās intereses izrādījās daudz stiprākas par ideologu sludināto ateismu un proletārisko internacionālismu; solītā cilvēces gaišā nākotne — komunisms pagaisa kā mirāža tuksnesī. Prāgas pavasara laika čehi loti trāpīgi definēja sociālismu: «Sociālisms ir smags un grūtību pilns ceļš no kapitālisma uz kapitālismu.»

Mūsu gadsimta pieredze ir apstiprin